CN109187446A - A kind of gold, silver nanoparticle chiral dimer of detectable 8-OHdG - Google Patents
A kind of gold, silver nanoparticle chiral dimer of detectable 8-OHdG Download PDFInfo
- Publication number
- CN109187446A CN109187446A CN201810803481.8A CN201810803481A CN109187446A CN 109187446 A CN109187446 A CN 109187446A CN 201810803481 A CN201810803481 A CN 201810803481A CN 109187446 A CN109187446 A CN 109187446A
- Authority
- CN
- China
- Prior art keywords
- gold
- ohdg
- dimer
- silver nanoparticle
- nanoparticle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- B—PERFORMING OPERATIONS; TRANSPORTING
- B82—NANOTECHNOLOGY
- B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
- B82Y30/00—Nanotechnology for materials or surface science, e.g. nanocomposites
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N2021/6417—Spectrofluorimetric devices
- G01N2021/6423—Spectral mapping, video display
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Health & Medical Sciences (AREA)
- Nanotechnology (AREA)
- Immunology (AREA)
- General Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Crystallography & Structural Chemistry (AREA)
- Materials Engineering (AREA)
- Condensed Matter Physics & Semiconductors (AREA)
- Composite Materials (AREA)
- Optics & Photonics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the gold, silver nanoparticle chiral dimers of detectable 8-OHdG a kind of, belong to technical field of analytical chemistry.Gold, silver nanoparticle chiral dimer of the invention has the advantage of high yield, high stability and high-biocompatibility；With the method for the intracellular 8-OHdG changes of contents of detection that this dimer is established, the in situ imaging of intracellular 8-OHdG can be realized by fluorescence signal, and has highly sensitive, highly selective, had a good application prospect in terms of evaluating DNA damage degree.
Description
Technical field
The present invention relates to the gold, silver nanoparticle chiral dimers of detectable 8-OHdG a kind of, belong to technique of analytical chemistry
Field.
Background technique
DNA is the important inhereditary material of life entity, and DNA damage is a kind of universal phenomenon in organism.In DNA damage
In detection, 8-OHdG is most representative one kind in oxidative damage biomarker, it can be by influencing DNA methylation journey
It spends and influences gene expression indirectly, moreover it is possible to directly cause the mutation of gene and the expression of oncogene, and the fracture of it and DNA chain
Related, therefore, detecting intracellular 8-OHdG level has very big directive significance to evaluation DNA damage degree.
Currently, the method for being usually used in detecting intracellular 8-OHdG level has32Labelling method, ELISA method, high-efficient liquid phase color after P
Spectrometry etc., ELISA method have the defect of pre-treating method complexity；High performance liquid chromatography is at high cost, detection cycle is long, and above-mentioned
Method is all horizontal, evaluation DNA damage by exogenous chemistry or biological substance and its intracellular 8-OHdG of metabolism analyte detection
Degree.
And exogenous chemistry or biological substance and its metabolin, often to the DNA in cell cause oxidative damage after
And cause related disease, therefore, be badly in need of designing it is a kind of new, sensitive, can be applied to detect 8-OHdG level into the cell, evaluate
DNA damage degree, and the reagent and related application method of oxidative damage will not be caused to the DNA in cell.
Summary of the invention
To solve the above problems, the present invention provides the gold, silver nanoparticle chiral dimers of detectable 8-OHdG a kind of.
This dimer has the advantage of high yield, high stability and high-biocompatibility；The detection cell established with this dimer
The method of interior 8-OHdG changes of contents can be realized the in situ imaging of intracellular 8-OHdG by fluorescence signal, and be had highly sensitive
It spends, is highly selective, being had a good application prospect in terms of evaluating DNA damage degree.
Technical scheme is as follows:
The present invention provides the gold, silver nanoparticle chiral dimer of detectable 8-OHdG a kind of, the gold, silver nanoparticles
Sub- chiral dimer includes to pass through the DNA3 condensate 1 to condense together and condensate 2；The condensate 1 is Jenner's grain of rice
The condensate of son and DNA1；The condensate 2 is Nano silver grain and the condensate of DNA2；The DNA3 is 8- hydroxyl deoxidation bird
The aptamers sequence of glycosides (8-OHdG)；The DNA1 is complementary with DNA3 respectively with DNA2；One end of the DNA3 is modified with Cy5.
In one embodiment of the invention, the nucleotide sequence of described DNA1, DNA2, DNA3 are respectively SEQ ID
NO.1、SEQ ID NO.2、SEQ ID NO.3。
In one embodiment of the invention, the chiral dimer need to be coupled with cell-penetrating peptide (TAT), obtain table
Face is modified with the gold, silver nanoparticle chiral dimer of cell-penetrating peptide.
In one embodiment of the invention, the amino acid sequence of the cell-penetrating peptide is SEQ ID NO.4.
The present invention provides a kind of above-mentioned preparation method of the gold, silver nanoparticle chiral dimer of detectable 8-OHdG,
The method is that gold nanoparticle and Nano silver grain are resuspended in buffer, obtain the buffer containing gold nanoparticle and
Buffer containing Nano silver grain；Respectively into the buffer containing gold nanoparticle and the buffer containing Nano silver grain
Complementary series DNA1, DNA2 that 8-OHdG aptamers sequence is added are reacted, and are obtained the reaction solution 1 containing condensate 1 and are contained
There is the reaction solution 2 of condensate 2；It goes supernatant to remove unreacted DNA reaction solution 1 and the centrifugation of reaction solution 2, is resuspended with buffer,
Obtain re-suspension liquid 1 and re-suspension liquid 2；Re-suspension liquid 1 and re-suspension liquid 2 are mixed and added into the 8-OHdG aptamers sequence for being modified with Cy5
DNA3, and NaCl solution is added and is reacted, obtain the reaction solution 3 containing dimer；Supernatant is gone to remove not the centrifugation of reaction solution 3
The DNA3 of reaction, and be resuspended with buffer, obtain re-suspension liquid 3；Re-suspension liquid 3 is mixed with cell-penetrating peptide and is coupled, is contained
Surface modification has the reaction solution 4 of the gold, silver nanoparticle chiral dimer of cell-penetrating peptide；Reaction solution 4 is centrifuged removal supernatant, is obtained
Surface modification has the gold, silver nanoparticle chiral dimer of cell-penetrating peptide.
In one embodiment of the invention, the nucleotide sequence of described DNA1, DNA2, DNA3 are respectively SEQ ID
NO.1,SEQ ID NO.2,SEQ ID NO.3；The nucleotides sequence of the cell-penetrating peptide is classified as SEQ ID NO.4.
In one embodiment of the invention, it is resuspended in again after the gold nanoparticle need to be concentrated with Nano silver grain slow
In fliud flushing.
In one embodiment of the invention, the cycles of concentration of the gold nanoparticle and Nano silver grain is 9-11
Times.
In one embodiment of the invention, the cycles of concentration of the gold nanoparticle and Nano silver grain is 10 times.
In one embodiment of the invention, the granularity of the gold nanoparticle is 23-27nm；The grain of Nano silver grain
Degree is 9-10nm.
In one embodiment of the invention, the granularity of the gold nanoparticle is 25nm；The granularity of Nano silver grain
For 10nm.
In one embodiment of the invention, the buffer is PB buffer.
In one embodiment of the invention, the concentration of the PB buffer is 9-11mmol/L.
In one embodiment of the invention, the concentration of the PB buffer is 10mmol/L.
In one embodiment of the invention, the pH of the PB buffer is 7-8.
In one embodiment of the invention, the pH of the PB buffer is 7.4.
In one embodiment of the invention, in the buffer containing gold nanoparticle, gold nanoparticle it is dense
Degree is 9-11nmol/L；In buffer containing Nano silver grain, the concentration of Nano silver grain is 9-11nmol/L.
In one embodiment of the invention, in the buffer containing gold nanoparticle, gold nanoparticle it is dense
Degree is 10nmol/L；In buffer containing Nano silver grain, the concentration of Nano silver grain is 10nmol/L.
In one embodiment of the invention, the molar ratio of the DNA1 and gold nanoparticle is 9- (11:1)；It is described
The molar ratio of DNA2 and Nano silver grain is 9- (11:1).
In one embodiment of the invention, the molar ratio of the DNA1 and gold nanoparticle is 10:1；The DNA2
Molar ratio with Nano silver grain is 10:1.
In one embodiment of the invention, the centrifugal rotational speed of the reaction solution 1 be 7500-8500rpm, time 9-
11min。
In one embodiment of the invention, the centrifugal rotational speed of the reaction solution 1 be 8000rpm, time 10min.
In one embodiment of the invention, the centrifugal rotational speed of the reaction solution 2 is 12000-14000rpm, the time is
9-11min。
In one embodiment of the invention, the centrifugal rotational speed of the reaction solution 2 be 13000rpm, time 10min.
In one embodiment of the invention, the molar ratio of the DNA3 and condensate 1 and condensate 2 be 9- (11:
1)。
In one embodiment of the invention, the molar ratio of the DNA3 and condensate 1 and condensate 2 is 10:1.
In one embodiment of the invention, the concentration of the NaCl solution is 4.5-5.5mol/L.
In one embodiment of the invention, the concentration of the NaCl solution is 5mol/L.
In one embodiment of the invention, the concentration of NaCl solution is 45-55mmol/L in the reaction solution 3.
In one embodiment of the invention, the concentration of NaCl solution is 50mmol/L in the reaction solution 3.
In one embodiment of the invention, the reaction solution 3 need to be protected from light 22-26h in room temperature.
In one embodiment of the invention, the reaction solution 3 need to be protected from light for 24 hours in room temperature.
In one embodiment of the invention, the centrifugal rotational speed of the reaction solution 3 is 7000-8000rpm, the time is
18-22min。
In one embodiment of the invention, the centrifugal rotational speed of the reaction solution 3 be 13000rpm, time 10min.
In one embodiment of the invention, the reaction solution 3 need to be kept in dark place in 4 DEG C.
In one embodiment of the invention, the re-suspension liquid 3 need to be mixed under protectant protection with cell-penetrating peptide
Row coupling.
In one embodiment of the invention, the protective agent is SH-PEG-5000.
In one embodiment of the invention, dimer in the re-suspension liquid 3, SH-PEG-5000, cell-penetrating peptide mole
Than for (1:450)-(550:1500) -2500.
In one embodiment of the invention, dimer in the re-suspension liquid 3, SH-PEG-5000, cell-penetrating peptide mole
Than for 1:500:2000.
In one embodiment of the invention, the time of the coupling is 10-14h.
In one embodiment of the invention, the time of the coupling is 12h.
In one embodiment of the invention, the centrifugal rotational speed of the reaction solution 4 is 6500-7500rpm, the time is
18-22min。
In one embodiment of the invention, the centrifugal rotational speed of the reaction solution 4 be 7000rpm, time 20min.
The present invention provides apply a kind of above-mentioned preparation side of the gold, silver nanoparticle chiral dimer of detectable 8-OHdG
The gold, silver nanoparticle chiral dimer that method is prepared.
The present invention provides gold, silver nanoparticle chiral dimers or above-mentioned one kind that trade company says a kind of detectable 8-OHdG
The preparation method of the gold, silver nanoparticle chiral dimer of detectable 8-OHdG or the above-mentioned gold, silver nanoparticle being prepared
Application of the chiral dimer in terms of detection 8-OHdG, detection DNA damage.
The present invention provides a kind of method for detecting intracellular 8-OHdG, the method is to use a kind of above-mentioned detectable 8-
The gold, silver nanoparticle chiral dimer of OHdG.
In one embodiment of the invention, the method is by cell to be detected and a kind of above-mentioned detectable 8-OHdG
Gold, silver nanoparticle chiral dimer be resuspended in culture medium, will be resuspended has the culture of gold, silver nanoparticle chiral dimer
Base is mixed and is cultivated with cell suspension to be detected, then carries out spectrofluorimetry and cell imaging analysis.
In one embodiment of the invention, the culture medium is 1640 culture mediums containing 10% fetal calf serum.
It is described that gold, silver nanoparticle chiral dimer in the culture medium for having gold, silver nanoparticle chiral dimer is resuspended
Concentration is 10nmol/L.
The concentration of cell is 1 × 10 in the cell suspension7A/mL.
The volume ratio that the culture medium and cell suspension that have gold, silver nanoparticle chiral dimer is resuspended is 0.5-
(1.5:1)。
The volume ratio that the culture medium and cell suspension that have gold, silver nanoparticle chiral dimer is resuspended is 1:1.
The culture cultivates 7-9h to be protected from light.
The culture cultivates 8h to be protected from light.
The present invention provides a kind of above-mentioned methods for detecting intracellular 8-OHdG in detection 8-OHdG, detection DNA damage side
The application in face.
The utility model has the advantages that
(1) dimer of the invention have high yield (yield reaches 84%), (dimer is in buffer solution system for high stability
With structural integrity and good optical signalling are kept in culture medium) and high-biocompatibility (with cell co-culture 8h, cell
Activity is 80% or more) advantage；
(2) method for the intracellular 8-OHdG changes of contents of detection established with dimer of the present invention, can be believed by fluorescence
It number realizes the in situ imaging of intracellular 8-OHdG, and there is highly sensitive (sensitivity can reach 0.1nmol/L), highly selective,
It is had a good application prospect in terms of evaluating DNA damage degree；
(3) method for the intracellular 8-OHdG changes of contents of detection established with dimer of the present invention is not damaged to cell
(dimer and cell of the invention are hatched for 24 hours altogether, by the cell after the detection hatching of CCK-8 method, find cell without obvious
Damage).
Detailed description of the invention
The electromicroscopic photograph of Fig. 1 gold, silver nanoparticle chiral dimer；
Cell activity changes after Fig. 2 series of concentrations Fipronil and cell incubation different time；
8-OHdG variation intracellular after Fig. 3 series of concentrations Fipronil and cell incubation different time；
Rear corresponding chiral signal changes standard curve to Fig. 4 series of concentrations Fipronil for 24 hours with cell incubation；
Rear corresponding fluorescence signal changes standard curve to Fig. 5 series of concentrations Fipronil for 24 hours with cell incubation；
Fig. 6 dimer and corresponding cell activity after cell incubation different time；
The intracellular 8-OHdG in situ imaging figure of Fig. 7.
Specific embodiment
The present invention will be further elaborated combined with specific embodiments below.
Detection method involved in following embodiments is as follows:
Yield detection method:
It is counted after being observed under transmission electron microscope；
Cytoactive detection method:
By the cell in cell suspension, overnight incubation, number reach 5 × 10 in culture dish6CCK- is added in a/mL or so
8 solution measure absorption value with microplate reader, and the ratio of experimental group and control group is cell activity, wherein experimental group refers to through two
Cell after aggressiveness incubation, control group refer to the cell after being incubated for without dimer；
8-OHdG detection method of content intracellular:
Cell is collected, 2400rpm is centrifuged 30min, collects precipitating, and ELISA kit is added and (builds up biological work purchased from Nanjing
Journey research institute, product number H165) in detected；
Chiral signal detection method:
Baseline is established using circular dichroism spectrometer, solution to be measured is put into circular dichroism instrument, after obtaining spectral signal, button
Except baseline, the chiral signal of prepare liquid is obtained；
Fluorescence signal detection method: utilizing fluorescence detector, selects 638nm excitation-detection.
Embodiment 1: the preparation of gold, silver nanoparticle chiral dimer
(1) synthesis of gold, silver nanoparticle chiral dimer
1. the Nano silver grain of the gold nanoparticle of 25nm, 10nm are prepared, by obtained 25nm gold nanoparticle, 10nm silver
Nanoparticle is concentrated and is resuspended in respectively in the PB buffer of 1mL, 10mM, is made its final concentration of 10nM, is rubbed according to DNA and particle
Complementary series DNA1, DNA2 of 8-OHdG, room temperature reaction is added than the ratio for being 10:1 in you into gold, silver nanoparticle respectively
Centrifugation goes supernatant to remove unreacted DNA after 12 hours, and (Jenner's grain of rice is resuspended with the PB buffer that 1mL, 10mM, pH are 7.4
Sub, Nano silver grain preparation method can refer to Liu, L.；Wei,T.；Guan,X.；Zi,X.；He,H.；Dai,H.Size and
Morphology Adjustment of PVP-Stabilized Silver and Gold Nanocrystals
Synthesized by Hydrodynamic Assisted Self-Assembly.J.Phys.Chem.C 2009,113
(20),8595–8600.FRENS,G.Controlled Nucleation for the Regulation of the
Particle Size in Monodisperse Gold Suspensions.Nat.Phys.Sci.1973,241(105),20–
22.)；
Centrifugal condition are as follows: gold nanoparticle 8000rpm, 10min；Nano silver grain 13000rpm, 10min.
2. the gold, silver nanoparticle mixing after taking 500 μ L to be resuspended respectively, the ratio for being 10:1 according to DNA and particle molar ratio
The 8-OHdG aptamers DNA3 for being modified with Cy5 is added in example, and 5M NaCl solution is added, and makes the final concentration of 50mM of NaCl, room temperature is kept away
Light reaction is for 24 hours；
3. above-mentioned solution 2. after reaction, centrifugation goes supernatant to remove unreacted under conditions of 7500rpm, 20min
DNA3, and with isometric 10mM, pH be 7.4 PB buffer be resuspended, 4 DEG C are kept in dark place spare (the gold, silver nanoparticle of preparation
Sub- chiral dimer electron microscope characterization is shown in Fig. 1)；
(2) gold, silver nanoparticle chiral dimer modifies cell-penetrating peptide
The gold, silver nanoparticle that step (1) is obtained respectively with SH-PEG-5000 and cell-penetrating peptide TAT (SEQ ID NO.4:
Cy5-GCGGGCGATCGGCGGGGGGTGCGTGCGCTCTGTGCCAGGGGGTGGGACAGATCATATCCCCCTGCTCCTCAC
CATC it) is mixed with the molar ratio of 1:500:2000, after being coupled 12h, 7000rpm is centrifuged 20min, removes supernatant, and will precipitate weight
It is suspended from culture medium, obtains the gold, silver nanoparticle chiral dimer that surface modification has cell-penetrating peptide.
Obtained gold, silver nanoparticle chiral dimer is subjected to yield detection, testing result 84%.
Obtained gold, silver nanoparticle chiral dimer is subjected to cytoactive detection, testing result is > 80%.
The nucleotide sequence of DNA used in table 1
Embodiment 2: the application of gold, silver nanoparticle chiral dimer
(1) Fipronil and cell incubation
1. weighing the Fipronil of certain mass, solvent is made with methanol, makes its concentration 10mM, then is with methanol that its is dilute respectively
Releasing to concentration is 5mM, 1mM, 200 μM, 20 μM, 5 μM；
2. every hole number of cells is 10 by cell inoculation in 24 orifice plates4, the volume of every hole culture solution is 1mL, takes 6
Hole, is separately added into 5mM, 1mM, 200 μM, 20 μM, 5 μM of the Fipronil of 10 μ L, and 10 μ L methanol are added in control group；
3. Fipronil be incubated for jointly with cell respectively for 24 hours, 48h, 72h, detect cell activity and 8-OHdG content intracellular
(cell activity and the changes of contents of corresponding 8-OHdG are shown in Fig. 2-3 under different incubation times), due to when for 24 hours, cell
Greater activity is still kept under the Fipronil processing of various concentration, accordingly, it is determined that compound is with cell the best use time
24h；
(2) DNA oxidative damage object 8-OHdG is detected using gold, silver nanoparticle chiral dimer
1. removing the culture solution in step (1), the gold, silver nanoparticle chiral dimer for being modified with cell-penetrating peptide is centrifuged,
It is added in 24 orifice plates with isometric culture solution resuspension, culture 8h is protected from light, when Fipronil acts on cell and generates 8-OHdG
When, chiral dimer is dismissed, and the fluorescent dye Cy5 on the DNA3 for causing chiral signal to change, while dissociateing causes glimmering
Optical signal changes, and can be used for spectrofluorimetry and cell imaging analysis simultaneously；
2. respectively obtaining the cell of the chiral dimer containing different dissociation degrees into the cell with trypsin digestion and cell
Suspension.
Cell suspension is subjected to circular dichroism characterization, fluorescence signal characterization, and the standard for establishing detection 8-OHdG intracellular is bent
Line (spectrum standard curve is as illustrated in figures 4-5)；
Such as Fig. 4-5, detection limit intracellular has reached 0.1nmol/L, and therefore, dimer of the present invention detects containing for 8-OHdG intracellular
Amount variation high sensitivity, and can achieve the purpose that in situ imaging intracellular (intracellular 8-OHdG original simultaneously with dimer of the invention
Position imaging results are shown in Fig. 7).
Cell suspension is subjected to cytoactive detection, testing result such as Fig. 6.
As shown in fig. 6, dimer with after cell incubation 12h keep 90% or so activity, for 24 hours after still keep 80% with
On cell activity, it is believed that the cytotoxicity of dimer is small, be suitable for next application.
Comparative example 1: the influence of the chiral dimer of nanoparticle type
Gold nano example in embodiment 1 is substituted for the up-conversion nanoparticles (preparation method of up-conversion nanoparticles
It can refer to X.Li, Z.Guo, T.Zhao, Y.Lu, L.Zhou, D.Zhao, F.Zhang, Angew Chem Int Ed Engl
2016,55,2464.), remaining step is constant, prepares gold, silver nanoparticle chiral dimer.
Obtained gold, silver nanoparticle chiral dimer is subjected to yield detection, testing result 30%.
Obtained gold, silver nanoparticle chiral dimer is subjected to cellular damage detection, testing result 80%.
Comparative example 2: the influence of the chiral dimer of aptamers sequence
It is SEQ ID NO.5:GCGTCGACCTGCAGACC that aptamers sequence DNA 3 in embodiment 1, which is replaced with sequence,
8-OhdG (8-OHdG) aptamers sequence of CCCATATCATCAGTCCCACCCCCAGGCACAGAGCGCCGTACCCCC
Column, remaining step is constant, and preparation prepares gold, silver nanoparticle chiral dimer.
Obtained gold, silver nanoparticle chiral dimer is subjected to yield detection, testing result 50%.
Obtained gold, silver nanoparticle chiral dimer is subjected to cellular damage detection, testing result 85%.
Comparative example 3: influence of the molar ratio to gold, silver nanoparticle chiral dimer
The ratio of DNA and nanoparticle in embodiment 1 is adjusted to 5:1, remaining step is constant, prepares gold, silver nanoparticle
Sub- chiral dimer.
Obtained gold, silver nanoparticle chiral dimer is subjected to yield detection, testing result 47%.
Obtained gold, silver nanoparticle chiral dimer is subjected to cellular damage detection, testing result 85%.
Comparative example 4: influence of the reaction time to gold, silver nanoparticle chiral dimer
The reaction time of DNA and nanoparticle in embodiment 1 is adjusted to 6h, remaining step is constant, prepares gold, silver nanometer
Particle chiral dimer.
Obtained gold, silver nanoparticle chiral dimer is subjected to yield detection, testing result 53%.
Obtained gold, silver nanoparticle chiral dimer is subjected to cellular damage detection, testing result 85%
Comparative example 5: influence of the reaction time to gold, silver nanoparticle chiral dimer testing result
The incubation time of cell and nanoparticle in embodiment 2 is adjusted to 4h, remaining step is constant, detects Fipronil pair
The damage of cell.
Optical signalling detection, CD value are carried out after being incubated for 4h, fluorescent value falls to original 45%
Cytoactive detection after incubation 4h, testing result 88%.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
Sequence table
<110>Southern Yangtze University, Wuxi Di Tengmin Biotechnology Co., Ltd
<120>the gold, silver nanoparticle chiral dimer of a kind of detectable 8-OHdG
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213>artificial sequence
<400> 1
tttctgtccc accccctggc a 21
<210> 2
<211> 20
<212> DNA
<213>artificial sequence
<400> 2
cagagcgcac gcaccccttt 20
<210> 3
<211> 76
<212> DNA
<213>artificial sequence
<400> 3
gcgggcgatc ggcggggggt gcgtgcgctc tgtgccaggg ggtgggacag atcatatggg 60
ggtgctggtg aggatg 76
<210> 4
<211> 76
<212> DNA
<213>artificial sequence
<400> 4
gcgggcgatc ggcggggggt gcgtgcgctc tgtgccaggg ggtgggacag atcatatccc 60
cctgctcctc accatc 76
<210> 5
<211> 62
<212> DNA
<213>artificial sequence
<400> 5
gcgtcgacct gcagaccccc atatcatcag tcccaccccc aggcacagag cgccgtaccc 60
cc 62
Claims (10)
1. the gold, silver nanoparticle chiral dimer of detectable 8-OHdG a kind of, which is characterized in that the gold, silver nanoparticle
Chiral dimer includes to pass through the DNA3 condensate 1 to condense together and condensate 2；The condensate 1 is gold nanoparticle
With the condensate of DNA1；The condensate 2 is Nano silver grain and the condensate of DNA2；The DNA3 is 8-OhdG
The aptamers sequence of (8-OHdG)；The DNA1 is complementary with DNA3 respectively with DNA2；One end of the DNA3 is modified with Cy5.
2. a kind of gold, silver nanoparticle chiral dimer of detectable 8-OHdG as described in claim 1, which is characterized in that
The chiral dimer need to be coupled with cell-penetrating peptide (TAT), and obtaining surface modification has the gold, silver nanoparticle of cell-penetrating peptide chiral
Dimer.
3. a kind of preparation side of the gold, silver nanoparticle chiral dimer of detectable 8-OHdG as claimed in claim 1 or 2
Method, which is characterized in that the method is that gold nanoparticle and Nano silver grain are resuspended in buffer, is obtained containing gold nano
The buffer of particle and buffer containing Nano silver grain；To the buffer containing gold nanoparticle and contain silver nanoparticle respectively
Complementary series DNA1, DNA2 that 8-OHdG aptamers sequence is added in the buffer of particle are reacted, and are obtained containing condensate 1
Reaction solution 1 and reaction solution 2 containing condensate 2；Supernatant is gone to remove unreacted DNA reaction solution 1 and the centrifugation of reaction solution 2,
It is resuspended with buffer, obtains re-suspension liquid 1 and re-suspension liquid 2；Re-suspension liquid 1 and re-suspension liquid 2 are mixed and added into the 8- for being modified with Cy5
OHdG aptamers sequence DNA 3, and NaCl solution is added and is reacted, obtain the reaction solution 3 containing dimer；By reaction solution 3 from
The heart goes supernatant to remove unreacted DNA3, and is resuspended with buffer, obtains re-suspension liquid 3；Re-suspension liquid 3 is mixed to progress with cell-penetrating peptide
Coupling, obtains the reaction solution 4 for the gold, silver nanoparticle chiral dimer for having cell-penetrating peptide containing surface modification；Reaction solution 4 is centrifuged
Supernatant is removed, the gold, silver nanoparticle chiral dimer that surface modification has cell-penetrating peptide is obtained.
4. a kind of preparation method of the gold, silver nanoparticle chiral dimer of detectable 8-OHdG as claimed in claim 3,
It is characterized in that, the nucleotide sequence of described DNA1, DNA2, DNA3 are respectively SEQ ID NO.1, SEQ ID NO.2, SEQ ID
NO.3；The nucleotides sequence of the cell-penetrating peptide is classified as SEQ ID NO.4.
5. a kind of preparation side of the gold, silver nanoparticle chiral dimer of detectable 8-OHdG as described in claim 3 or 4
Method, which is characterized in that in the buffer containing gold nanoparticle, the concentration of gold nanoparticle is 9-11nmol/L；Contain
In the buffer of Nano silver grain, the concentration of Nano silver grain is 9-11nmol/L.
6. such as a kind of preparation of the gold, silver nanoparticle chiral dimer of detectable 8-OHdG as claimed in claim 3 to 5
Method, which is characterized in that the molar ratio of the DNA1 and gold nanoparticle is 9- (11:1)；The DNA2 and Nano silver grain
Molar ratio is 9- (11:1).
7. a kind of preparation of the gold, silver nanoparticle chiral dimer of detectable 8-OHdG as described in claim 3-6 is any
Method, which is characterized in that the molar ratio of the DNA3 and condensate 1 and condensate 2 is 9- (11:1).
8. a kind of preparation of the gold, silver nanoparticle chiral dimer of detectable 8-OHdG as described in claim 3-7 is any
Method, which is characterized in that dimer in the re-suspension liquid 3, SH-PEG-5000, cell-penetrating peptide molar ratio be (1:450)-(550:
1500)-2500。
9. a kind of system of the gold, silver nanoparticle chiral dimer of any detectable 8-OHdG of application claim 3-8
The gold, silver nanoparticle chiral dimer that Preparation Method is prepared.
10. the gold, silver nanoparticle chiral dimer or claim of a kind of detectable 8-OHdG of any of claims 1 or 2
A kind of preparation method of the gold, silver nanoparticle chiral dimer of any detectable 8-OHdG of 3-8 or claim 9 institute
Application of the gold, silver nanoparticle chiral dimer being prepared stated in terms of detection 8-OHdG, detection DNA damage.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810803481.8A CN109187446A (en) | 2018-07-20 | 2018-07-20 | A kind of gold, silver nanoparticle chiral dimer of detectable 8-OHdG |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810803481.8A CN109187446A (en) | 2018-07-20 | 2018-07-20 | A kind of gold, silver nanoparticle chiral dimer of detectable 8-OHdG |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109187446A true CN109187446A (en) | 2019-01-11 |
Family
ID=64936546
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810803481.8A Pending CN109187446A (en) | 2018-07-20 | 2018-07-20 | A kind of gold, silver nanoparticle chiral dimer of detectable 8-OHdG |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109187446A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007244254A (en) * | 2006-03-14 | 2007-09-27 | Kanazawa Univ | Dna aptamer having specific binding property to 8-hydroxydeoxyguanosine |
| CN103698320A (en) * | 2013-12-17 | 2014-04-02 | 江南大学 | Construction method of chiral sensor for detecting DNA enzymatic assembly of lead ion |
| CN103760332A (en) * | 2014-01-16 | 2014-04-30 | 江南大学 | Method for detecting bisphenol A by utilizing aptamer-based chiral sensor |
| CN106290166A (en) * | 2016-09-20 | 2017-01-04 | 江南大学 | A kind of circular dichroism real-time detection method of intracellular ATP |
| CN106434852A (en) * | 2016-09-20 | 2017-02-22 | 江南大学 | Method for realizing intracellular telomerase activity detection based on chiral self-assembled nano sensor |
| CN107805657A (en) * | 2017-09-11 | 2018-03-16 | 杨蕾 | A kind of chiral gold nanoparticle dimer detection ATP method |
-
2018
- 2018-07-20 CN CN201810803481.8A patent/CN109187446A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2007244254A (en) * | 2006-03-14 | 2007-09-27 | Kanazawa Univ | Dna aptamer having specific binding property to 8-hydroxydeoxyguanosine |
| CN103698320A (en) * | 2013-12-17 | 2014-04-02 | 江南大学 | Construction method of chiral sensor for detecting DNA enzymatic assembly of lead ion |
| CN103760332A (en) * | 2014-01-16 | 2014-04-30 | 江南大学 | Method for detecting bisphenol A by utilizing aptamer-based chiral sensor |
| CN106290166A (en) * | 2016-09-20 | 2017-01-04 | 江南大学 | A kind of circular dichroism real-time detection method of intracellular ATP |
| CN106434852A (en) * | 2016-09-20 | 2017-02-22 | 江南大学 | Method for realizing intracellular telomerase activity detection based on chiral self-assembled nano sensor |
| CN107805657A (en) * | 2017-09-11 | 2018-03-16 | 杨蕾 | A kind of chiral gold nanoparticle dimer detection ATP method |
Non-Patent Citations (2)
| Title |
|---|
| FU PAN ET AL.: "A self-assembled chiral-aptasensor for ATP activity detection", 《NANOSCALE》 * |
| LIU YUANJIAN ET AL.: "Chiroplasmonic Assemblies of Gold Nanoparticles for Ultrasensitive Detection of 8‑Hydroxy-2′-deoxyguanosine in Human Serum Sample", 《ANALYTICAL CHEMISTRY》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210247349A1 (en) | METHOD FOR PREPARING RATIOMETRIC ELECTROCHEMICAL miR3123 APTASENSOR BASED ON METAL-ORGANIC FRAMEWORK COMPOSITE | |
| JP3182515B2 (en) | Apparatus for improved luminescence assay | |
| US9428810B2 (en) | Detection of a target in a preservative solution | |
| Yang et al. | A facile fluorescence assay for rapid and sensitive detection of uric acid based on carbon dots and MnO 2 nanosheets | |
| Wang et al. | Bi-functional fluorescent polymer dots: a one-step synthesis via controlled hydrothermal treatment and application as probes for the detection of temperature and Fe 3+ | |
| Vijayan et al. | Nicking enzyme-assisted signal-amplifiable Hg2+ detection using upconversion nanoparticles | |
| CN109307664B (en) | Fluorescent detection probe capable of detecting metal ions in living cells | |
| Zhang et al. | A sensitive fluorescent probe for alkaline phosphatase and an activity assay based on the aggregation-induced emission effect | |
| CN108315421A (en) | Method of the constant-temperature amplification with the combination of quantum dot fluorescence Resonance energy transfer for detecting a variety of MicroRNAs simultaneously | |
| CN103923071A (en) | Specific fluorescent probe for identifying hydrazine and application thereof | |
| Liu et al. | Fluorescence sensor for detecting protamines based on competitive interactions of polyacrylic acid modified with sodium 4-amino-1-naphthalenesulfonate with protamines and aminated graphene oxide | |
| Gao et al. | A fluorescence assay for microRNA let-7a by a double-stranded DNA modified gold nanoparticle nanoprobe combined with graphene oxide | |
| Bonnet et al. | Highly labeled methylene blue-ds DNA silica nanoparticles for signal enhancement of immunoassays: application to the sensitive detection of bacteria in human platelet concentrates | |
| CN110726707B (en) | Based on N-Ti 3 C 2 Composite nano probe of QDs and o-phenylenediamine oxide and detection method thereof | |
| Li et al. | Glucose detection via glucose-induced disaggregation of ammonium-modified tetraphenylethylene from polyanion | |
| Lv et al. | Aptamer based strategy for cytosensing and evaluation of HER-3 on the surface of MCF-7 cells by using the signal amplification of nucleic acid-functionalized nanocrystals | |
| CN105886596B (en) | Cervical cancer cell detection kit | |
| CN108752373B (en) | Fluorescent probe for identifying hydrogen peroxide based on phenylboronate | |
| You et al. | Silica-coated triangular gold nanoprisms as distance-dependent plasmon-enhanced fluorescence-based probes for biochemical applications | |
| CN107219213B (en) | Method for detecting bisphenol A by using surface effect of enzyme-guided crystal growth enhanced Raman spectrum | |
| Tian et al. | Sensitive colorimetric detection of microrna based on target catalyzed double-arm hairpin DNA assembling | |
| CN109187446A (en) | A kind of gold, silver nanoparticle chiral dimer of detectable 8-OHdG | |
| CN112710709A (en) | Cadmium sulfide quantum dot glassy carbon electrode for target DNA detection, preparation method thereof, electrochemical luminescence sensor system and application | |
| Jiang et al. | A gas pressure and colorimetric signal dual-mode strategy for sensitive detection of spermine using ssDNA-coated Au@ Pt nanoparticles as the probe | |
| CN108760695A (en) | A method of the phosphorescence probe based on PRET quantitatively detects fibrin ferment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190111 |