CN109182587A - Ginseng pathogenesis related gene and its detection primer, kit and application and detection method - Google Patents
Ginseng pathogenesis related gene and its detection primer, kit and application and detection method Download PDFInfo
- Publication number
- CN109182587A CN109182587A CN201811272072.6A CN201811272072A CN109182587A CN 109182587 A CN109182587 A CN 109182587A CN 201811272072 A CN201811272072 A CN 201811272072A CN 109182587 A CN109182587 A CN 109182587A
- Authority
- CN
- China
- Prior art keywords
- ginseng
- related gene
- pathogenesis related
- detection
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the detection primer of ginseng pathogenesis related gene, kit and application and detection methods, belong to Chinese herbal medicine prevention and control of plant diseases, pest control field.The detection primer of ginseng pathogenesis related gene provided by the invention, it is convenient that ginseng pathogenesis related gene is detected, have the effect of to the ginseng prevention and control of plant diseases, pest control positive, the ginseng prevention and control of plant diseases, pest control is helped to mention preferable guidance and help, primer be will test applied to reagent preparation box, the convenient detection to related gene, application value with higher.
Description
Technical field
The present invention relates to Chinese herbal medicine prevention and control of plant diseases, pest control fields, in particular to ginseng pathogenesis related gene and its detection
Primer, kit and application and detection method.
Background technique
Black fleck disease of ginseng (English name Alternariapanaxwhetz) belongs to Deuteromycotina, alternaria nees fungus, distribution
In the Northeast, germ is to become next on mycelium and conidium on the ground portion's invalid body, in soil and the surface of the seed is overwintering
The primary source of infection of year morbidity.
Main blade of causing harm, can also cause harm the positions such as stem, bennet, fruit.Scab subcircular or irregular shape on blade are caused,
Yellowish-brown is to dark brown, slightly wheel line, and when scab often results in early stage and withered falls.Scab ellipse on stem, yellowish-brown expand up and down
Exhibition, intermediate recess blackening, the upper raw mould layer of black make stalk lodge.When fruit is aggrieved, surface generates brown spot, gradually shrivelled
At " hang dry seed ".The mould layer of the black born on scab when moist is the conidiophore of pathogen and divides season spore.The disease occurs
It generally, is one of ginseng most serious disease.
It is also less to the research of the relevant gene of black fleck disease of ginseng at present, and black spot can be effectively relieved in external source application silicon
Generation, therefore Exogenous Silicon is worked by what gene and is had no knowledge about at present.
Summary of the invention
The first object of the present invention is to provide ginseng pathogenesis related gene, and it is disease-resistant and coerce relevant can to obtain ginseng
As a result.
The second object of the present invention is to provide the detection primer of ginseng pathogenesis related gene, which can detect and people
Join the relevant gene of the course of disease.
The third object of the present invention is to provide the detection primer of above-mentioned ginseng pathogenesis related gene in ginseng course of disease phase
Application in correlation gene detection.
The fourth object of the present invention is that the detection primer for providing above-mentioned ginseng pathogenesis related gene is preparing ginseng disease
Application in the detection kit of journey related gene.
The fifth object of the present invention is to provide the detection kit of ginseng pathogenesis related gene, detection kit convenience pair
Ginseng pathogenesis related gene is detected.
The sixth object of the present invention is to provide the detection method of ginseng pathogenesis related gene.
In order to realize above-mentioned purpose of the invention, using following technical scheme:
Ginseng pathogenesis related gene, the base sequence of ginseng pathogenesis related gene is as shown in SEQ ID No.1.
The detection primer of ginseng pathogenesis related gene, the base sequence of detection primer is respectively as shown in SEQ ID No.2-3.
Application of the detection primer of above-mentioned ginseng pathogenesis related gene in the detection of ginseng pathogenesis related gene.
The detection primer of above-mentioned ginseng pathogenesis related gene is in the detection kit for preparing ginseng pathogenesis related gene
Application.
The detection kit of ginseng pathogenesis related gene, detection kit include the inspection of above-mentioned ginseng pathogenesis related gene
Survey primer.
The detection method of ginseng pathogenesis related gene, detection method includes the following steps:
The total serum IgE that reagent extracts leaves of panax ginseng sample is extracted with RNA;
Then reverse transcription is carried out with total serum IgE and Reverse Transcription and synthesizes cDNA;
Quantitative fluorescent PCR is carried out with the detection primer of cDNA, quantitative fluorescent PCR reaction reagent and ginseng pathogenesis related gene
Reaction analyzes the expression quantity of ginseng pathogenesis related gene using ginseng actin as reference gene, quantitative fluorescent PCR reaction
93-95 DEG C of initial denaturation 2min;93-95 DEG C of denaturation 5s;58-61 DEG C of annealing 15s;72 DEG C of extension 10s;45 circulations.
Compared with prior art, the beneficial effect comprise that ginseng pathogenesis related gene provided by the invention
Detection primer, it is convenient that ginseng pathogenesis related gene is detected, have the effect of positive, help people to the ginseng prevention and control of plant diseases, pest control
The ginseng prevention and control of plant diseases, pest control mentions preferable guidance and help, will test primer applied to reagent preparation box, the convenient inspection to related gene
It surveys, application value with higher.
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, below will be to needed in the embodiment attached
Figure is briefly described, it should be understood that the following drawings illustrates only certain embodiments of the present invention, therefore is not construed as pair
The restriction of range for those of ordinary skill in the art without creative efforts, can also be according to this
A little attached drawings obtain other relevant attached drawings.
Fig. 1 is the expression quantity qPCR detection figure of the ginseng pathogenesis related gene for the different samples that experimental example of the present invention provides.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment, but those skilled in the art should
Understand, the following example is merely to illustrate the present invention, and is not construed as limiting the scope of the invention.It is not specified in embodiment specific
Condition person carries out according to conventional conditions or manufacturer's recommended conditions.Reagents or instruments used without specified manufacturer is
The conventional products that can be obtained by commercially available purchase.
Below to the ginseng pathogenesis related gene and its detection primer of the embodiment of the present invention, kit and application and detection side
Method is specifically described.
Discovery external source is tested by earth culture and applies the Development process that black fleck disease of ginseng can be effectively relieved in silicon, and plant is transcribed
Group test, obtains six pathogenesis-related proteins, significantly increases (P < 0.05) when being inoculated with black spot;The transcript profile data that will be obtained
It is filtered to obtain Clean Data, carries out sequence alignment with specified reference genome, obtained Mapped Data is carried out
The assessment of the Library Qualities such as Insert Fragment length check, randomness test;Carry out alternative splicing analysis, new gene excavation and gene knot
The structure levels analysis such as structure optimization;Differential expression point is carried out according to expression quantity of the gene in different samples or different sample sets
The expressions analyses such as analysis, difference expression gene functional annotation and function enrichment;Screening obtains base relevant to black fleck disease of ginseng
Because of data.
Ginseng pathogenesis related gene, the base sequence of ginseng pathogenesis related gene is as shown in SEQ ID No.1.
The detection primer of ginseng pathogenesis related gene, the base sequence of detection primer is respectively as shown in SEQ ID No.2-3.
It, can be special by the detection primer for the stronger primer pair of ginseng pathogenesis related gene design specificity in the present invention
Ginseng pathogenesis related gene in anisotropic detection sample.
The upstream primer of detection primer is such as:
SEQ ID NO.2 is 237749F:5 '-CATGCACGACGTTCAAGACC-3 ';
Downstream primer is such as:
SEQ ID NO.3 is 237749R:5 '-CTAGATGGATCATCCTGAGG-3 '.
Product length 127bp.
Application of the detection primer of above-mentioned ginseng pathogenesis related gene in the detection of ginseng pathogenesis related gene.
The detection primer of above-mentioned ginseng pathogenesis related gene is in the detection kit for preparing ginseng pathogenesis related gene
Application.
The detection kit of ginseng pathogenesis related gene, detection kit include the inspection of above-mentioned ginseng pathogenesis related gene
Survey primer.
It further, at least further include that RNA extracts reagent, Reverse Transcription and glimmering in preferred embodiments of the present invention
One of Fluorescent Quantitative PCR reaction reagent.
The total serum IgE in reagent extraction ginseng sample is extracted by the RNA that kit provides, is carried out using Reverse Transcription anti-
Transcription, and PCR reaction is carried out with quantitative fluorescent PCR reaction reagent, ginseng just can be detected by the expression of related gene
Incidence.
In kit, including integrated detection primer and related matched chemical reagent, it is convenient that gene is detected;Together
When, corresponding detection reagent is provided by kit, stability, the reliability and accuracy of detection can be improved.
Further, in preferred embodiments of the present invention, it is Trizol, chloroform, isopropanol and 75% that RNA, which extracts reagent,
At least one of ethyl alcohol.
Further, in preferred embodiments of the present invention, Reverse Transcription is Oligo (dT)18Primer, reverse transcription are slow
At least one of fliud flushing, RNase Inhibitor, dNTP and reverse transcriptase.
Further, in preferred embodiments of the present invention, quantitative fluorescent PCR reaction reagent includes TransStart Top
Green qPCRSuperMix。
The detection method of ginseng pathogenesis related gene, detection method includes the following steps:
The total serum IgE that reagent extracts leaves of panax ginseng sample is extracted with RNA;
Then reverse transcription is carried out with total serum IgE and Reverse Transcription and synthesizes cDNA;
Quantitative fluorescent PCR is carried out with the detection primer of cDNA, quantitative fluorescent PCR reaction reagent and ginseng pathogenesis related gene
Reaction analyzes the expression quantity of ginseng pathogenesis related gene, the item of quantitative fluorescent PCR reaction using ginseng actin as reference gene
Part are as follows: 93-95 DEG C of initial denaturation 2min;93-95 DEG C of denaturation 5s;58-61 DEG C of annealing 15s;72 DEG C of extension 10s;45 circulations.
Feature and performance of the invention are described in further detail with reference to embodiments.
Embodiment 1
The present embodiment provides ginseng pathogenesis related genes, and the gene is disease-resistant related to ginseng, and the base sequence of the gene is such as
Shown in SEQ ID NO.1.
Ginseng pathogenesis related gene SEQ ID NO.1 is as follows:
CATGCACGAC GTTCAAGACC CCACAATACT GTTGCACCAA TGGACCATGT
GGCCCCACAGGTTACTCAAG GTTTTTCAAG GAAAGGTGCC CTGATGCCTA TAGTTATCCT CAGGATGATC
CAACTAG
The present embodiment provides the detection primers of ginseng pathogenesis related gene, and the base sequence of detection primer is respectively such as SEQ ID
Shown in No.2-3.
The upstream primer of detection primer is such as:
SEQ ID NO.2 is 237749F:5 '-CATGCACGACGTTCAAGACC-3 ';
Downstream primer is such as:
SEQ ID NO.3 is 237749R:5 '-CTAGATGGATCATCCTGAGG-3 '.
The detection primer of above-mentioned detection ginseng pathogenesis related gene is directed to ginseng pathogenesis related gene, with strong points, therefore
Have preferable specificity, by detection primer, so that testing result is more reliable and accurate, therefore can be applied to ginseng disease
In the detection of journey related gene.
At the same time it can also which the detection primer of ginseng pathogenesis related gene to be applied to the inspection for preparing ginseng pathogenesis related gene
In test agent box.
Embodiment 2
The present embodiment provides the detection kit of ginseng pathogenesis related gene, detection kit includes that ginseng is pathogenesis-related
The detection primer of cause, the base sequence of detection primer is respectively as shown in SEQ ID No.1-2.
The upstream primer of detection primer is such as:
SEQ ID NO.2 is 237749F:5 '-CATGCACGACGTTCAAGACC-3 ';
Downstream primer is such as:
SEQ ID NO.3 is 237749R:5 '-CTAGATGGATCATCCTGAGG-3 '.
Embodiment 3
The present embodiment provides the detection kit of ginseng pathogenesis related gene, detection kit includes that ginseng is pathogenesis-related
The detection primer of cause, the base sequence of detection primer is respectively as shown in SEQ ID No.1-2.
The upstream primer of detection primer is such as:
SEQ ID NO.2 is 237749F:5 '-CATGCACGACGTTCAAGACC-3 ';
Downstream primer is such as:
SEQ ID NO.3 is 237749R:5 '-CTAGATGGATCATCCTGAGG-3 '.
The detection kit of ginseng pathogenesis related gene at least further includes that RNA extraction reagent, Reverse Transcription and fluorescence are fixed
Measure one of PCR reaction reagent.
It is at least one of Trizol, chloroform, isopropanol and 75% ethyl alcohol that RNA, which extracts reagent,.
Reverse Transcription is Oligo (dT)18Primer, reverse transcription buffer, RNase Inhibitor, dNTP and anti-
At least one of transcriptase.
Quantitative fluorescent PCR reaction reagent includes TransStart Top Green qPCRSuperMix.
Embodiment 4
The present embodiment is using the detection primer of ginseng pathogenesis related gene provided by the invention to ginseng pathogenesis related gene
Detection method.
The extraction of the leaves of panax ginseng total serum IgE of black fleck disease of ginseng is infected, Trizol is used to extract total serum IgE in this experimental example, it is real
It tests agents useful for same and consumptive material is RNase-free, the specific steps are as follows:
1.1 take 100mg leaves of panax ginseng tissue, and liquid nitrogen grinding is transferred in centrifuge tube at powder;
1.2 addition 1mLTrizol are vortexed mixing immediately, are placed at room temperature for 5-10min;
1.3 at 4 DEG C, and 13,000g is centrifuged 15min, takes 900 μ L supernatants into new centrifuge tube, and 500 μ L chloroforms are added and are vortexed
It mixes;
1.4 at 4 DEG C, and 13,000g is centrifuged 15min, takes 500 μ L supernatants into new centrifuge tube, and the shake of 500 μ L isopropanols is added
Swing mixing;
1.5 at 4 DEG C, and 13,000g is centrifuged 15min, abandons supernatant, is precipitated 2-3 times with 75% ethanol washing, abandon ethyl alcohol, room temperature
Dry 5min;
1.6 are added suitable RNase-free water dissolution precipitating;
1.7 take 2 μ LRNA samples to dilute 10 times, and the concentration and purity of RNA are measured with NanoVue ultramicrospectrophotometer,
The quality and integrality for carrying out agarose gel electrophoresis detection RNA simultaneously are placed at room temperature for 10min;
1.8, as having DNA pollution in detection discovery RNA sample, need to handle sample simultaneously using DNaseI (Rnase-free)
Extracting detecting step before repeating;After total serum IgE sample no problem, -80 DEG C of reversions for saving backup or directly carrying out next step
Record experiment.
Reverse transcription is carried out using the total serum IgE of aforementioned extraction to synthesize to obtain cDNA, uses TransScript II All-in-
One First-Strand cDNA Synthesis SuperMix for qPCR (one-step gDNA Removal) (goods
Number: AH341), specific experiment is as follows:
Reaction system is as follows:
Reverse transcription condition:
55℃ 30min;
85℃ 5s.80 μ LRNase-free Water are added after reaction to dilute to obtain cDNA.
With the detection primer of ginseng pathogenesis related gene, the base sequence of detection primer is respectively such as SEQ ID No.1-2 institute
Show.
The upstream primer of detection primer is such as:
SEQ ID NO.2 is 237749F:5 '-CATGCACGACGTTCAAGACC-3 ';
Downstream primer is such as:
SEQ ID NO.3 is 237749R:5 '-CTAGATGGATCATCCTGAGG-3 '.Carry out ginseng pathogenesis related gene
Expression quantity measurement, and use ginseng actin gene as reference gene.
The reaction system of qPCR are as follows:
Reaction condition are as follows: 93 DEG C of initial denaturation 2min;93 DEG C of denaturation 5s;58 DEG C of annealing 15s;72 DEG C of extension 10s;45 are followed
Ring.
Embodiment 5
The present embodiment is using the detection primer of ginseng pathogenesis related gene provided by the invention to ginseng pathogenesis related gene
Expression quantity detected.
The extraction of the leaves of panax ginseng total serum IgE of black fleck disease of ginseng is infected, Trizol is used to extract total serum IgE in this experimental example, it is real
It tests agents useful for same and consumptive material is RNase-free, the specific steps are as follows:
1.1 take 100mg leaves of panax ginseng tissue, and liquid nitrogen grinding is transferred in centrifuge tube at powder;
1.2 addition 1mLTrizol are vortexed mixing immediately, are placed at room temperature for 5-10min;
1.3 at 4 DEG C, and 13,000g is centrifuged 15min, takes 900 μ L supernatants into new centrifuge tube, and 500 μ L chloroforms are added and are vortexed
It mixes;
1.4 at 4 DEG C, and 13,000g is centrifuged 15min, takes 500 μ L supernatants into new centrifuge tube, and the shake of 500 μ L isopropanols is added
Swing mixing;
1.5 at 4 DEG C, and 13,000g is centrifuged 15min, abandons supernatant, is precipitated 2-3 times with 75% ethanol washing, abandon ethyl alcohol, room temperature
Dry 5min;
1.6 are added suitable RNase-free water dissolution precipitating;
1.7 take 2 μ LRNA samples to dilute 10 times, and the concentration and purity of RNA are measured with NanoVue ultramicrospectrophotometer,
The quality and integrality for carrying out agarose gel electrophoresis detection RNA simultaneously are placed at room temperature for 10min;
1.8, as having DNA pollution in detection discovery RNA sample, need to handle sample simultaneously using DNaseI (Rnase-free)
Extracting detecting step before repeating;After total serum IgE sample no problem, -80 DEG C of reversions for saving backup or directly carrying out next step
Record experiment.
Reverse transcription is carried out using the total serum IgE of aforementioned extraction to synthesize to obtain cDNA, uses TransScript II All-in-
One First-Strand cDNA Synthesis SuperMix for qPCR (one-step gDNA Removal) (goods
Number: AH341), specific experiment is as follows:
Reaction system is as follows:
Reverse transcription condition:
55℃ 30min;
85℃ 5s.80 μ LRNase-free Water are added after reaction to dilute to obtain cDNA.
With the detection primer of ginseng pathogenesis related gene, the base sequence of detection primer is respectively such as SEQ ID No.1-2 institute
Show.
The upstream primer of detection primer is such as:
SEQ ID NO.2 is 237749F:5 '-CATGCACGACGTTCAAGACC-3 ';
Downstream primer is such as:
SEQ ID NO.3 is 237749R:5 '-CTAGATGGATCATCCTGAGG-3 '.Carry out ginseng pathogenesis related gene
Expression quantity measurement, and use ginseng actin gene as reference gene.
The reaction system of qPCR are as follows:
Reaction condition are as follows: 95 DEG C of initial denaturation 2min;95 DEG C of denaturation 5s;61 DEG C of annealing 15s;72 DEG C of extension 10s;45 are followed
Ring.
Embodiment 6
The present embodiment is using the detection primer of ginseng pathogenesis related gene provided by the invention to ginseng pathogenesis related gene
Expression quantity detected.
The extraction of the leaves of panax ginseng total serum IgE of black fleck disease of ginseng is infected, Trizol is used to extract total serum IgE in this experimental example, it is real
It tests agents useful for same and consumptive material is RNase-free, the specific steps are as follows:
1.1 take 100mg leaves of panax ginseng tissue, and liquid nitrogen grinding is transferred in centrifuge tube at powder;
1.2 addition 1mLTrizol are vortexed mixing immediately, are placed at room temperature for 5-10min;
1.3 at 4 DEG C, and 13,000g centrifugation 15min take 900 μ L supernatants into new centrifuge tube, 500 μ L chloroforms are added and are vortexed
It mixes;
1.4 at 4 DEG C, and 13,000g centrifugation 15min take 500 μ L supernatants into new centrifuge tube, the shake of 500 μ L isopropanols is added
Swing mixing;
1.5 at 4 DEG C, and 13,000g centrifugation 15min abandon supernatant, precipitated 2-3 times with 75% ethanol washing, abandon ethyl alcohol, room temperature
Dry 5min;
1.6 are added suitable RNase-free water dissolution precipitating;
1.7 take 2 μ LRNA samples to dilute 10 times, and the concentration and purity of RNA are measured with NanoVue ultramicrospectrophotometer,
The quality and integrality for carrying out agarose gel electrophoresis detection RNA simultaneously are placed at room temperature for 10min;
1.8, as having DNA pollution in detection discovery RNA sample, need to handle sample simultaneously using DNaseI (Rnase-free)
Extracting detecting step before repeating;After total serum IgE sample no problem, -80 DEG C of reversions for saving backup or directly carrying out next step
Record experiment.
Reverse transcription is carried out using the total serum IgE of aforementioned extraction to synthesize to obtain cDNA, uses TransScript II All-in-
One First-Strand cDNA Synthesis SuperMix for qPCR (one-step gDNA Removal) (goods
Number: AH341), specific experiment is as follows:
Reaction system is as follows:
Reverse transcription condition:
55℃ 30min;
85℃ 5s.80 μ LRNase-free Water are added after reaction to dilute to obtain cDNA.
With the detection primer of ginseng pathogenesis related gene, the base sequence of detection primer is respectively such as SEQ ID No.1-2 institute
Show.
The upstream primer of detection primer is such as:
SEQ ID NO.2 is 237749F:5 '-CATGCACGACGTTCAAGACC-3 ';
Downstream primer is such as:
SEQ ID NO.3 is 237749R:5 '-CTAGATGGATCATCCTGAGG-3 '.Carry out ginseng pathogenesis related gene
Expression quantity measurement, and use ginseng actin gene as reference gene.
The reaction system of qPCR are as follows:
Reaction condition are as follows: 94 DEG C of initial denaturation 2min;94 DEG C of denaturation 5s;60 DEG C of annealing 15s;72 DEG C of extension 10s;45 are followed
Ring.
Experimental example
The detection method that this experimental example is provided by embodiment 6 carries out ginseng pathogenesis related gene to 4 samples of selection
(code name: 237749) expression quantity is detected.The quantitative result of this experimental example is as shown in Figure 1.
As shown in Figure 1, it can be seen that ginseng pathogenesis related gene (code name: 237749) expression quantity in 4 different samples
There are larger differences.
In conclusion the detection primer of ginseng pathogenesis related gene provided in an embodiment of the present invention, and utilize the detection
The detection kit of primer preparation, has preferable specificity and higher sensitivity, testing result is accurate and reliable, can be in people
In ginseng plantation and the prevention and control of plant diseases, pest control.
Embodiments described above is a part of the embodiment of the present invention, instead of all the embodiments.The present invention is implemented
The detailed description of example is not intended to limit the range of claimed invention, but is merely representative of selected implementation of the invention
Example.Based on the embodiments of the present invention, obtained by those of ordinary skill in the art without making creative efforts
Every other embodiment, shall fall within the protection scope of the present invention.
SEQUENCE LISTING
<110>Gao Yun
<120>ginseng pathogenesis related gene and its detection primer, kit and application and detection method
<170> PatentIn version 3.5
<210> 1
<211> 127
<212> DNA
<213> Alternaria panax
<400> 1
catgcacgac gttcaagacc ccacaatact gttgcaccaa tggaccatgt ggccccacag 60
gttactcaag gtttttcaag gaaaggtgcc ctgatgccta tagttatcct caggatgatc 120
caactag 127
<210> 2
<211> 20
<212> DNA
<213>artificial synthesized
<400> 2
catgcacgac gttcaagacc 20
<210> 3
<211> 20
<212> DNA
<213>artificial synthesized
<400> 3
ctagatggat catcctgagg 20
Claims (10)
1. ginseng pathogenesis related gene, which is characterized in that the base sequence of the ginseng pathogenesis related gene such as SEQ ID No.1
It is shown.
2. detecting the detection primer of ginseng pathogenesis related gene as described in claim 1, which is characterized in that the detection primer
Base sequence respectively as shown in SEQ ID No.2-3.
3. the detection primer of ginseng pathogenesis related gene as claimed in claim 2 answering in the detection of ginseng pathogenesis related gene
With.
4. the detection primer of ginseng pathogenesis related gene as claimed in claim 2 is in the detection for preparing ginseng pathogenesis related gene
Application in kit.
5. the detection kit of ginseng pathogenesis related gene, which is characterized in that the detection kit includes described in claim 1
Ginseng pathogenesis related gene detection primer.
6. the detection kit of ginseng pathogenesis related gene according to claim 5, which is characterized in that at least further include
RNA extracts one of reagent, Reverse Transcription and quantitative fluorescent PCR reaction reagent.
7. the detection kit of ginseng pathogenesis related gene according to claim 6, which is characterized in that the RNA is extracted
Reagent is at least one of Trizol, chloroform, isopropanol and 75% ethyl alcohol.
8. the detection kit of ginseng pathogenesis related gene according to claim 7, which is characterized in that the reverse transcription examination
Agent is at least one in Oligo (dT) 18primer, reverse transcription buffer, RNase Inhibitor, dNTP and reverse transcriptase
Kind.
9. the detection kit of ginseng pathogenesis related gene according to claim 8, which is characterized in that quantitative fluorescent PCR
Reaction reagent includes TransStart Top Green qPCRSuperMix.
10. the detection method of ginseng pathogenesis related gene, which is characterized in that described detection method includes the following steps:
The total serum IgE that reagent extracts leaves of panax ginseng sample is extracted with RNA;
Then reverse transcription is carried out with the total serum IgE and Reverse Transcription and synthesizes cDNA;
Quantitative fluorescent PCR is carried out with the detection primer of the cDNA, quantitative fluorescent PCR reaction reagent and ginseng pathogenesis related gene
Reaction analyzes the expression quantity of ginseng pathogenesis related gene, the quantitative fluorescent PCR reaction using ginseng actin as reference gene
93-95 DEG C of initial denaturation 2min;93-95 DEG C of denaturation 5s;58-61 DEG C of annealing 15s;72 DEG C of extension 10s;45 circulations.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811272072.6A CN109182587A (en) | 2018-10-29 | 2018-10-29 | Ginseng pathogenesis related gene and its detection primer, kit and application and detection method |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811272072.6A CN109182587A (en) | 2018-10-29 | 2018-10-29 | Ginseng pathogenesis related gene and its detection primer, kit and application and detection method |
Publications (1)
Publication Number | Publication Date |
---|---|
CN109182587A true CN109182587A (en) | 2019-01-11 |
Family
ID=64944400
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811272072.6A Pending CN109182587A (en) | 2018-10-29 | 2018-10-29 | Ginseng pathogenesis related gene and its detection primer, kit and application and detection method |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109182587A (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101845504A (en) * | 2010-06-11 | 2010-09-29 | 天津科润农业科技股份有限公司 | Primer sequence for identifying resistance of cucumber against alternaria cucumerina and identification method thereof |
CN105506057A (en) * | 2016-01-26 | 2016-04-20 | 浙江省农业科学院 | Method for performing banded sclerotial blight inoculation and resistance evaluation by means of rice detached leaves |
CN106244599A (en) * | 2016-09-21 | 2016-12-21 | 昆明理工大学 | A kind of Radix Notoginseng pathogenesis-related proteins 1 family gene PnPR1 2 and application |
-
2018
- 2018-10-29 CN CN201811272072.6A patent/CN109182587A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101845504A (en) * | 2010-06-11 | 2010-09-29 | 天津科润农业科技股份有限公司 | Primer sequence for identifying resistance of cucumber against alternaria cucumerina and identification method thereof |
CN105506057A (en) * | 2016-01-26 | 2016-04-20 | 浙江省农业科学院 | Method for performing banded sclerotial blight inoculation and resistance evaluation by means of rice detached leaves |
CN106244599A (en) * | 2016-09-21 | 2016-12-21 | 昆明理工大学 | A kind of Radix Notoginseng pathogenesis-related proteins 1 family gene PnPR1 2 and application |
Non-Patent Citations (2)
Title |
---|
GOHAR TAJ等: "Pahtogenesis mechanisms employed by Alternaria species", 《JOURNAL OF OILSEED BRASSICA》 * |
许振宁: "基于转录组分析的三七抗黑斑病关键基因的研究", 《中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Mekuria et al. | Rapid and sensitive detection of Little cherry virus 2 using isothermal reverse transcription-recombinase polymerase amplification | |
Abarshi et al. | Optimization of diagnostic RT-PCR protocols and sampling procedures for the reliable and cost-effective detection of Cassava brown streak virus | |
CN106086167B (en) | The primer sequence and method of a kind of Rapid identification Larimichthys crocea, little yellow croaker and Collichthys lucidus | |
CN101519697A (en) | Phytophthora sojae molecule detecting primer and detection reagent kit thereof | |
CN110117592A (en) | A method of quickly detecting fusarium moniliforme rattan storehouse fusarium based on RPA | |
CN108841996A (en) | Newcastle disease novel visual recombinase polymerase room temperature amplification of nucleic acid test strips detection kit and application | |
Aparicio et al. | Simultaneous detection of six RNA plant viruses affecting tomato crops using a single digoxigenin-labelled polyprobe | |
CN106868164A (en) | A kind of primer and nested PCR detection method for detecting camphor tree phytophthora | |
CN107090521A (en) | The kit of TNA of HIV-1 total nucleic acid HIV 1 a kind of and its application | |
CN112322768B (en) | Rapid RPA detection method for diagnosing sea-buckthorn branch blight and pathogenic bacteria | |
CN106381341A (en) | Phytophthora colocasiae nested PCR detection primer and application thereof | |
CN107723381A (en) | Banana crown rot bacterium LAMP detection primer and its detection method | |
CN109182587A (en) | Ginseng pathogenesis related gene and its detection primer, kit and application and detection method | |
CN109280719A (en) | Ginseng pathogenesis related gene and its detection primer, kit and application and detection method | |
Bilodeau et al. | Multiplex real-time polymerase chain reaction (PCR) for detection of Phytophthora ramorum, the causal agent of sudden oak death | |
CN105177182B (en) | A kind of DPO primer and kit detecting No. 3 real-time fluorescence PCRs of grape leaf roll associated virus | |
CN107385108A (en) | A kind of detection kit and its detection method of new marmor upsilon coe virus in lotus rhizome | |
Yang et al. | Investigation of viruses infecting rice in southern China using a multiplex RT-PCR assay | |
CN107828912A (en) | A kind of dosporium cucumerinumand LAMP detection primer and detection method | |
CN107586866A (en) | Thin shell mountain pecan Peach cultivars Moore characteristic sequence, labeled primer and authentication method | |
CN105274245B (en) | A kind of method and its special primer pair for identifying David's-harp | |
Picó et al. | Quantitative detection of Cucumber vein yellowing virus in susceptible and partially resistant plants using real-time PCR | |
CN107574233A (en) | For detecting primer sets, kit and the method for the mutation of the Exon deletion of EGFR gene 19 | |
CN104232755A (en) | Tobacco phytophthora LAMP detection primer and rapid detection method thereof | |
CN104561270B (en) | The molecular biology differentiating method of two kinds of rice leaf folder larvas |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190111 |