CN109206490A - Protein sequence 11B09 and application thereof - Google Patents
Protein sequence 11B09 and application thereof Download PDFInfo
- Publication number
- CN109206490A CN109206490A CN201811156169.0A CN201811156169A CN109206490A CN 109206490 A CN109206490 A CN 109206490A CN 201811156169 A CN201811156169 A CN 201811156169A CN 109206490 A CN109206490 A CN 109206490A
- Authority
- CN
- China
- Prior art keywords
- axl
- cell
- protein sequence
- expression
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/001—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Abstract
The invention discloses a kind of protein sequences.The sequence is as shown in SEQ ID NO:1.Corresponding nucleic acid sequence is SEQ ID NO:2.The protein sequence, which has, is used for AXL inhibitor, inhibits AXL phosphorylation in A549 and MDA-MB-231 cell, inhibits the purposes of AXL phosphorylation in cell, further has the purposes for inhibiting activity of tumor cells.
Description
Technical field
The present invention relates to field of gene, more particularly, to protein sequence 11B09 and application thereof.
Background technique
Axl receptor is one of the member of tyrosine protein kinase family, it is considered to be the potential target of oncotherapy.Permitted
In more tumor patients, the cell-signaling pathways of AXL activated usually with promote lesion transfer, tumour drug resistance and the course of disease
Deteriorate related.And its height expression is found in a variety of solid tumors and leukaemia cancer cell, expression and disease process and
More quality is positively correlated after.Therefore, AXL can be used as the important target of oncotherapy, be controlled by finding AXL inhibitor for tumour
It is significant for treating and finding new therapy approach.
Currently, open report or be probably divided into two classes: 1.AXL micromolecular inhibitor in the AXL inhibitor ground, it is main
It is represented as R428, has carried out the clinical research of non-small cell lung cancer, melanoma and acute myeloid leukaemia.2.AXL antibody
And antibody analog, such as the YW327.6S2 monoclonal antibody of Genetech company, the ASP2215 of Astellas Pharma company its be
AXL-Fc fusion protein is antibody analog, and there are also the mutant MYD1 of the AXL-Fc of Stanford University's research and development.These two types of AXL's
Inhibitor has its respectively disadvantage: its specificity of 1.AXL micromolecular inhibitor is poor, therefore its is right when inhibiting the AXL target
Other similar target can also generate inhibition, and negative interaction is more.2.AXL antibody and antibody analog are glycoprotein, therefore in life
It is mainly expressed with mammalian cell during producing, production technology is complicated, Quality Control and high production cost.
Summary of the invention
The purpose of the present invention is to provide one kind to have convenient for production and high-efficient, the albumen with AXL inhibitor function
Sequence 11B09.
To achieve the above object, the present invention provides a kind of protein sequence, and the sequence is as shown in SEQ ID NO:1.
The present invention also provides the corresponding nucleic acid sequences of the protein sequence, and the sequence is as shown in SEQ ID NO:2.
The present invention also provides a strain expression vector, the recombinant vector containing the albumen.
Further, the carrier of the recombinant vector is PET-24a.
The present invention also provides a kind of preparation methods of protein sequence, which is characterized in that and step is,
SEQ ID NO:2 is connected on pET-24a carrier, the expression vector built, which is transferred in DH5 α, to be expanded
Increase, extracts expression vector and be transferred to BL21 building expression bacterial strain, positive colony is selected by resistance screening, carries out bacterial strain amplification, it will
The strain culturing of acquisition expands, and when OD600 value reaches 0.6-0.9, IPTG inducing expression 12-20h is added, and collects thallus and carries out
Bacterial cell disruption；Supernatant is collected by centrifugation, albumen shown in SEQ ID NO:1 is prepared through affinity chromatography in supernatant.
The present invention also provides the purposes that the protein sequence is used for AXL inhibitor.
There is the purposes for inhibiting AXL phosphorylation in A549 cell the present invention also provides the protein sequence.
There is the purposes for inhibiting AXL phosphorylation in MDA-MB-231 cell the present invention also provides the protein sequence.
There is the purposes for inhibiting activity of tumor cells the present invention also provides the protein sequence.
Applicant of the present invention has synthesized one section of albumen (being named as 11B09), has the function of AXL inhibitor, point
Minor structure is stablized, and molecular weight is smaller, 93aa, about 10kd, and non-glycoprotein can carry out prokaryotic expression, can in Ecoli system
It carries out solubility expression and expression quantity is higher, greatly reduce the complexity and cost of production technology.
NVSPPRRARVTDATETTITISWERSESTVVGLQVDAVPANGQTPIQRTIKPDVRSYTITGLQPGTDYK
IYLYTLTVVGKSAHGSSPVVIDAST SEQ ID NO:1；
Its corresponding nucleic acid sequence are as follows:
AATGTGAGCCCGCCGCGTCGTGCACGTGTTACCGATGCCACCGAAACCACCATCACCATTAGCTGGGAA
CGCAGCGAAAGCACCGTGGTGGGTCTGCAGGTGGATGCCGTTCCGGCCAATGGTCAGACCCCGATTCAGCGCACCAT
TAAACCGGATGTGCGCAGCTATACCATTACCGGTCTGCAGCCGGGCACCGACTACAAGATCTACCTGTACACCCTGA
CCGTGGTGGGTAAAAGCGCCCATGGTAGCAGCCCGGTTGTGATTGATGCCAGCACC
SEQ ID NO:2。
The technology path of albumen synthesis:
The DNA sequence dna (SEQ ID NO:2) of artificial synthesized 11B09 is connected on pET-24a carrier, the table built
It is transferred in DH5 α and is expanded up to carrier, extract expression vector and be transferred to BL21 building expression bacterial strain, selected by resistance screening
Positive colony carries out bacterial strain amplification, the bacterial strain of acquisition is expanded in 37 DEG C of cultures, when OD600 value reaches 0.6-0.9, is added
IPTG induction, 25 DEG C of low temperature express 16h, collect thallus and carry out bacterial cell disruption.Supernatant is collected by centrifugation, supernatant is through affinity chromatography
It can get 90% or more target protein.
The utility model has the advantages that albumen of the present invention can be in conjunction with treatment of cancer target AXL, and inhibit signal path downstream,
To inhibit activity of tumor cells, and proved on a cellular level.Its corresponding DNA sequence dna is conducive in Ecoli system simultaneously
Solubility expression is carried out in system.Not only AXL micromolecular inhibitor poor specificity had been overcome, but also has overcome the life of AXL antibody class inhibitor
Production. art is complicated, production Quality Control disadvantage at high cost, provides new direction to find AXL inhibitor.
Detailed description of the invention:
Fig. 1 is PET-24a Vector map；
Fig. 2 is the SDS-PAGE result figure of the cell conditioned medium of 11BO9 thallus expression；
Fig. 3 is the SDS-PAGE result figure for the cell conditioned medium that 11BO9 thallus is expressed after ni-sepharose purification；
Fig. 4 is the SDS-PAGE result figure after 11B09 is purified by flash；
Fig. 5 is 11B09 active determination in vitro result figure；
Fig. 6 is that 11B09 inhibits AXL phosphorylation assays result figure in A549-luc cell；
Fig. 7 is that 11B09 inhibits AXL phosphorylation assays result figure in MDA-MB-231-luc cell.
Specific embodiment
The embodiment of the present invention is described below in detail, the examples of the embodiments are intended to be used to explain the present invention, and cannot
It is interpreted as limitation of the present invention.In the examples where no specific technique or condition is specified, described according to the literature in the art
Technology or conditions or carried out according to product description.Reagents or instruments used without specified manufacturer is that can lead to
Cross the conventional products of commercially available acquisition.
The determination of activity of albumen:
AXL is the member for being tyrosine protein kinase family, and activity is by forming dimer or its ligand GAS6
Albumen is in connection and leads to the activation of downstream signaling pathway after making autophosphorylation, and plays biological effect.Therefore it to examine
Survey whether protein 11 B09 has the activity methods for inhibiting AXL.By detect albumen can inhibit the phosphorylation of AXL so as to cause
The foundation that the loss of activity of downstream signaling pathway determines as external activity experiment.Specific experiment operation passes through WB (Western
Blot) the phosphorylation small molecule suppression of AXL is during which introduced to compare the power of inhibitory activity to verify the protein content of AXL phosphorylation
Preparation R428 comes whether judgment models construct success as positive control, with this.
Particular technique process is as shown in the figure: being screened from candidate metastatic tumour cell line by FACS (flow cytometer)
The highly expressed cell line of AXL is used for the building of competent cell test model out, and by by candidate cell model respectively with three
Albuminoid and positive control and negative control co-culture and are added ligand GAS6 costimulation, abandon supernatant later, collect clasmatosis
WB test is carried out afterwards, in parallel the differential expression of relatively pAXL (the AXL albumen of phosphorylation).
The building of embodiment 1:PET-24a/11B09 expression bacterial strain
DNA sequence dna is converted by the protein sequence (SEQ ID NO:1) of 11B09 and optimized (selection Ecoli system is common
Codon, while balancing the distribution of GC base, it made to be evenly distributed, reduce the probability etc. that secondary structure is formed) after sequence
(SEQ ID NO:2) is separately added into NdeI (CATATG) and XhoI (CTCGAG) double digestion position in the rear and front end SEQ ID NO:2
Artificial synthesized SEQ ID NO:3 (giving company of Suzhou Jin Weizhi Biotechnology Co., Ltd), the sequence SEQ ID after synthesis after point
It is connected on the pET-24a carrier of same double digestion after NO:3 double digestion (NdeI and XhoI), is transferred to DH5 α phage amplification and mentions
Plasmid obtains expression vector.
Expression vector is converted into BL21 again, positive strain is screened by Kanamycin, obtains expression bacterial strain.The bacterium of acquisition
The a small amount of expressions of results of body are as shown in Figure 2.Wherein swimming lane 1 is molecular criteria albumen, and swimming lane 2 is on the cell of 11BO9 thallus expression
Clearly.From the SDS-PAGE electrophoresis of Fig. 2 it is found that having mesh in 10-15KD molecular weight in the cell conditioned medium of 11BO9 thallus expression
Protein expression, destination protein molecular weight is consistent with theoretical value (10.8KD).The expression bacterial strain built freezes -80 DEG C of refrigerators
It is spare.
Embodiment 2:11B09 expresses bacterial strain and expands culture and protein purification
Expression bacterial strain obtained by embodiment 1 is carried out to the recovery of bacterial strain by following steps, seed expands and IPTG induction hair
Ferment and purifying finally obtain purity > 90% the above object albumen, and protein SDS-PAGE result is detailed in Fig. 3 after purification.Wherein swim
Road 1 is 11BO9 albumen after purification, and swimming lane 2 is molecular criteria albumen.It knows from SDS-PAGE electrophoresis in 11BO9 thallus table
The cell conditioned medium reached, destination protein purity reaches 90% or more after ni-sepharose purification.
(1) it will freeze and dilute 100,000 times with LB liquid medium in -80 DEG C of purpose glycerol stock, be coated on 50 μ g/
On the agar plate of ml Kan (or scraping glycerol stock with sterilizing pipette tips, line on agar plate), it is inverted in 37 DEG C of insulating boxs
Overnight incubation (about 16h)；
(2) picking single colonie be inoculated in 50mL LB containing in 50 μ g/mL Kan fluid nutrient mediums (37 DEG C, under the conditions of 180rpm
Shaken overnight culture (about 16h)；
(3) the small seed bacterium solution of shaking of 4ml is inoculated in 400mL (1:100) containing in 50 μ g/mL Kan LB liquid mediums, 37
DEG C, when shaken cultivation reaches 0.7-0.8 to OD600 under the conditions of 250rpm；
(4) IPTG to final concentration of 0.5mM (1:2000) of 1M is added immediately, at 25 DEG C, training is vibrated under the conditions of 180rpm
Support 16h；
(5) bacterium solution is collected, 4 DEG C, 5500rpm is centrifuged 10min, abandons supernatant；
(6) PBS Buffer (PH7.4) weight of 1/20 (if inclusion body more can appropriate exaggerated scale) volume of culture is added
Outstanding thallus；
(7) it homogeneous crusher machine resuspended bacterium solution: is used under 2-8 DEG C of environment after cleaning pipeline, pressure (1000-1400bar) is anti-
It is crushed 3h again；
(8) broken liquid is collected, 4 DEG C, 10000rpm recycles supernatant after being centrifuged 20min；
(9) protein purification: the imidazole of 0.1% Triton X-100 and 10mM are added into supernatant, mixes
Afterwards, nickel column is crossed, after punching is flat, final (SDS-PAGE after 11B09 is purified by flash is tied with the imidazol of 50mM elution destination protein
Fruit is as shown in Figure 4).Wherein swimming lane 1 is molecule protein Marker, and swimming lane 2 is to penetrate obtained by TritonX-100+10mM imidazoles, swimming
Road 3 is 50mM imidazoles elution gained.The cell conditioned medium expressed from 11BO9 thallus known to SDS-PAGE electrophoresis, most of miscellaneous egg
White not nickel column combination penetrates outflow (such as swimming lane 2) under conditions of TritonX-100+10mM imidazoles, and destination protein has
His label achievees the purpose that separate in conjunction with nickel column, and elutes under the conditions of 50mM imidazoles, and the purity of 11BO9 reaches
90% or more (such as swimming lane 3).
Embodiment 3:11B09 active determination in vitro
1.FACS is screened and is verified AXL overexpression cell line
It is investigated by pertinent literature, applicant has selected the highly expressed candidate cell system of AXL: A549-luc, MDA-MB-
231-luc, SKOV3, NCI-H1975-luc, and verified by FACS, specific testing program is as follows:
1) prepared by cell sample: collecting 1 × 10 with 2ml round bottom EP pipe6A cell；800rpm is centrifuged 5min；Supernatant is abandoned, is added
Enter the sterile PBS of 1ml and washes cell precipitation；800rpm is centrifuged 5min；Supernatant is abandoned, the sterile PBS of 100 μ l is added, cell is resuspended；By cell
Suspension is transferred to 96 hole round bottom plates.
2) primary antibody (Anti-AXL antibody) is incubated for: Anti-AXL antibody, 4 DEG C of incubation 60min being added into cell suspension.
3) it cleans Anti-AXL antibody: 96 hole round bottom plates being centrifuged by 2000rpm × 3min, abandon supernatant；200 μ l are added
PBS washes away unbonded primary antibody, is centrifuged 2000rpm × 3min, abandons supernatant.
4) secondary antibody (PE Goat anti-mouse IgG) is incubated for: the secondary antibody of respective volume is added, piping and druming is resuspended, and 4 DEG C are kept away
Light is incubated for 1 hour；Centrifuge 2000g, 3 minutes, is centrifuged；Supernatant is removed, resuspension is cleaned with 200 μ l PBS, repeats three times.
5) machine testing on, testing result as figure 5 illustrates: AXL in tri- plants of cells of A549-luc, MDA-MB-231-luc, SKOV3
Height expression.What abscissa FL2-H as shown in Figure 5 was indicated is fluorescence signal value size detected, ordinate table under the channel
The cell number shown, due to testing principle be after cell and Anti-AXL antibodies are incubated for (antibody incubation is not added for control group) then on
Machine, when how detected the AXL antibody combined on cell fluorescence signal value more be bigger, two peak values in figure indicate in difference
Cell number under fluorescence signal.Such as shown in (a) of Fig. 5, the peak close to zero point, that is, left side is that SKOV3-control is expressed as not
Range with the cell signal value of the SKOV3 of AXL antibody incubation is 100-101, median 4.72, and will be glimmering within the scope of this
The cell readings of optical signal is determined as AXL- (i.e. the cell that AXL is not expressed) that the peak on the right of image is that SKOV3 and AXL antibody is incubated
The figure of upper machine testing after educating, most cell fluorescence signal strength is 10 as we know from the figure2-104, median 334, and press
The signal value of SKOV3 is integrated respectively according to the range of two horizontal lines, the cell number within the scope of AXL- fluorescence signal accounts for SKOV3
Total cell number ratio is that account for SKOV3 total cell number ratio be 99.5% to the cell number within the scope of 0.521%, AXL+ fluorescence signal.
It can thus be appreciated that SKOV3 is AXL overexpression cell line.Similarly determine that A549-luc (b), MDA-MB-231-luc are AXL high expression
(c), NCI-H1975-luc (d) is AXL low expression or the strain of non-expression cell.
2.AXL inhibitor inhibits AXL phosphorylation assays result in A549 cell
By the culture in complete medium (F-12K+10%FBS+0.8 μ g/ml puromycin) after A549 cell recovery
1-2 angel's cell confluency degree reaches 70-80%.Culture medium is removed, cleans cell with PBS, and serum free medium (F- is added
12K) starved overnight collects cell, the culture medium containing different inhibitor concentrations is added, cell is resuspended and is incubated at 37 DEG C
3h collects cell and carries out Western Blot (WB) experiment (Human Phospho-Axl (Y779) of primary antibody selection R&D company
Antibody).As a result see that the 11B09 of Fig. 6 inhibits AXL phosphorylation assays result figure in A549-luc cell.Inhibitor
Cnoc. the concentration that inhibitor and cell are incubated for altogether is indicated, pAxl indicates that the protein content of Axl phosphorylation, Total Axl indicate Axl
Total protein concentration, β-Actin indicate beta-actin expression quantity (system internal reference)；NC indicates that cell is not incubated for inhibitor altogether, PC-
R428 is Axl micromolecular inhibitor in this as positive control, and 11B09 is purpose albumen, and beneath 0,33.3,50,100 be suppression
Formulation concentrations unit is μM.β-Actin expressing quantity under each inhibitor concentration is consistent as we know from the figure, illustrates for WB's
Cell concentration is consistent with base state；Total Axl expressing quantity under various concentration of the R428 with 11B09 is consistent, shows
R428 and 11B09 does not influence the expression of Axl in A549-luc cell；By comparing pAXL under different inhibitor concentrations expression quantity
Known to: PC-R428 can inhibit the expression of pAXL in A549-Luc under the conditions of 50 μM, almost press down under the conditions of 100 μM
System；The expression of pAXL and amount in 11B09, inhibition A549-Luc that can be different degrees of under the conditions of 33.3,50,100 μM
Effect relationship.
In conclusion it can be seen that AXL inhibitor (11B09) and positive control PC-R428 points from the WB result of Fig. 6
It is not tested with 33.3,50,100 μM of concentration, by pAXL expression quantity it is found that PC-R428 is completely inhibited at 100 μM
The phosphorylation of AXL in A549-luc cell, so cell model building is reliable；Therefore it may indicate that 11B09 33.3,50,100
μM concentration under can inhibit the phosphorylation of AXL in A549-luc cell, and have dose-effect relationship；To be its activity examination in vivo
Go verifying 11B09 that the transfer of tumour cell A549-luc and drug resistance is inhibited to provide reliable basis in testing.
3.AXL inhibitor inhibits AXL phosphorylation assays result in MDA-MB-231 cell
1-2 angel cell will be cultivated after MDA-MB-231 cell recovery in complete medium (RPMI1640+10%FBS)
Convergence degree reaches 70-80%.Culture medium is removed, cleans cell with PBS, and the hungry training of serum free medium (RPMI1640) is added
It supports overnight, collects cell, the culture medium containing different inhibitor concentrations is added, cell is resuspended and is incubated for 3h at 37 DEG C, be added later
Cell is collected after the Gas6 costimulation 30min of final concentration of 2 μ g/mL carries out Western Blot (WB) experiment.As a result see Fig. 7's
11B09 inhibits AXL phosphorylation assays result figure in MDA-MB-231-luc cell.Wherein: Inhibitor Cnoc. indicates suppression
The concentration that preparation and cell are incubated for altogether, pAxl indicate that the protein content of Axl phosphorylation, Total Axl indicate Axl total protein concentration, β-
Actin indicates beta-actin expression quantity (system internal reference)；NC indicates that cell is not incubated for inhibitor altogether, and PC-R428 is that Axl is small
For molecule inhibitor in this as positive control, 11B09 is purpose albumen, and beneath 0,33.3,50,100 be inhibitor concentration list
Position is μM.β-Actin expressing quantity under each inhibitor concentration is consistent as we know from the figure, illustrates the cell concentration for WB test
It is consistent with base state；Total Axl expressing quantity under various concentration of the R428 with 11B09 is consistent, show R428 and
11B09 does not influence the expression of Axl in A549-luc cell；By comparing pAXL, expression quantity is known under different inhibitor concentrations:
PC-R428 can inhibit the expression of pAXL in MDA-MB-231-luc under the conditions of 50 μM, almost press down under the conditions of 100 μM
System；11B09 is able to suppress the expression of pAXL in MDA-MB-231-luc under the conditions of 100 μM.
In conclusion it can be seen that AXL inhibitor (11B09) and positive control PC-R428 points from the WB result of Fig. 7
It is not tested with 33.3,50,100 μM of concentration, by pAXL expression quantity it is found that R428 is in 50,100 μM of complete inhibition cells
The phosphorylation of MDA-MB-231-luc, so cell model building is reliable；Therefore it may indicate that 11B09 can part at 100 μM
Inhibit the phosphorylation of MDA-MB-231-luc；Thus to go verifying 11B09 to inhibit tumour cell in its in vivo activity test
The transfer of MDA-MB-231-luc and drug resistance provide reliable basis.
Although the embodiments of the present invention has been shown and described above, it is to be understood that above-described embodiment is example
Property, it is not considered as limiting the invention, those skilled in the art are not departing from the principle of the present invention and objective
In the case where can make changes, modifications, alterations, and variations to the above described embodiments within the scope of the invention.
SEQUENCE LISTING
<110>Wei Ming biological medicine Co., Ltd
<120>protein sequence 11B09 and application thereof
<130> WMSM-18004-CNI
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 93
<212> PRT
<213>artificial synthesized
<400> 1
Asn Val Ser Pro Pro Arg Arg Ala Arg Val Thr Asp Ala Thr Glu Thr
Thr Ile Thr Ile Ser Trp Glu Arg Ser Glu Ser Thr Val Val Gly Leu
Gln Val Asp Ala Val Pro Ala Asn Gly Gln Thr Pro Ile Gln Arg Thr
Ile Lys Pro Asp Val Arg Ser Tyr Thr Ile Thr Gly Leu Gln Pro Gly
Thr Asp Tyr Lys Ile Tyr Leu Tyr Thr Leu Thr Val Val Gly Lys Ser
Ala His Gly Ser Ser Pro Val Val Ile Asp Ala Ser Thr
<210> 2
<211> 279
<212> DNA
<213>artificial synthesized
<400> 2
aatgtgagcc cgccgcgtcg tgcacgtgtt accgatgcca ccgaaaccac catcaccatt 60
agctgggaac gcagcgaaag caccgtggtg ggtctgcagg tggatgccgt tccggccaat 120
ggtcagaccc cgattcagcg caccattaaa ccggatgtgc gcagctatac cattaccggt 180
ctgcagccgg gcaccgacta caagatctac ctgtacaccc tgaccgtggt gggtaaaagc 240
gcccatggta gcagcccggt tgtgattgat gccagcacc 279
Claims (9)
1. protein sequence, which is characterized in that the sequence is as shown in SEQ ID NO:1.
2. the corresponding nucleic acid sequence of protein sequence described in claim 1, which is characterized in that the sequence such as SEQ ID NO:2 institute
Show.
3. a strain expression vector, which is characterized in that the recombinant vector containing albumen described in claim 1.
4. expression vector as claimed in claim 3, which is characterized in that the carrier of the recombinant vector is PET-24a.
5. a kind of preparation method of protein sequence described in claim 1, which is characterized in that step is,
SEQ ID NO:2 is connected on pET-24a carrier, the expression vector built is transferred in DH5 α and is expanded, and mentions
It takes expression vector to be transferred to BL21 building expression bacterial strain, positive colony is selected by resistance screening, bacterial strain amplification is carried out, by acquisition
IPTG inducing expression 12-20h is added when OD600 value reaches 0.6-0.9 in strain culturing amplification, and it is broken to collect thallus progress thallus
It is broken；Supernatant is collected by centrifugation, albumen shown in SEQ ID NO:1 is prepared through affinity chromatography in supernatant.
6. the purposes that protein sequence described in claim 1 is used for AXL inhibitor.
7. protein sequence described in claim 1 has the purposes for inhibiting AXL phosphorylation in A549 cell.
8. protein sequence described in claim 1 has the purposes for inhibiting AXL phosphorylation in MDA-MB-231 cell.
9. protein sequence described in claim 1 has the purposes for inhibiting activity of tumor cells.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811156169.0A CN109206490A (en) | 2018-09-29 | 2018-09-29 | Protein sequence 11B09 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811156169.0A CN109206490A (en) | 2018-09-29 | 2018-09-29 | Protein sequence 11B09 and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109206490A true CN109206490A (en) | 2019-01-15 |
Family
ID=64982473
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811156169.0A Withdrawn CN109206490A (en) | 2018-09-29 | 2018-09-29 | Protein sequence 11B09 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109206490A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8470966B2 (en) * | 2007-08-10 | 2013-06-25 | Protelica, Inc. | Universal fibronectin type III binding-domain libraries |
| CN107531786A (en) * | 2014-12-18 | 2018-01-02 | 卑尔根技术锻造股份公司 | Anti- AXL antagonist antibodies |
-
2018
- 2018-09-29 CN CN201811156169.0A patent/CN109206490A/en not_active Withdrawn
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8470966B2 (en) * | 2007-08-10 | 2013-06-25 | Protelica, Inc. | Universal fibronectin type III binding-domain libraries |
| CN107531786A (en) * | 2014-12-18 | 2018-01-02 | 卑尔根技术锻造股份公司 | Anti- AXL antagonist antibodies |
Non-Patent Citations (1)
| Title |
|---|
| 吴彦君等: "Axl激酶抑制剂的研究进展", 《中国新药杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2592063B2 (en) | Hybrid receptor for efficient determination of ligand, antagonist or agonist | |
| JP3537141B2 (en) | Interaction-based capture system for separation of new proteins | |
| Hanaka et al. | Nuclear-localization-signal-dependent and nuclear-export-signal-dependent mechanisms determine the localization of 5-lipoxygenase | |
| CN107556387A (en) | Resisting GPC 3 and the double targeting antibodies of CD3 specificity, the minicircle dna containing this pair of targeting antibodies expression cassette and application | |
| CN109913422A (en) | A kind of immunocyte comprising tumour antigen identification receptor and its application | |
| CN110343665A (en) | A kind of novel C AR-T cell and its application | |
| CN101643511A (en) | Fusion protein for inhibiting telomerase activity, preparation and application thereof | |
| CN107903307A (en) | A kind of high-affinity EDB FN targeting proteins peptides and its application | |
| CN109206490A (en) | Protein sequence 11B09 and application thereof | |
| CN109160941A (en) | Protein sequence 17E11 and application thereof | |
| CN109206489A (en) | Protein sequence 12G12 and application thereof | |
| Weber et al. | Ectopic expression of a constitutively active Cdc42 small GTPase alters the morphology of haploid and dikaryotic hyphae in the filamentous homobasidiomycete Schizophyllum commune | |
| CN107236046A (en) | A kind of recombinant human endostatin fusion protein and its preparation method and application | |
| CN101768210A (en) | Tumor targeting polypeptide and preparation method thereof | |
| CN101143895A (en) | Polypeptide with tumour targeting effects and preparation method thereof | |
| CN110487877A (en) | A method of screening anti-trioxypurine small molecule compound | |
| CN107502658A (en) | The method that expression for EPCR genes or EPCR albumen prepares cancer diagnosis and treatment product | |
| CN103937871A (en) | Application of SRRP35 gene and expression product thereof to cancer diagnosis and treatment | |
| CN113698486A (en) | MMP-9 nano antibody, preparation method and application thereof | |
| CN104945496B (en) | A kind of polypeptide and its application in the preparation and purification antibody special to EHD2 | |
| JP2003527824A (en) | Novel cells signaling polypeptides and nucleic acids | |
| KR101699105B1 (en) | A method for the diagnosis of pancreatic cancer using ALPPL2 protein | |
| CN111378039A (en) | Antibody for treating malignant tumor and application thereof | |
| CN108047330A (en) | The monoclonal antibody of Cry2Ah1 albumen | |
| CN106620651A (en) | Application of heat shock protein gp96 in therapy of ulcerative colitis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20190115 |