CN109206521A

CN109206521A - A kind of immunotoxin and its preparation method and application

Info

Publication number: CN109206521A
Application number: CN201710552857.8A
Authority: CN
Inventors: 谢捷明
Original assignee: Fujian Medical University
Current assignee: Fujian Medical University
Priority date: 2017-07-07
Filing date: 2017-07-07
Publication date: 2019-01-15

Abstract

Of the invention is a kind of immunotoxin and its preparation method and application, and the immunotoxin includes toxicity molecule and carrier, and the toxicity molecule is the mutant of pumpkin protein or pumpkin protein.Wherein, the immunotoxin is that pumpkin protein or pumpkin protein mutant pass through the method being chemically crosslinked and the gene fusion expression of the two gone out immunotoxin at immunotoxin, or by gene engineering method with that can be combined the antibody coupling of tumour cell；And it is tested to rejection of the immunotoxin after anti-tumor activity, treating organs transplanting or autoimmune disease, for treating for infectious diseases caused by pathogen.Enhance using pumpkin protein or pumpkin protein mutant as specificity of the immunotoxin of lps molecule to target cell, the activity for killing target cell significantly improves, and usage amount can obviously reduce, and toxicity also just substantially reduces.

Description

A kind of immunotoxin and its preparation method and application

Technical field

The present invention relates to a kind of immunotoxins and its preparation method and application.

Background technique

Immunotoxin is that by the carrier molecule (such as antibody, cell factor) with guidance capability and have cytotoxicity Toxicity molecule (such as phytotoxin, bacteriotoxin etc.) coupling made of with specific cell killing ability hybrid molecule, It makes the toxicity molecule entrained by it reach target cell by the guiding role of carrier, then synthesizes in inhibition protein intracellular Lead to cell death, has the function that specific killing target cell without damaging normal tissue.

Ribosome inactivating protein (ribosome-inactivating protein, RIP) is usually divided into two by structure difference Type: I type RIP is single chain protein, such as trichosanthin；II type RIP is the dichain proteins connected by disulfide bond, such as ricin Element.I type RIP is a kind of RNA N- glycosidase or polynucleotides: adenosine glycosidase as the A chain of II type RIP, can be exclusively The N-C glycosidic bond between adenine base and ribose in hydrolysis eukaryocyte ribosomes 28S rRNA the 4324th, releases One adenine base inhibits the biosynthesis of protein to check elongation factor and ribosomal combination, has antibiosis It educates, antiviral and antitumor etc. various biologicals activity.Since the B chain of II type RIP has the function of agglutinin, can recognize normal The D- galactolipin of cell surface, thus have very big toxicity, it is limited in the intracorporal application of people.And I type RIP is not due to having B chain, it is smaller to the toxicity of human body, application prospect is had more in terms for the treatment of.

Pumpkin protein (cucurmosin, CUS) is the new I type ribosome inactivating protein extracted from pumpkin fruit, point Son amount 28,203Da, for alkaline single chain polypeptide glycoprotein.Over nearly 15 years, this seminar and Fujian Inst. of Matter Structure, Chinese Academy of Sciences are closed Make, systematically studies the structure and antitumor action of pumpkin protein: determining its amino acid sequence and DNA sequence dna, turn out list Crystalline substance simultaneously determines two, tertiary structure；Pumpkin protein has RNA N- glycosidase activity, can significantly inhibit kinds of tumor cells proliferation And induce its apoptosis, activity be better than trichosanthin, Luffa acutangula, luffin, amaranth seed ribosome inactivating protein and A variety of same albuminoids such as crotin and the strongest I type ribosome inactivating protein of anti-tumor activity of our seminar's discoveries.

However, pumpkin protein has no specificity to the effect of tumour cell, (i.e. to normal cell, there are still non-specific poison Property), a large amount of uses have toxicity to human body.Pumpkin protein and carrier molecule (mainly tumour antibody or cell factor) crosslinking are made For the major measure at immunotoxin being attenuation and synergy.

Summary of the invention

The purpose of the present invention is to provide a kind of pumpkin protein or pumpkin protein mutant by the method for chemical crosslinking with The antibody coupling of tumour cell can be combined to go out the gene fusion expression of the two at immunotoxin, or by gene engineering method Immunotoxin；And test the application of immunotoxin.

The object of the present invention is achieved like this:

The immunotoxin includes toxicity molecule and carrier, and the toxicity molecule is pumpkin protein or pumpkin protein Mutant.

Wherein, the immunotoxin is pumpkin protein or pumpkin protein mutant by the method for chemical crosslinking and can tie The antibody coupling of tumour cell is closed into immunotoxin, or goes out to be immunized by the gene fusion expression of the two by gene engineering method Toxin；

And rejection or autoimmune disease, use to immunotoxin after anti-tumor activity, treating organs transplanting It is tested in treating infectious diseases caused by for pathogen.

Specific pumpkin protein is coupled by the method and Trastuzumab of chemical crosslinking at immunotoxin T-CUS is prepared, and is used in combination In its inhibiting effect to the breast cancer cell of the Her-2 positive of measurement；Determine the encoding gene (Seq.ID of pumpkin protein No2), the gene order (Seq.IDno2) for being suitble to prokaryotic expression is synthesized after codon optimization.On this basis, it is inserted into prominent Become transformation (Seq.ID no3)) the recombination pumpkin protein mutant CUS (+245C) containing cysteine is given expression to, and this is mutated Body carries out chemical crosslinking with Trastuzumab and Cetuximab respectively and prepares immunotoxin, is respectively used to the measurement Her2 positive and high table Up to the inhibiting effect of the tumour cell of EGFR.

Enhance using pumpkin protein or pumpkin protein mutant as specificity of the immunotoxin of lps molecule to target cell, kills The activity for hurting target cell significantly improves, and usage amount can obviously reduce, and toxicity also just substantially reduces.In short, with pumpkin protein or south Melon protein mutant is that the immunotoxin of lps molecule has the advantages that synergy and attenuation, should be had broad application prospects.

Detailed description of the invention

The non-reduced SDS-PAGE (6% separation gel, 5% concentration glue) of Fig. 1 immunotoxin T-CUS and T-CU-SH

Wherein a:Marker；B:T-CUS-SH；C:T-CUS；D:T antibody

Specific embodiment

The content of present invention is described in detail with embodiment with reference to the accompanying drawings of the specification:

Embodiment 1: pumpkin protein and Trastuzumab coupling prepare immunotoxin T-CUS

Method: taking the herceptin antibody (21mg/ml) of 1.3ml, with the PB of the 20mmol/L of the NaCl containing 0.15mol/L (pH7.5) it is removed with same dilution dialysed overnight after buffer solution 1.3ml dilution and is reacted incoherent small molecule object Matter is added the SPDP solution (being dissolved with DMSO) of the 20mmol/L of 80 μ l for 1:3 in molar ratio, is stirred at room temperature anti-after dialysis is good 40min is answered, reaction product (T-PDP) removes the excessive SPDP of dereaction with above-mentioned buffer solution dialysed overnight.Separately the concentration is taken to be The CUS solution 1.8ml of 12.671mg/ml is in small beaker, and the 20mmol/L SPDP solution of 405 μ l is added in 1:10 in molar ratio, Reaction 40min is stirred at room temperature, reaction product (CUS-PDP) is slow with the AB (pH4.5) of the 0.1mol/L of the NaCl containing 0.1mol/L Solution dialysed overnight is rushed except the excessive SPDP of dereaction.21.6mg DTT is weighed, is dissolved with the sodium acetate of 500 μ l 0.01mol/L Afterwards, the final concentration of 50mmol/L for making DTT is added in the CUS-PDP solution dialysed, reaction 40min, reaction is stirred at room temperature The buffer solution dialysed overnight of product (CUS-PDP-SH) PB (pH7.5) of the 20mmol/L containing 0.15mol/LNaCl.It will be saturating The T-PDP solution analysed is mixed with CUS-PDP-SH solution, and the two molar ratio is about 1:5, is reacted 24 hours, and it is dense that 600 μ l are added The iodoacetamido amine aqueous solution that degree is 1mol/L makes its final concentration of 0.1mol/L, after terminating reaction 30min, takes supernatant molten after centrifugation Liquid, is diluted to 10ml with equilibrium liquid, is carefully equably added drop-wise on Ni Sepharose 6Fast Flow medium cylinder, loading Speed is less than 1ml/min；About 30ml is rinsed with equilibrium liquid after end of the sample, speed is about 2ml/min；With 30ml 15mmol/L Imidazoles PB buffer solution elution remove foreign protein；It is eluted again with the imidazoles PB buffer solution of 150mmol/L, collects sample 10ml, The dialysed overnight in equilibrium liquid, after 10 times of 0.1mol/LAB buffer solution (pH4.5) dilutions, from SP-Sepharose Fast The slow loading in the upper end of Flow cation exchange column, flow velocity are less than 1ml/min.The complete PB (pH7.5) with 20mmol/L of loading is flat Weigh about 15min, carries out gradient elution with the NaCl of 0.3mol/L, is in charge of collection.The sample of collection is detected with SDS-PAGE, is merged T-CUS is dispensed through the filtering with microporous membrane of 0.22um and is saved, and carries out protein quantification with BCA method.

As a result: protein electrophoresis after purification is shown in Fig. 1, is that SPDP method is crosslinked CUS and Trastuzumab antibody from figure c swimming lane, obtains Partial immunity toxin T-CUS is obtained, but still is mixed with more Trastuzumab antibody.

Embodiment 2: immunotoxin T-CUS anti-breast cancer activity measurement

Method: the human breast cancer cell line BT-474 cell (HER-2 is positive) and HCC1937 of logarithmic growth phase are thin respectively Born of the same parents (HER-2 is negative), are inoculated on 96 well culture plates, and it is 8000/100 μ L and 6000/100 μ L that every hole inoculation, which is respectively amount,.Training After supporting for 24 hours, experimental group adds the immunotoxin (T-CUS) of various concentration, pumpkin protein (CUS), Trastuzumab antibody (T) and corresponding dense The pumpkin protein of degree and the 100 μ L of mixture (T+CUS) of Trastuzumab, each concentration do 3 multiple holes；Negative control group adds nutrient solution 100 μ L, blank control wells add 200 μ L of nutrient solution, return to zero for instrument.After acting on 72h, supernatant is abandoned, every hole adds the 10% of pre-cooling Trichloroacetic acid 100 μ L, 4 DEG C of fixed 1h；Fixer is outwelled, aperture is washed with deionized water 3 times, and drying is air-dried；Every hole adds SRB liquid (Sulforhodamine B is made into 0.4% solution with 1% acetic acid) 50uL, is being placed at room temperature for 30 minutes, with 1% acetic acid Liquid is washed 4 times, is air-dried；It is dissolved with the non-buffered Tris lye (pH 10.5) of 100uL 10mmol/L, with microplate reader (BIO-RAD Product) absorbance value (A of each aperture is measured at 570nm wavelength₅₇₀), each group is averaged, and calculates inhibiting rate: inhibiting rate =(1- experimental group A₅₇₀/ control group A₅₇₀) × 100%.Statistical analysis is carried out with SPSS12.0, and calculates IC₅₀.Experiment repeats Once.

As a result: being shown in Table 1- table 5.Herceptin is in the people that concentration dependent inhibits the HER-2 positive in the low concentration range The growth of breast cancer BT-474 cell, acts on the IC of 7d₅₀For 0.124 ± 0.022mg/L, but reach after a certain concentration not with Concentration enhances and inhibiting rate increases, and can not thoroughly kill cell to 400 μ g/ml, inhibiting rate is maintained at 85% Left and right；And the human breast carcinoma HCC1937 cell of HER-2 feminine gender is increased to 400 μ g/ml grow it even if concentration without shadow It rings.CUS is in concentration dependent to the inhibition of BT-474 cell and HCC1937 cell, acts on the IC of 7d₅₀Respectively 0.325 ± 0.032 and 0.298 ± 0.062mg/L.Under same concentrations gradient, inhibiting effect of the immunotoxin T-CUS to BT-474 cell It is significantly stronger than CUS, T and CUS+T, IC of the immunotoxin T-CUS to BT-474 cell₅₀For 0.011mg/L, anti-BT-474 cell Activity be respectively 29.54 times and 11.27 times of CUS and T；And immunotoxin T-CUS needs very high concentration ability to HCC1937 cell There is inhibiting effect.

Table 1 T and T-PDP to the inhibiting effect of BT-474 and HCC1937 cell (N=3)

* P < 0.05VS T is to BT-474 cell；* P < 0.01VS T is to BT-474 cell；#P < 0.01 is thin to BT-474 Born of the same parents' VS HCC1937 cell

Table 2 CUS, CUS-SH to the inhibiting effect of BT-474 cell and HCC1937 cell (N=3)

* P < 0.05VS CUS, * * P < 0.01VS CUS

3 immunotoxin T-CUS of table to the inhibited proliferation of BT-474 cell (N=3)

* P < 0.05VS T-CUS-PDP, * * P < 0.01VS T-CUS-PDP,；#P < 0.01VS CUS, T, CUD+t

4 immunotoxin of table to the inhibiting effect of HCC1937 cell (N=3)

IC of 5 each sample of table to BT-474 cell and HCC1937 cell₅₀

* P < 0.05VS T-CUS-PDP, * * P < 0.01VS CUS, CUS-PDP, T；#P < 0.01VS CUS-SH, T

Embodiment 3: pumpkin protein mutant CUS (+245C) and Trastuzumab are coupled into immunotoxin T-CUS-SH and its resist Mammary gland cancer activity measurement

1. the clone of the cDNA of encoding mature pumpkin protein and sequencing weigh the fresh leaf of round musky gourd respectively Each two parts of the tooth that sub and elongated musky gourd seed is grown after incubating (every part of 200mg), a copy of it leaf and tooth are in liquid nitrogen It after grinding, is homogenized respectively with Trizol (Invitrogen company), by specification method extracts RNA, and uses Reverse Transcriptase kit (Fermentas:#K1622) the first chain of cDNA is synthesized；In addition a tooth and a leaf use kit respectively with after liquid nitrogen grinding (OMEGA:D3485-01) DNA is extracted.Respectively using above-mentioned four kinds of samples as template, with corresponding upstream and downstream primer, row Standard PCR After be sequenced.As a result the gene order (Seq.ID no2) of mature pumpkin protein is obtained, and the sequence of four kinds of samples is the same 's.

2. using pET32a carrier expression in escherichia coli pumpkin protein and measure its anti-tumor activity be suitble to big It is expressed in enterobacteria, pumpkin protein gene (Seq.ID no2) is subjected to codon optimization at gene order (Seq.ID no3), Then gene order (Seq.ID no4) of the synthesis both ends respectively containing NdeI/XhoI restriction enzyme site, through PCR amplification, uses NdeI It is separately recovered, and two segments T4DNA ligase is connected, connection product with after the XhoI double digestion gene and pET32a plasmid Conversion enters e. coli bl21 (DE3), and the selected clone on the LB plate containing ampicillin prepares plasmid in a small amount, passes through NdeI/XhoI double digestion and PCR filter out positive colony, and identify that gene order is Seq.ID no4 through sequencing, encode ammonia Base acid sequence is Seq.ID no5 (connecting 6 histidines after pET32a carrier).One plant of expression engineering bacteria BL21 (DE3) of picking/ PET32a-CUS is cultivated with LB culture medium 1L at 37 DEG C, until IPTG is added to final concentration of when A600 value is 0.8 1mmol/L, in 25 DEG C of shake culture 18h.Precipitating that thalline were collected by centrifugation, PBS solution use equilibrium liquid (50mM after washing 2 times Tris, 300mM Nacl) 20ml dissolution precipitating, it mixes well and lysozyme is added to final concentration of 1mg/ml, ultrasonication (15 DEG C, 20min) 2 times, centrifugation (10000rpm, 20min) takes supernatant, with being added slowly to Ni- after the filtering with microporous membrane of 0.45um On NTA column, pillar is washed with 30ml equilibrium liquid after loading, with the equilibrium liquid 30ml washing impurity-removing albumen of the imidazoles containing 15mM, finally It is slowly eluted with the equilibrium liquid of the imidazoles containing 150mM, is in charge of with the EP pipe of 1.5ml and receives sample (0.5-1ml/ pipe), the sample that will be collected into Product carry out SDS-PAGE, and the eluent containing destination protein is collected into dialysis tubing, and dialysis removes micro- with 0.22um after imidazoles Membrane filtration packing in hole saves, and carries out protein quantification by BCA method.With MTT measurement recombinant C US to the white blood of people's acute myelogenous The inhibited proliferation of sick cell line HL60 and Human B lymphoma cell line Raji.As a result every liter of inoculum can get 6- 12mg recombinates pumpkin protein, and recombinant C US has obvious anti-HL60 cell and Raji cytosis, and activity is slightly weaker than natural pumpkin egg White (table 6).

IC of the 6 recombinant C US of table to tumour cell₅₀

3. the preparation of the pumpkin protein mutant CUS-SH of cysteine is inserted into using pET32a-CUS as template, passes through PCR The design of downstream primer is inserted into TGC in CUS gene end, passes through the genetic fragment and pET32a of NdeI/XhoI double digestion respectively It after plasmid fragments recycling, is connected with T4DNA ligase, connection product conversion enters e. coli bl21 (DE3), in the west of benzyl containing ammonia Selected clone on the LB plate of woods, prepares plasmid in a small amount, filters out positive colony by NdeI/XhoI double digestion and PCR, and pass through Sequencing identifies that its gene order is Seq.ID no6, and the amino acid sequence of coding protein is that Seq.ID no7 (connects after CUS-SH There are 6 histidines).One plant of expression engineering bacteria BL21 (DE3)/pET32a-CUS-SH of picking, is carried out with LB culture medium 1L at 37 DEG C Culture, until IPTG to final concentration of 1mmol/L is added, in 25 DEG C of shake culture 18h when A600 value is 0.8.Thalline were collected by centrifugation Precipitating, PBS solution are precipitated with equilibrium liquid (50mM Tris, 300mMNacl) 20ml dissolution after washing 2 times, mix well and be added Lysozyme to final concentration of 1mg/ml, ultrasonication (15 DEG C, 20min) 2 times, centrifugation (10000rpm, 20min) takes supernatant, uses It is added slowly to after the filtering with microporous membrane of 0.45um on Ni-NTA column, washs pillar with 30ml equilibrium liquid after loading, with containing 15mM The equilibrium liquid 30ml washing impurity-removing albumen of imidazoles, is finally slowly eluted with the equilibrium liquid of the imidazoles containing 150mM, is managed with the EP of 1.5ml It is in charge of and receives sample (0.5-1ml/ pipe), the sample being collected into is subjected to SDS-PAGE, the eluent containing destination protein is collected into It analyses in pipe, dialysis is saved after removing imidazoles with the filtering with microporous membrane packing of 0.22um, and carries out protein quantification by BCA method. With srb assay measurement recombinant C US-SH to the inhibited proliferation of human breast cancer cell line BT-474 and HCC1937.As a result every liter thin Bacteria culture fluid can get 6-12mg and recombinate pumpkin protein, and recombinant C US has obvious anti-BT-474 and HCC1937 cytosis, living Property is slightly weaker than natural pumpkin protein (table 2).

4. CUS-SH and Trastuzumab coupling prepare immunotoxin T-CUS-SH and its anti-breast cancer activity measurement by embodiment 1 Method, herceptin antibody is connected into T-PDP with SPDP, dialysis removes the excessive SPDP of dereaction.The T-PDP to have dialysed is molten Liquid is mixed with recombination pumpkin protein mutant CUS-SH solution, and the two molar ratio is about 1:5, is reacted 24 hours, is used iodoacetamido After amine terminates reaction, exchanged respectively with Ni Sepharose6Fast Flow column and SP-Sepharose Fast Flow cation Column purification.The sample of collection is detected with SDS-PAGE, the T-CUS-SH pipe of purifying is merged, the miillpore filter mistake through 0.22um It dispenses and saves after filter, and carry out protein quantification with BCA method.T-CUS-SH pairs of immunotoxin of measurement measurement as described in Example 2 The inhibited proliferation of human breast cancer cell line BT-474 and HCC1937.The result shows that pumpkin protein mutant and Trastuzumab are even The efficiency for being unified into immunotoxin is higher than natural CUS (Fig. 1)；The activity of anti-breast cancer BT-474 and the HCC1937 cell of CUS-SH Slightly it is weaker than natural CUS (table 2, table 5), but immunotoxin T-CUS-SH is significantly stronger than T-CUS to the inhibiting effect of BT-474 cell (table 3, table 5), IC of the immunotoxin T-CUS-SH to BT-474 cell₅₀For 0.080mg/L, the activity point of anti-BT-474 cell It Wei not be 65.25 times and 15.50 times of CUS-SH and T；And immunotoxin T-CUS-SH needs very high concentration just to have in HCC1937 cell Inhibiting effect.

Embodiment 4: using pumpkin protein and its mutant as the immunotoxin of toxicity molecule immunity disease application

The antibody coupling of pumpkin protein or its mutant and T lymphocyte surface antigen (such as CD3, CD5, CD25) is at exempting from Epidemic disease toxin can be used for the immunity rejection for the treatment of organs transplanting, the GvHD disease of bone-marrow transplantation and autoimmune disease.

Embodiment 5: the application using pumpkin protein and its mutant as the immunotoxin of toxicity molecule in infectious diseases

Pumpkin protein or its mutant and pathogen (pathogenic microorganisms, helminth) face antigen or infected and lesion people The antibody coupling of the antibody of cell surface antigen can be used for treating corresponding pathogenic infection disease at immunotoxin.Such as It can be used to inhibition of HIV at immunotoxin with the antibody coupling of H IV coating protein gp160, gp120, gp41, with CD4 antibody coupling At immunotoxin alternative kill CD4⁺HIV⁺Cell.

Embodiment 6: using pumpkin protein or its mutant as the preparation of the recombinant immunotoxin of toxicity molecule and application

It expresses, can be prepared in appropriate host after the Gene Fusion of pumpkin protein or its mutant gene and carrier molecule Corresponding recombinant immunotoxin.Carrier molecule is targets neoplastic cells surface antigen (such as EGFR, HER-2, CD20, CD25, CD38 Deng) monoclonal antibody or can be with the ligand (such as some cell factors) in conjunction with tumor cell surface receptor, immunotoxin is available In the corresponding malignant tumour for the treatment of；Carrier molecule is the pathogenic immunocyte (such as T lymphocyte) of targeting, and immunotoxin can be used for Treat corresponding immunity disease (immunological rejection and autoimmune disease when organ transplant)；Carrier molecule is targeting The antibody of pathogen surface antigen or sick cell surface antigen, then immunotoxin can be used for treating corresponding pathogenic infection Disease.

Although the present invention is illustrated and illustrated to the present invention using specific embodiment and its alternative, but it should reason Solution, can be implemented without departing from the variations and modifications in scope of the invention.It is therefore understood that in addition to by with Outside the limitation of attached claim and its condition of equivalent, the present invention is not limited by in all senses.

SEQUENCE LISTING

<110>Medical University Of Fujian

<120>a kind of immunotoxin and its preparation method and application

<130>

<160> 7

<210> 1

<211> 244

<212> PRT

<213>cucurbitaceous plant Cucurbita musky gourd kind (Cucurbita moschata)

<400> 1

Asn Val Arg Phe Asp Leu Ser Ser Ala Thr Ser Ser Ser Tyr Lys Thr

1 5 10 15

Phe Ile Lys Asn Leu Arg Glu Ala Leu Pro Lys Asp Gly Lys Val Tyr

20 25 30

Asp Ile Pro Val Leu Leu Ser Thr Val Met Asp Ser Arg Arg Phe Ile

35 40 45

Leu Ile Asp Leu Val Asn Tyr Asp Gly Gln Ser Ile Thr Ala Ala Ile

50 55 60

Asp Val Leu Asn Val Tyr Ile Val Ala Tyr Ser Thr Gly Thr Val Ser

65 70 75 80

Tyr Phe Phe Gln Gln Val Pro Ala Gln Ala Pro Lys Leu Leu Phe Lys

81 85 90 95

Gly Thr Gln Gln Arg Thr Leu Pro Tyr Thr Gly Asn Tyr Glu Asn Leu

100 105 110

Gln Thr Ala Ala Lys Lys Leu Arg Glu Asn Ile Glu Leu Gly Leu Pro

115 120 125

Ala Leu Asp Ser Ala Ile Thr Thr Leu Phe His Tyr Asn Ala Glu Ala

130 135 140

Ala Ala Ser Ala Leu Leu Val Leu Ile Gln Thr Thr Ser Glu Ala Ala

145 150 155 160

Arg Phe Arg Tyr Ile Glu Leu Gln Ile Ala Asn Asn Val Gly Thr Lys

161 165 170 175

Phe Lys Pro Ser Gln Thr Ile Ile Ser Leu Glu Asn Asn Trp Ser Ala

180 185 190

Leu Ser Lys Gln Ile Gln Ile Ala Lys Asn Lys Asn Gly Gln Phe Glu

195 200 205

Thr Pro Val Ile Leu Ile Asp Pro Gln Gly Asn Arg Val Gln Ile Thr

210 215 220

Asn Val Thr Ser Asn Val Val Thr Gln Asn Ile Lys Leu Leu Leu Asn

225 230 235 240

Ile Gly Ala Thr

244

<210> 2

<211> 732

<212> DNA

<213>cucurbitaceous plant Cucurbita musky gourd kind (Cucurbita moschata)

<400> 2

aatgtgcgtttcgacttgtccagtgccacaagctcatcttacaaaacttttataaaaaat 60

ttgagggaagcacttccaaaggatgggaaagtgtatgacattcctgtgttactttcgact 120

gtaatggactcgaggcgcttcatactaatagatctcgtcaattacgacggtcaatccatc 180

acagctgccatagatgtgctaaacgtatatatcgtggcatacagcacaggcacagtgtcc 240

tacttttttcagcaagttccagctcaagctcccaaattgctgttcaaaggcactcagcaa 300

aggacacttccatacacaggtaattacgagaaccttcaaactgctgcaaaaaagctaaga 360

gaaaacatcgagcttggactcccagctctagacagtgccattaccaccttgtttcattac 420

aacgccgaggctgctgcttcagcgctgctcgttctcattcaaacgacctctgaagctgca 480

aggtttagatatatcgagctacagattgctaacaatgttgggacgaaatttaagccaagt 540

caaacgattataagcttggaaaacaactggtctgcgctctccaaacaaatccaaattgcc 600

aagaacaaaaatgggcaatttgaaactccagttatccttatagaccctcaaggaaatcgt 660

gttcaaataacaaacgtgacttcgaacgttgtgacccagaacatcaagctgctgctgaac 720

attggtgcaaca 732

<210> 3

<211> 732

<212> DNA

<213>artificial sequence

<400> 3

aacgtgcgttttgatctgagcagcgcgacctctagtagctataaaacctttattaaaaac 60

ctgcgtgaagcgctgccgaaagatggcaaagtgtatgatattccggtgctgctgagcacc 120

gtgatggatagccgtcgttttattctgattgatctggttaactatgatggccagagcatt 180

accgcggcgattgatgtgctgaacgtgtatattgtggcgtatagcaccggcaccgtgagc 240

tactttttccagcaggtgccggcgcaggcgccgaaactgctgtttaaaggcacccagcag 300

cgtaccctgccgtataccggcaactatgaaaacctgcagaccgcggcgaaaaaactgcgt 360

gaaaacattgaactgggcctgccggcgctggatagcgcgattaccaccctgtttcattat 420

aacgcagaagccgcagcaagcgcactgctggtgctgatccagaccaccagcgaagcagca 480

cgttttcgttatattgaactgcagattgcgaacaacgtgggcaccaaattcaaaccgagc 540

cagaccattattagcctggaaaacaactggagcgcgctgagcaaacagatccagattgcg 600

aaaaacaaaaacggccagtttgaaaccccggtgattctgattgatccgcagggcaaccgt 660

gtgcagattaccaacgtgaccagcaacgtggtgacccagaacattaaactgctgctgaac 720

attggcgcgacc 732

<210> 4

<211> 744

<212> DNA

<213>artificial sequence

<400> 4

catatgaacgtgcgttttgatctgagcagcgcgacctctagtagctataaaacctttatt 60

aaaaacctgcgtgaagcgctgccgaaagatggcaaagtgtatgatattccggtgctgctg 120

agcaccgtgatggatagccgtcgttttattctgattgatctggttaactatgatggccag 180

agcattaccgcggcgattgatgtgctgaacgtgtatattgtggcgtatagcaccggcacc 240

gtgagctactttttccagcaggtgccggcgcaggcgccgaaactgctgtttaaaggcacc 300

cagcagcgtaccctgccgtataccggcaactatgaaaacctgcagaccgcggcgaaaaaa 360

ctgcgtgaaaacattgaactgggcctgccggcgctggatagcgcgattaccaccctgttt 420

cattataacgcagaagccgcagcaagcgcactgctggtgctgatccagaccaccagcgaa 480

gcagcacgttttcgttatattgaactgcagattgcgaacaacgtgggcaccaaattcaaa 540

ccgagccagaccattattagcctggaaaacaactggagcgcgctgagcaaacagatccag 600

attgcgaaaaacaaaaacggccagtttgaaaccccggtgattctgattgatccgcagggc 660

aaccgtgtgcagattaccaacgtgaccagcaacgtggtgacccagaacattaaactgctg 720

ctgaacattggcgcgaccctcgag 744

<210> 5

<211> 253

<212> PRT

<213>artificial sequence

<400> 5

Met Asn Val Arg Phe Asp Leu Ser Ser Ala Thr Ser Ser Ser Tyr Lys

1 5 10 15

Thr Phe Ile Lys Asn Leu Arg Glu Ala Leu Pro Lys Asp Gly Lys Val

20 25 30

Tyr Asp Ile Pro Val Leu Leu Ser Thr Val Met Asp Ser Arg Arg Phe

35 40 45

Ile Leu Ile Asp Leu Val Asn Tyr Asp Gly Gln Ser Ile Thr Ala Ala

50 55 60

Ile Asp Val Leu Asn Val Tyr Ile Val Ala Tyr Ser Thr Gly Thr Val

65 70 75 80

Ser Tyr Phe Phe Gln Gln Val Pro Ala Gln Ala Pro Lys Leu Leu Phe

81 85 90 95

Lys Gly Thr Gln Gln Arg Thr Leu Pro Tyr Thr Gly Asn Tyr Glu Asn

100 105 110

Leu Gln Thr Ala Ala Lys Lys Leu Arg Glu Asn Ile Glu Leu Gly Leu

115 120 125

Pro Ala Leu Asp Ser Ala Ile Thr Thr Leu Phe His Tyr Asn Ala Glu

130 135 140

Ala Ala Ala Ser Ala Leu Leu Val Leu Ile Gln Thr Thr Ser Glu Ala

145 150 155 160

Ala Arg Phe Arg Tyr Ile Glu Leu Gln Ile Ala Asn Asn Val Gly Thr

161 165 170 175

Lys Phe Lys Pro Ser Gln Thr Ile Ile Ser Leu Glu Asn Asn Trp Ser

180 185 190

Ala Leu Ser Lys Gln Ile Gln Ile Ala Lys Asn Lys Asn Gly Gln Phe

195 200 205

Glu Thr Pro Val Ile Leu Ile Asp Pro Gln Gly Asn Arg Val Gln Ile

210 215 220

Thr Asn Val Thr Ser Asn Val Val Thr Gln Asn Ile Lys Leu Leu Leu

225 230 235 240

Asn Ile Gly Ala Thr Leu Glu His His His His His His

245 250

<210> 6

<211> 747

<212> DNA

<213>artificial sequence

<400> 6

catatgaacgtgcgttttgatctgagcagcgcgacctctagtagctataaaacctttatt 60

aaaaacctgcgtgaagcgctgccgaaagatggcaaagtgtatgatattccggtgctgctg 120

agcaccgtgatggatagccgtcgttttattctgattgatctggttaactatgatggccag 180

agcattaccgcggcgattgatgtgctgaacgtgtatattgtggcgtatagcaccggcacc 240

gtgagctactttttccagcaggtgccggcgcaggcgccgaaactgctgtttaaaggcacc 300

cagcagcgtaccctgccgtataccggcaactatgaaaacctgcagaccgcggcgaaaaaa 360

ctgcgtgaaaacattgaactgggcctgccggcgctggatagcgcgattaccaccctgttt 420

cattataacgcagaagccgcagcaagcgcactgctggtgctgatccagaccaccagcgaa 480

gcagcacgttttcgttatattgaactgcagattgcgaacaacgtgggcaccaaattcaaa 540

ccgagccagaccattattagcctggaaaacaactggagcgcgctgagcaaacagatccag 600

attgcgaaaaacaaaaacggccagtttgaaaccccggtgattctgattgatccgcagggc 660

aaccgtgtgcagattaccaacgtgaccagcaacgtggtgacccagaacattaaactgctg 720

ctgaacattggcgcgacctgcctcgag 747

<210> 7

<211> 254

<212> DNA

<213>artificial sequence

<400> 7

Met Asn Val Arg Phe Asp Leu Ser Ser Ala Thr Ser Ser Ser Tyr Lys

1 5 10 15

Thr Phe Ile Lys Asn Leu Arg Glu Ala Leu Pro Lys Asp Gly Lys Val

20 25 30

Tyr Asp Ile Pro Val Leu Leu Ser Thr Val Met Asp Ser Arg Arg Phe

35 40 45

Ile Leu Ile Asp Leu Val Asn Tyr Asp Gly Gln Ser Ile Thr Ala Ala

50 55 60

Ile Asp Val Leu Asn Val Tyr Ile Val Ala Tyr Ser Thr Gly Thr Val

65 70 75 80

Ser Tyr Phe Phe Gln Gln Val Pro Ala Gln Ala Pro Lys Leu Leu Phe

81 85 90 95

Lys Gly Thr Gln Gln Arg Thr Leu Pro Tyr Thr Gly Asn Tyr Glu Asn

100 105 110

Leu Gln Thr Ala Ala Lys Lys Leu Arg Glu Asn Ile Glu Leu Gly Leu

115 120 125

Pro Ala Leu Asp Ser Ala Ile Thr Thr Leu Phe His Tyr Asn Ala Glu

130 135 140

Ala Ala Ala Ser Ala Leu Leu Val Leu Ile Gln Thr Thr Ser Glu Ala

145 150 155 160

Ala Arg Phe Arg Tyr Ile Glu Leu Gln Ile Ala Asn Asn Val Gly Thr

161 165 170 175

Lys Phe Lys Pro Ser Gln Thr Ile Ile Ser Leu Glu Asn Asn Trp Ser

180 185 190

Ala Leu Ser Lys Gln Ile Gln Ile Ala Lys Asn Lys Asn Gly Gln Phe

195 200 205

Glu Thr Pro Val Ile Leu Ile Asp Pro Gln Gly Asn Arg Val Gln Ile

210 215 220

Thr Asn Val Thr Ser Asn Val Val Thr Gln Asn Ile Lys Leu Leu Leu

225 230 235 240

Asn Ile Gly Ala Thr Cys Leu Glu His His His His His His

245 250

Claims

1. a kind of immunotoxin, it includes toxicity molecule and carrier, it is characterised in that: the toxicity molecule be pumpkin protein or The mutant of pumpkin protein.

2. immunotoxin according to claim 1, it is characterised in that: its amino acid sequence of the pumpkin protein be based on Sequence shown in Seq.ID no1.

3. immunotoxin according to claim 2, it is characterised in that: the pumpkin protein is the pumpkin egg naturally extracted The pumpkin protein of white or chemically synthesized pumpkin protein or gene engineering expression.

4. immunotoxin according to claim 1, it is characterised in that: the mutant of pumpkin protein is that point mutation or missing are prominent Change or insertion mutation mutant obtained.

5. immunotoxin according to claim 1, it is characterised in that: the carrier is can be in conjunction with the antibody of tumour cell Or ligand, can in conjunction with pathogenic immune cell antibody or cell factor and resisting for pathogen or body disease cell can be combined Body.

6. any one preparation method to the immunotoxin according to claim 1~5: pumpkin protein or its mutant and load Body is coupled by chemical method into immunotoxin.

7. any one preparation method to the immunotoxin according to claim 1~5:, will be southern by genetic engineering means The gene of melon albumen or its mutant merges with vector gene and gives expression to immunotoxin.

8. any one purposes to the immunotoxin according to claim 1~5: for treating tumour.

9. any one purposes to the immunotoxin according to claim 1~5: treating organs transplanting after rejection or Autoimmune disease.

10. any one purposes to the immunotoxin according to claim 1~5: for infectivity disease caused by pathogen Disease.