CN109200042A - Application of the Determination of pterodontic acid in preparation prevention or treatment flu pharmaceutical - Google Patents

Application of the Determination of pterodontic acid in preparation prevention or treatment flu pharmaceutical Download PDF

Info

Publication number
CN109200042A
CN109200042A CN201710544207.9A CN201710544207A CN109200042A CN 109200042 A CN109200042 A CN 109200042A CN 201710544207 A CN201710544207 A CN 201710544207A CN 109200042 A CN109200042 A CN 109200042A
Authority
CN
China
Prior art keywords
acid
pterodontic
determination
influenza virus
influenza
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710544207.9A
Other languages
Chinese (zh)
Inventor
李菁
王新华
潘锡平
杨子峰
姜志宏
关文达
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Institute Of Respiratory Disease
First Affiliated Hospital of Guangzhou Medical University
Original Assignee
Guangzhou Institute Of Respiratory Disease
First Affiliated Hospital of Guangzhou Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Institute Of Respiratory Disease, First Affiliated Hospital of Guangzhou Medical University filed Critical Guangzhou Institute Of Respiratory Disease
Priority to CN201710544207.9A priority Critical patent/CN109200042A/en
Publication of CN109200042A publication Critical patent/CN109200042A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C51/00—Preparation of carboxylic acids or their salts, halides or anhydrides
    • C07C51/42—Separation; Purification; Stabilisation; Use of additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/28—Asteraceae or Compositae (Aster or Sunflower family), e.g. chamomile, feverfew, yarrow or echinacea

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention belongs to field of medicaments, disclose a kind of sesquiterpenoid --- new application of the Determination of pterodontic acid in preparation Tamiflu.Inventor has found that Determination of pterodontic acid can obviously inhibit the duplication of a variety of subtype influenza virus, and be effectively improved inflammatory response caused by influenza virus for the first time, and disclosing Determination of pterodontic acid can be used for the prevention and treatment of influenza.The active constituent derives from plant, and raw material is cheap and easy to get, no overt toxicity, great application prospect.

Description

Application of the Determination of pterodontic acid in preparation prevention or treatment flu pharmaceutical
Technical field
The invention belongs to field of medicaments, it is related to preventing or treating flu pharmaceutical and a kind of new medical use of sequiterpene, Specifically, referring to application of the Determination of pterodontic acid in preparation prevention and treatment flu pharmaceutical.
Background technique
Influenza (abbreviation influenza) is the acute respiratory disease as caused by influenza virus, is had highly infectious. Human influenza virus is divided into first, second, the third three types, and wherein Flu-A threatens the mankind maximum, and H1N1 is most important seasonal first Type influenza virus.Global annual flu episode rate is about 5%-10% in adult, is about 20%-30% in children, in height It is easily caused in danger crowd such as infant, the elderly or chronic in hospital and dead.The annual influenza in the whole world causes about 3,000,000 To 5,000,000 serious diseases and about 250,000 to 500,000 death, the life and health of the mankind is seriously threatened, and tremendous economic is caused to damage It loses.The most effectual way of prevention and control influenza spread is vaccine inoculation, but since the antigenic variation ability of influenza virus is strong, The production of vaccine generates novel influenza infection for antigenic drift and variation and does not produce only for popular influenza subtype strain The protective effect of life body, and it is low to people at highest risk such as old man and the protective effect of hypoimmunity children.Therefore, influenza epidemic disease Seedling flu-prevention has certain hysteresis quality, and protective rate is also limited.Currently used for the chemicals for the treatment of of influenza, there are two main classes: Adamantane amine (amantadine and Rimantadine) and neuraminidase inhibitor (Oseltamivir and zanamivir), usually need to be Disease early stage (after symptom appearance in 48 hours) administration, and there is drug resistance since action target spot is single, significantly impact curative effect. Therefore, clinical urgent need has the novel Tamiflu of different target spots.
During influenza infection, host starts inherent immunity reaction and generates antiviral agent (such as interferon) and inflammation To inhibit the virus invaded, appropriate inflammatory reaction is conducive to the removing of influenza virus for disease reaction.But excessive inflammatory response can draw It rises " inflammatory factor storm ", leads to the serious tissue damage of body, this is one of the main reason for influenza leads to death.Therefore, Research hotspot is had become as the medicament research and development of target to inhibit influenza virus to induce host's generation excessive inflammatory response.Such drug Modulate host inherent immunity reacts the secretion of relevant signal path and inflammatory factor, is not directed to pathogen, therefore is not likely to produce resistance to Medicine.
Determination of pterodontic acid (Pterodontic acid, I) is a kind of sesquiterpenoid, it is known that has antibacterial, antitumor etc. Bioactivity [Acta Pharmaceutica Sinica, 2007,42 (5): 511-515；University Of Tianjin, 2004, Liu Yong refined Master's thesis].This product inhibits stream Influenza Virus, the effect for lowering the inflammatory response that influenza virus mediates have not been reported.Determination of pterodontic acid has the following structure formula:
Summary of the invention
The purpose of the present invention is to provide a kind of novel Tamiflu of mechanism of action.
By the random screening to a large amount of natural products, inventor has found for the first time, and Determination of pterodontic acid, which has, inhibits influenza virus Duplication, the activity for lowering the inflammatory response that influenza virus mediates, can become a kind of safely and effectively novel Tamiflu.
The present invention provides Determination of pterodontic acid in preparation for preventing or treating the new opplication in flu pharmaceutical.
Said medicine can be made into any dosage form pharmaceutically allowed, including alimentary canal, respiratory tract and injecting medicine-feeding form, packet Include but be not limited to capsule, tablet, soft capsule, dripping pill, granule, syrup, oral solution, inhalant, spray, emulsifiable paste, creme, Gelling agent, injection etc..
According to needed for clinical application, said medicine contains the Determination of pterodontic acid of suitable dosage, and deal in a medicament is 0.1%~99.9% (w/w), also can compatibility other medicinal licenses active material；Preparations carrier or auxiliary material include but is not limited to Filler, binder, disintegrating agent, lubricant, cosolvent etc..Wherein, starch, dextrin, Icing Sugar, pre- glue specifically may be selected in filler It is one or more to change starch, lactose, glucose, micro- smart cellulose, calcium carbonate, calcium sulfate, calcium bicarbonate etc.；Binder specifically may be used Select hydroxypropyl methylcellulose, povidone, starch slurry, dextrin slurry, rubber cement, syrup, polyethylene glycol, sodium alginate, Arabic gum, peach Glue etc. is one or more；Crospovidone, croscarmellose sodium, hydroxypropul starch, carboxylic first specifically may be selected in disintegrating agent Sodium starch, tartaric acid, citric acid, sodium bicarbonate, sodium carbonate, acid anhydrides etc. are one or more；The optional talcum powder of lubricant, stearic acid Magnesium, atoleine, superfine silica gel powder, polyethylene glycol are one or more；The optional sodium bicarbonate of cosolvent (potassium), sodium carbonate (potassium), hydrogen Sodium oxide molybdena (potassium), tween, vegetable oil etc. are one or more.
The influenza virus includes but is not limited to first, influenza B virus and avian influenza virus；First, the influenza B disease Poison and avian influenza virus include but is not limited to human influenza virus H1N1 hypotype, H3N2 hypotype, avian influenza virus H6N2, H7N3, H9N2 hypotype and INFB type, human influenza virus's H1N1 hypotype includes new H1N1virus.
The invention discloses a kind of sesquiterpenoids --- new application of the Determination of pterodontic acid in preparation Tamiflu.Hair Bright people has found that Determination of pterodontic acid can obviously inhibit the duplication of a variety of subtype influenza virus, and be effectively improved influenza virus and lead for the first time The inflammatory response of cause, disclosing Determination of pterodontic acid can be used for the prevention and treatment of influenza.The active constituent derives from plant, and raw material is inexpensive It is easy to get, no overt toxicity, great application prospect.
The preparation method of Determination of pterodontic acid provided by the invention is the following steps are included: take the dry medicinal material of laggera pterodonta, with 90% wine Smart seepage pressure effects obtain medicinal extract, and medicinal extract, which adds water and stirs, to be made to be suspended, and successively use petroleum ether, ethyl acetate, extracting n-butyl alcohol, recycle molten Agent；Ligroin extraction plus silica gel are mixed into sample in right amount, dry column-packing (200~300 mesh) uses petroleum ether-ethyl acetate under normal pressure Mixed solvent gradient elution, solvent burden ratio are followed successively by 1:0,20:1,10:1 and 5:1；It receives, is concentrated respectively；Petroleum ether elutes section Continue to be separated repeatedly with silica gel column chromatography, petroleum ether and chloroform elution is used alternatingly, instruct to merge with TLC, concentration obtains white Crystalline powder is Determination of pterodontic acid.
Present invention experiment includes resisiting influenza virus experiment and anti-inflammatory experiment two parts.
Antiviral breeding: the present invention verifies Determination of pterodontic acid infected by influenza using cytopathic-effect inhibition assay in the therapeutic mode The inhibiting effect of duplication observes Determination of pterodontic acid to the toxicity of mdck cell and to influenza using Oseltamivir as positive control drug The inhibiting effect of virus replication.Toxic concentration (the TC of half for measuring Determination of pterodontic acid using mtt assay50) it is 278.9 μ g/mL, smelly spirit Red acid inhibits the medium effective concentration IC of multiple subtype influenza virus (A/PR/8/34,09H1N1, season H1N1 etc.)50For 9.47~ 37.14 μ g/mL, it was demonstrated that infected by influenza has obvious inhibiting effect to Determination of pterodontic acid in the therapeutic mode, selects index SI=7.5 ~29.5, efficiently for low toxicity.Influenza neuraminidase (NA) Inhibition test show Determination of pterodontic acid to the inhibitory activity of NA, IC50=668.1 μ g/ml.Immunofluorescence experiment shows that Determination of pterodontic acid (100 μ g/mL) can inhibit the output of influenza virus RNPs core.
Anti-inflammatory experiment: using the HEK293 cell line of the reporter plasmid of the NF- κ B starting luciferase expression of stable transfection The regulating and controlling effect with virus replication associated signal paths of Determination of pterodontic acid infected by influenza induction is studied, respectively with 20ng/ml's TNF-α and influenza virus H1N1 stimulation, while various dose Determination of pterodontic acid (20 μ g/ml, 40 μ g/ml) intervention is given, find Drug can inhibit the expression of the luciferase of NF- κ B mediation, and be in dose-dependence.It prompts drug to have and inhibits NF- κ B letter The pharmacological activity of number signal pathway activated.Since the expression of the height of NF- κ B signal Pathway Activation and proinflammatory factor is closely related, pass through QRT-PCR method measures Determination of pterodontic acid for the proinflammatory factor expression that mediates after influenza infection it is experimentally confirmed that different agent Amount Determination of pterodontic acid (6.25 μ g/ml, 25 μ g/ml, 100 μ g/ml) can obviously inhibit H1N1 virus and H9N2 virus infection A549 The unconventionality expression of the cellular inflammation factor (IL-6, IP-10, MIP-1, MCP-1), and be in dose-dependence.
Detailed description of the invention
The influence of Fig. 1 Determination of pterodontic acid infected by influenza RNPs core output.
The influence for the NF- κ B signal signal pathway activated that Fig. 2 Determination of pterodontic acid mediates TNF-α and influenza virus H1N1.
The inflammation that Fig. 3 is mediated using the detection Determination of pterodontic acid infected by influenza H1N1 infection of real-time quantitative PCR (qRT-PCR) technology The influence that inflammation factor IL-6, IP-10, MIP-1 α, MCP-1 are expressed.
The inflammation that Fig. 4 is mediated using the detection Determination of pterodontic acid infected by influenza H9N2 infection of real-time quantitative PCR (qRT-PCR) technology The influence that inflammation factor CCL-5, IP-10, MIP-1 α, TNF-α, MCP-1 are expressed.
Specific embodiment
Embodiment 1: the preparation of Determination of pterodontic acid
Dry medicinal material (the picking up from the Kunming suburbs) 1kg of laggera pterodonta is taken, obtains medicinal extract 135g by 90% alcohol seepage pressure effects；Leaching Cream adds the stirring of 800ml water to make to be suspended, and successively uses petroleum ether, ethyl acetate, extracting n-butyl alcohol (each 5 × 500ml), recycling design； Ligroin extraction plus silica gel are mixed into sample in right amount, dry column-packing (200~300 mesh, 650g) uses petroleum ether-acetic acid second under normal pressure Ester mixed solvent gradient elution, solvent burden ratio are followed successively by 1:0,20:1,10:1 and 5:1；It receives, is concentrated respectively；Petroleum ether elution Duan Chongyue 3.8g continues to be separated repeatedly with silica gel column chromatography, and petroleum ether and chloroform elution is used alternatingly, and is instructed to merge (iodine with TLC Smoked colour developing), concentration obtains white crystalline powder (0.1g), Determination of pterodontic acid is accredited as through NMR spectra parsing:
1H-NMR (400MHz, CDC13) δ ppm:6.31 (1H, br s, H-12), 5.68 (1H, br s, H-12), 5.20 (1H, br s, H-6), 1.16 (3H, s, H-14), 1.18 (3H, d, J=8.0Hz, H-15), 3.32 (1H, m, H-7), 2.47 (1H, m, H-4), 2.0~1.4 (10H, m, H-1,2,3,8,9)；13C-NMR(100MHz,CDCl3) δ ppm:42.87 (C-1), 17.52(C-2),33.20(C-3),38.14(C-4),144.90(C-5),122.80(C-6),38.20(C-7),26.60(C- 8),41.51(C-9),34.41(C-10),149.14(C-11),171.93(C-12),125.76(C-13),27.22(C-14), 23.19(C-15).Above-mentioned data consistent with literature value [Acta Pharmaceutica Sinica, 2007,42 (5): 511-515；Yunnan plant research, 1996,18 (3): 349-352].
Embodiment 2: Determination of pterodontic acid inhibits influenza activity
1. material
Cell: dog kidney cells (Madin Darby Canine Kidney, MDCK) cell is trained quoted from Chinese Academy of Sciences typical case Yang Wu preservation committee cell bank.
Virus:
Ichi plants of PR8 plants of influenza A virus (A/PR/8/34, H1N1), A type H3N2 influenza virus A (A/Aichi/2/ 68, H3N2) it is purchased from American classic culture collecting center (American Type Culture Collection, ATCC)；Newly H1N1virus strain (A/Guangzhou/GIRD07/09, H1N1, Genebank No.HM014332.1) is that this room is faced Bed separation strains, above-mentioned strain influenza virus expand in the chick embryo allantoic cavity by being inoculated in 9 ages in days, 35 DEG C of incubation 2d, harvest urine Cyst fluid.Virus is titrated with mdck cell, the median infective dose (TCID50/ of these strains is determined with cytopathic-effect inhibition assay (CPE) 100 μ L) as viral original titer.
Reagent and drug:
DMSO (Sigma Co., USA)；MEM (GIBCO company of the U.S.) lot number: 8114414；Fetal calf serum (U.S. GIBCO Company) lot number: 10099；PBS (GIBCO company of the U.S.) lot number: 20150122；1mg/ml TPCK lot number: 20140220 are purchased from This Biotechnology Co., Ltd of prompt times of Guangzhou；MTT (3- (4,5- dimethylthiazole -2) -2) is purchased from Genebase；Positive control Medicine: Oseltamivir carboxylate is purchased from U.S. GIBCO company, article No.: Y0001337；Determination of pterodontic acid: self-control.
2. experimental method
Drug toxicity trails (mtt assay)
By every hole about 2.5 × 104Mdck cell is inoculated into 96 orifice plates, grows up to single layer to cell afterwards for 24 hours, discards culture solution, It is added 100 hole μ L/ of drug of different dilutions, blank control and normal cell controls hole are added 100 μ L/ hole MEM, and 37 DEG C, 5% CO2Continue culture 36-48 hours, every hole adds 20 μ L of MTT solution (5mg/mL), sets 37 DEG C, and it is small to continue incubation 4 in 5%CO2 incubator When.It inhales and abandons culture supernatant, every hole adds 100 μ L dimethyl sulfoxide (DMSO) low-speed oscillation 10 minutes, melts crystal sufficiently. 490nm wavelength is selected, each hole absorbance value is measured on enzyme linked immunological monitor.Inhibiting rate is calculated according to the following formula, is used in combination It is the toxic concentration (TC of drug half that Reed-Muench method, which calculates 50% toxic concentration,50).Inhibiting rate=[(normal to organize average OD Value-blank group mean OD value)-(administration group mean OD value-blank group mean OD value)]/(it is flat normally to organize mean OD value-blank group Equal OD value) × 100%.
Drug inhibition influenzavirus C PE experiment
It is inoculated in cell after virus and 37 DEG C of incubation 1h of drug of various concentration, is placed in 4 DEG C of incubation 1h, inhales and abandon supernatant, It changes 37 DEG C of the serum free medium containing TPCK, cultivate 8h under 5%CO2 environment.There is lesion degree and remembers by following 6 grade standard in cell Record:
"-" is that cell growth is normal, and no lesion occurs；
" ± " is that cytopathy is less than the 10% of entire cell monolayer；
"+" is that cytopathy accounts for about the 25% of entire cell monolayer；
" ++ " is that cytopathy accounts for about the 50% of entire cell monolayer；
" +++ " is that cytopathy accounts for about the 75% of entire cell monolayer:
" ++++" it is that cytopathy accounts for about 75% or more of entire cell monolayer.
With Reed-Muench method calculation of half inhibitory concentration (IC50), and to select index SI to indicate (SI=TC50/ IC50), SI > 2 indicates low toxicity efficiently；SI=1~2 indicates that high poison is inefficient；SI < 1 indicates invalid.
3. experimental result
The cytotoxicity of Determination of pterodontic acid: the toxic concentration (TC of half for measuring test medicine using mtt assay50) it is 278.9 μ g/ mL。
Determination of pterodontic acid inhibits influenza virus drug effect:
Determination of pterodontic acid just has different degrees of inhibiting effect to the influenza virus of different subtype as the result is shown, and concrete outcome is shown in Table 1.
Inhibiting effect of 1 Determination of pterodontic acid of table to a variety of subtype influenza virus
Embodiment 3: Determination of pterodontic acid inhibits influenza neuraminidase
1. material, instrument
Reagent and drug: Determination of pterodontic acid, self-control. Influenza Neuraminidase Inhibitor Resistance Detection Kit (U.S., Applied Biosystems company), chicken blood ball；
Instrument: HERAcell 150i constant temperature CO2Incubator (Thermo company of the U.S.), DU800 be ultraviolet and visible light light-splitting Luminance meter (Beckman company of the U.S.)
Virus and cell: new H1N1virus strain (A/Guangzhou/GIRD07/09, H1N1, Genebank No.HM014332.1), dog kidney cells (Madin Darby Canine Kidney, MDCK) cell is quoted from Chinese Academy of Sciences typical case Culture collection committee cell bank
2. experimental method
The virus titer (reaching 16 blood coagulation units) that Strain is measured with 0.5% chicken blood glomus cell, then with 16 blood The 25 μ l of virus of the solidifying unit and 25 μ l of drug (Determination of pterodontic acid and Oseltamivir) of various concentration, at the same set up virus control group with Blank control group.Then it covers, slight oscillatory mixes, and sets 37 DEG C of incubation 30min；Then 10 μ l substrates are added in each hole, are protected from light React 30min；Each hole is separately added into 60 hole μ l/ of catalyst again and reads immediately.
3. experimental result
Determination of pterodontic acid has inhibiting effect, IC to the NA of 09 year new H1N1virus50=668.1 μ g/ml.
Embodiment 4: Determination of pterodontic acid inhibits the output of influenza virus RNPs core
1. material, instrument
Reagent and drug: Determination of pterodontic acid (self-control), mouse NP antibody (Britain, abcam company), FITC label goat resist small Mouse IgG (the green skies), DAPI (Switzerland, Roche Applied Science), (prestige good science and technology in Guangzhou has 4% paraformaldehyde solution Limit company), Bovine Serum Albumin (BSA) (Vector Lab company),
Instrument: HERAcell 150i constant temperature CO2 incubator (Thermo company of the U.S.), Zeiss Axiovert135 fluorescence are aobvious Micro mirror (Germany, Zeiss company)
Virus and cell: PR8 plants of influenza A virus (A/PR/8/34, H1N1) purchased from the collection of American classic culture The heart (American Type Culture Collection, ATCC), dog kidney cells (Madin Darby Canine Kidney, MDCK) cell is quoted from the American Type Culture Collection committee of Chinese Academy of Sciences cell bank
2. experimental method
Cell climbing sheet: having digested mdck cell with pancreatin, sufficiently blows and beats, is allowed into single cell suspension and is added in culture dish On slide, it is placed in 37 DEG C of 5%CO2It is incubator 24 hours, primary with PBS rinse.It is grouped according to control group, viral group, medicine group, Virus group and medicine group use the cell on influenza virus PR8 strain (MOI=1) infection creep plate respectively, and after 2 hours, medicine group adds Enter various concentration Determination of pterodontic acid (25 μ g/ml, 50 μ g/ml, 100 μ g/ml).Creep plate cell is collected after 8 hours, is washed with 1 × PBST It cell 3 times, 5min/ times, is washed 3 times with PBS.Using the fixed 15min of 4% paraformaldehyde RT, washed cell 3 times with 1 × PBST, 5min/ times.0.5% Tritonx-100 punches 15min, is washed cell 3 times, 5min/ times with 1 × PBST.3%BSA closing 30min sucks confining liquid, the mouse NP antibody (1:500) (primary antibody) diluted is added, 4 DEG C overnight.Cell 3 is washed with 1 × PBST It is secondary, 5min/ times, FITC label goat anti-mouse lgG (secondary antibody) diluted is added, room temperature, which is protected from light, is incubated for 1h.It is washed with 1 × PBST Cell 3 times, 5min/ times, 1 μ g/ml DAPI staining cell core.It is washed cell 1 time with 1 × PBST, glycerol mounting, is seen under fluorescope It examines.
3. experimental result
Influenza nucleoprotein (NP) is relatively conservative, is the type specific antigen of influenza virus.In virus replication early stage, NP Albumen forms complex (RNPs) in conjunction with the RNA and polymerase of virus, participates in transcription, duplication, assembly and the transhipment function of virus Can, so NP albumen is the important symbol of new virus duplication.As shown in Fig. 1, PR8 plants of intrusion cells of I type influenza virus of first After duplication, the NP albumen disperse of generation is in (no drug-treated group) in cytoplasm and nucleus.However, by the smelly spirit of various dose After red acid (25 μ g/ml, 50 μ g/ml, 100 μ g/ml) processing, the visible strong green fluorescence in nucleus, and in endochylema Rarely seen a small amount of green fluorescence shows that NP albumen is largely gathered in the nucleus of infected cell.As drug concentration reduces, Nucleus green fluorescence intensity slightly weakens, and endochylema Green fluorescence intensity enhances, and shows Determination of pterodontic acid to NP albuminous cell core Orientation effect is more and more weaker.It can be seen that Determination of pterodontic acid is exported by inhibition NP pyrenoids, to inhibit the effective multiple of virus System, and show dose-dependence.
The adjustment effect for the host NF- κ B that 5 Determination of pterodontic acid infected by influenza of embodiment mediates
1. material, instrument
Drug, reagent: Determination of pterodontic acid (self-control), DMEM culture medium (lot number: 8114176)；DMEM/F12 culture medium (batch Number: 1292607)；(lot number: 20150122), fetal calf serum (lot number: 10099) is purchased from GIBCO company to PBS；TPCK (lot number: 20140220) purchased from this company of prompt times of Guangzhou, TNF-α (R&Dsystems).
Cell, Strain: during 549 cell strain of human lung adenocarcinoma (A549 cell) and dog renal epithelial cell (mdck cell) are purchased from The academy of sciences of state Shanghai cell bank, human embryo kidney 293 cells strain (HEK293 cell) is exhaled by Guangzhou grinds institute doctor Li Chufang and gives；A type Influenza virus A/PR/8/34 (H1N1) is purchased from ATCC, its infection multiplicity (MOI) is measured with Reed-Muench method, with MOI=0.1 As virus titer infection cell.
2. experimental method
It is capable of the HEK293 cell of continuous expression NF- κ B luciferase reporter gene with every hole 5 × 104A/ml is inoculated in 96 orifice plates grow up to single layer to cell, discard culture solution, are rinsed twice with PBS.With the DMEM without serum by influenza A virus H1N1 (PR8) is diluted to M.O.I=0.1 infection cell, or is pierced with the DMEM (TNF-α containing 20ng/ml) without fetal calf serum Swash cell, while intervening cell with the Determination of pterodontic acid of various concentration.It is examined afterwards with Luciferase Assay Reagent box (Promege) for 24 hours Survey Luciferase expression levels.
3. experimental result
The Determination of pterodontic acid NF- κ B fluorescence that can obviously inhibit TNF-α and influenza virus to induce of 20 μ g/ml, 40 μ g/ml The expression of plain enzyme reporter gene, and be in dose-dependence (see Fig. 2), illustrate that Determination of pterodontic acid is able to suppress NF- κ B signal access Activation.
The inflammatory response that 6 Determination of pterodontic acid of embodiment inhibits influenza virus to mediate
1. material, instrument
Drug: Determination of pterodontic acid, self-control.
Cell, virus: 549 cell strain of human lung adenocarcinoma (Human alveolar epithelial cell, A549) is purchased from The American Type Culture Collection committee of Chinese Academy of Sciences cell bank, H1N1virus (A/PR/8/34, H1N1), A type H9N2 avian influenza virus (A/Chicken/Guangdong/1996) is purchased from ATCC, and it is multiple to measure its infection with Reed-Muench method Number (M.O.I), using M.O.I=0.2 as virus titer infection cell.
Reagent: reagent D MEM culture medium (lot number: 8114176)；PBS (lot number: 20150122), fetal calf serum (lot number: 10099) it is purchased from GIBCO company；TPCK (lot number: 20140220) purchased from this company of prompt times of Guangzhou.Reat-time PCR reagent It buys from TaKarRa company, Cat#RR390A.RIPA lysate is purchased from U.S. sigma company.
Instrument:
HERAcell 150i constant temperature CO2 incubator, Thermo company of the U.S.
BHC-1300IIA/B3 two stage biological safety cabinet, Purifying Equipment Co., Ltd., Suzhou
Leica DM3000 inverted microscope, Lai Ka company
TGL-16M high speed desktop refrigerated centrifuge, German Eppendorf company
Avanti J-26 high speed freezing centrifuge, BECKMAN COULTER company of the U.S.
SIGMAJ-26 refrigerated centrifuge, German SIGMA company
BS115-ESHK01 horizontal shaker, granary science and education equipment factory
AL201 electronic balance, Mettler-Toledo Instrument (Shanghai) Co., Ltd.
DU800 is ultraviolet and visible light light-splitting luminance meter, Beckman company of the U.S.
JY-1000M type electric heating constant-temperature blowing drying box, Wujiang Zhi Sheng oven equipment factory
MultiScan MK3 type microplate reader, thermo company of the U.S.
Real-time PCR instrument, ABI7500
Fluorescence microscope
2. realtime fluorescent quantitative PCR experiment method
A549 cell is with every hole 5 × 104A/ml is inoculated in 96 orifice plates, grows up to single layer to cell, discards culture solution, uses PBS Rinse one time.With the DMEM without serum by Influenza virus H1N1 (A/PR/8/34 (H1N1) (MOI=0.2), H9N2 (A/ Chicken/Guangdong/1996) (MOI=0.2) respectively infection cell, in 37 DEG C incubator adherent cell 2 hours.With being free of Drug (Determination of pterodontic acid) is diluted to various concentration (100,25,6.25 μ g/ml) addition cell and done by the DMED/F12 of fetal calf serum In advance, it collects cell supernatant respectively afterwards for 24 hours, extracts RNA with TRIzol (Invitrogen), it then will with reverse transcription reagent box The RNA reverse transcription of 500ng carries out the analysis of inflammatory factor using quantitative PCR (ABI7500Real-time PCR) at cDNA. QPCR reaction condition: denaturation 95 DEG C, 30s；95 DEG C of annealing, 5s (40 circulations)；Extend 60 DEG C, 40s.It is carried out in the present embodiment real When quantitative PCR inflammatory factor used when reacting primer sequence and probe sequence it is as follows:
Primer name Primer Sequence (5'--3')
IP-10 (Human)-F:GAAATTATTCCTGCAAGCCAATTT
IP-10 (Human)-R:TCACCCTTCTTTTTCAT-TGTAGCA
IP-10(Human)-probe Fam-TCCACGTGTTGAGATCA-3'MGB
IL-6(Human)-F CGGGAACGAAAGAGAAGCTCTA
IL-6(Human)-R CGCTTGTGGAGAAGGAGTTCA
IL-6(Human)-probe Fam-TCCCCTCCAGGAGCCCAGCT-Tam
CCL-5(Human)-F CAGCAGTCGTCTTTGTCACC
CCL-5(Human)-R GTTGATGTACTCCCGAACCC
CCL-5(Human)-probe Fam-CGCCAAGTGTGTGCCAACCC-Tam
TNF‐α(Human)-F AACATCCAACCTTCCCAAACG
TNF‐α(Human)-R GACCCTAAGCCCCCAATTCTC
TNF‐α(Human)-probe Fam-CCCCCTCCTTCAGACACCCTCAACC-Tam
MIP‐1α(Human)-F CTGCATCACTTGCTGCTGACA
MIP‐1α(Human)-R CACTGGCTGCTCGTCTCAAAG
MIP‐1α(Human)-probe Fam-TTCAGCTACACCTCCCGGCAGATTCC-Tam
MCP-1(Human)-F CAAGCAGAAGTGGGTTCAGGAT
MCP-1(Human)-R AGTGAGTGTTCAAGTCTTCGGAGTT
MCP-1(Human)-probe Fam-CATGGACCACCTGGACAAGCAAACC-Tam
3. experimental result
Shown in the results are shown in attached figure 3, Determination of pterodontic acid (100,25,6.25 μ g/ml) obviously inhibits H1N1 influenza sick after intervening The gene transcription level of the inflammatory factor (IL-6, IP-10, MIP-1 α, MCP-1) of poison induction is in dose-dependence；Such as attached drawing The excessive table for the inflammatory factor (CCL-5, TNF-α, IP-10, MIP-1 α, MCP-1) for inhibiting H9N2 influenza virus to induce shown in 4 It reaches, and is in dose-dependence.Prompt Determination of pterodontic acid intervention that influenza infection is inhibited to induce excessive inflammation response.

Claims (10)

1. Determination of pterodontic acid is in preparation for preventing or treating the application in flu pharmaceutical.
2. Determination of pterodontic acid is in preparation for inhibiting the application in influenza virus drug.
3. Determination of pterodontic acid is preparing the effect in the inflammatory reaction drug for inhibiting influenza virus to mediate.
4. Determination of pterodontic acid described in claim 1,2 or 3 has the following structure formula:
5. a kind of for preventing or treating the pharmaceutical preparation of influenza, which is characterized in that contain dosage needed for suitable clinical application Determination of pterodontic acid and pharmaceutically acceptable other medicinal ingredients, carrier or auxiliary material.
6. a kind of for inhibiting the pharmaceutical preparation of influenza virus, which is characterized in that contain the smelly of dosage needed for suitable clinical application Miracle acid and pharmaceutically acceptable other medicinal ingredients, carrier or auxiliary material.
7. a kind of pharmaceutical preparation of the inflammatory reaction for inhibiting influenza virus to mediate, which is characterized in that contain suitable clinical use The Determination of pterodontic acid of dosage needed for medicine and pharmaceutically acceptable other medicinal ingredients, carrier or auxiliary material.
8. according to pharmaceutical preparation described in claim 5,6 or 7, which is characterized in that the pharmaceutical preparation is that can pharmaceutically connect Alimentary canal form of administration, respiratory tract administration dosage form or the injecting medicine-feeding form received.
9. according to pharmaceutical preparation described in claim 5,6 or 7, which is characterized in that the pharmaceutical preparation is capsule, piece Agent, soft capsule, dripping pill, granule, syrup, oral solution, inhalant, spray, emulsifiable paste, creme, gelling agent or injection.
10. a kind of preparation method of Determination of pterodontic acid, comprising the following steps: take the dry medicinal material of laggera pterodonta, mentioned with 90% alcohol diacolation Medicinal extract is obtained, medicinal extract, which adds water and stirs, to be made to be suspended, and successively uses petroleum ether, ethyl acetate, extracting n-butyl alcohol, recycling design；By petroleum Ether extract adds silica gel to mix sample in right amount, dry column-packing (200~300 mesh), with petroleum ether-ethyl acetate mixed solvent ladder under normal pressure Degree elution, solvent burden ratio are followed successively by 1:0,20:1,10:1 and 5:1；It receives, is concentrated respectively；Petroleum ether elution section continues to use silica gel Column chromatography separates repeatedly, and petroleum ether and chloroform elution is used alternatingly, and instructs to merge with TLC, and concentration obtains white crystalline powder As Determination of pterodontic acid.
CN201710544207.9A 2017-07-05 2017-07-05 Application of the Determination of pterodontic acid in preparation prevention or treatment flu pharmaceutical Pending CN109200042A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710544207.9A CN109200042A (en) 2017-07-05 2017-07-05 Application of the Determination of pterodontic acid in preparation prevention or treatment flu pharmaceutical

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710544207.9A CN109200042A (en) 2017-07-05 2017-07-05 Application of the Determination of pterodontic acid in preparation prevention or treatment flu pharmaceutical

Publications (1)

Publication Number Publication Date
CN109200042A true CN109200042A (en) 2019-01-15

Family

ID=64992156

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710544207.9A Pending CN109200042A (en) 2017-07-05 2017-07-05 Application of the Determination of pterodontic acid in preparation prevention or treatment flu pharmaceutical

Country Status (1)

Country Link
CN (1) CN109200042A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111978198A (en) * 2020-08-13 2020-11-24 云南中医药大学 Lapterostigmatic acid derivative and preparation method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1927197A (en) * 2006-09-27 2007-03-14 温州医学院 Medical use of 1beta-keto-5, 11(13)-diene eudesmane-12-acid for inhibiting hepatitis B virus

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1927197A (en) * 2006-09-27 2007-03-14 温州医学院 Medical use of 1beta-keto-5, 11(13)-diene eudesmane-12-acid for inhibiting hepatitis B virus

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
WENDA GUAN等: "Pterodontic Acid Isolated from Laggera pterodonta Inhibits Viral Replication and Inflammation Induced by Influenza A Virus", 《MOLECULES》 *
刘永彬: "臭灵丹生物有效化学成分的研究", 《中国优秀博硕士学位论文全文数据库（硕士）医药卫生科技辑》 *
夏晓玲等: "云南特色中药臭灵丹体外抗甲型H1N1流感病毒的实验研究", 《中国中药杂志》 *
王玉涛: "中药臭灵丹抗流感病毒活性成分分离及其药效机制研究", 《中国博士学位论文全文数据库 医药卫生科技辑》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111978198A (en) * 2020-08-13 2020-11-24 云南中医药大学 Lapterostigmatic acid derivative and preparation method and application thereof
CN111978198B (en) * 2020-08-13 2023-10-27 云南中医药大学 Oletum pteroic acid derivative and preparation method and application thereof

Similar Documents

Publication Publication Date Title
Kong et al. Effects of Chinese herbal medicinal ingredients on peripheral lymphocyte proliferation and serum antibody titer after vaccination in chicken
KR101782532B1 (en) A composition comprising extract of Angelica dahurica or furanocoumarins isolated therefrom for preventing or treating Avian influenza, Swine influenza or Corona virus
KR101638818B1 (en) Composition comprising extract of Camellia japonica or oleanane triterpenes derivatives isolated therefrom for treating or preventing Corona virus related disease
CN101873861A (en) The composition for preventing virus infection that contains poly-gamma-glutamic acid
CN109846896A (en) Hederagenin is preparing the application in anti-vascular endothelial cell inflammatory damage drug
CN104173418A (en) Eucommia ulmoides and teasel root composition and application thereof
CN108926584A (en) The antimicrobial purposes of chimonanthea extract
CN103142621A (en) Medical applications of four buxus alkaloids compounds
CN105592847A (en) Composition containing monoacetyldiacylglycerol compound as active ingredient for preventing or treating chronic obstructive pulmonary diseases
CN109200042A (en) Application of the Determination of pterodontic acid in preparation prevention or treatment flu pharmaceutical
CN101897776A (en) New application of Chinese flowing crabapple extractive and phlorizin
CN106947763B (en) The siRNA of the resisiting influenza virus infection of aerosolizable sucking and its application
CN102335185A (en) Purpose of icariin in preparation of medicines used for treating bronchial asthma
CN107375261B (en) Application of the pinostrobin in prevention and treatment osteoporosis
CN103784427B (en) Containing the pharmaceutical composition of eudesmane type sesquiterpene and the application in pharmacy thereof
CN109820947A (en) A kind of application of Chinese medicine composition in preparation treatment epithelium healing cough syndrome drug
CN102068452B (en) Antiviral medicinal composition
KR20210133861A (en) Composition for preventing or treating swine influenza virus disease comprising Resina Pini extract or diterpenoids isolated therefrom as active ingredients
CN108420815A (en) Application of the polyketone in inhibiting influenza virus
KR101521010B1 (en) A composition comprising the extract of Reynoutria sachalinensis and the compound isolated therefrom for preventing and treating influenza viral disease
KR20120026851A (en) Composition for anti-influenza virus comprising genus drynaria extract
CN104840477B (en) Lariciresinol -4-O- β-D-Glucose glycosides medicinal application and its pharmaceutical composition
KR102070040B1 (en) Composition comprising extract of Sargassum fusiforme for preventing or treating influenza
CN108309989A (en) 23- HBA is preparing the purposes in preventing flu pharmaceutical
CN102389412A (en) Eye drops for treating cataract

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20190115