CN109182565A - A kind of kit and primer that can detect pathogenic leptospire extensively - Google Patents
A kind of kit and primer that can detect pathogenic leptospire extensively Download PDFInfo
- Publication number
- CN109182565A CN109182565A CN201811088581.3A CN201811088581A CN109182565A CN 109182565 A CN109182565 A CN 109182565A CN 201811088581 A CN201811088581 A CN 201811088581A CN 109182565 A CN109182565 A CN 109182565A
- Authority
- CN
- China
- Prior art keywords
- primer
- extensively
- kit
- type
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of kit and primer that can detect pathogenic leptospire extensively, and 3 pairs of annealing temperatures are consistent, and the identical primer combination of purpose band size can be placed on same reaction system, can accurately detect coupler body serotype in 15.It selects LigL32 gene as test object, using 3 pairs of specific primers, realizes the purpose of detection pathogenic leptospire extensively.The present invention provides a kind of time saving and energy saving, specificity and sensibility are excellent, can detect the PCR primer and kit of Leptospira in China extensively.Primer and kit provided by the invention, it can be used for the early diagnosis of leptospirosis in this experiment, it establishes and the extensive detection pathogenic leptospire disease PCR method specificity assembled is strong, and the sensitivity for detecting coupler body concentration can reach the DNA content of 1 coupler body.
Description
Technical field
The present invention provides a kind of kit and primer that can detect pathogenic leptospire extensively, and 3 pairs of primers are put into
Same reaction system, be capable of specificity detects 15 kinds of type strain coupler bodies, time saving and energy saving, the pathogenic coupler body serotype of detection
Extensively, belong to field of biotechnology.
Background technique
Leptospirosis (abbreviation Leptospirosis) is a kind of nature as caused by pathogenic leptospire (abbreviation coupler body)
Epidemic disease source property zoonosis, compromises the development of people's health and animal husbandry.Leptospira possesses numerous serotypes,
There are at least 15 kinds of pathogenic coupler bodies in China, respectively rely type (56601), Java type (56602), dog type (56603), visit homotopy type
(56604), pyrogenicity type (56605), autumn type (56606), Australia type (56607), pomona type (56608), face type
(56609), nanukayami type (56610), Ba Yezan type (56612), Maksim Tarasov type (56613), clear water type (56615), Wu Er
Husband's type (56635) and bright Buddhist nun's type (56655), the interior reference culture for this kind of serotype of bracket.
Presently, there are common coupler body PCR detection primer and patented product, such as LipL-32 242 and Publication No.
CN103205502A, Publication No. CN101935696A Chinese patent all above all of coupler body serotype cannot all be examined
It measures, can only detect the serotype of certain several coupler body, the false negative for causing PCR to detect, above-mentioned technical proposal can not be examined extensively
Pathogenic leptospire is surveyed, consequence is serious.
Summary of the invention
In order to solve the problems in the existing technology, the present invention discloses one kind can detect pathogenic leptospire extensively
Kit and primer；3 pairs of annealing temperatures are consistent, the consistent PCR primer of purpose band is placed on the same reaction system, purpose
It is a kind of time saving and energy saving to be to provide, and specificity and sensibility are excellent, can detect pathogenic leptospire LigL32 gene extensively
PCR primer and kit can be used for detecting the early diagnosis of pathogenic leptospire disease.
The principle of the invention is to have selected Leptospira LigL32 gene as test object, and is directed to different serotypes
The LigL32 gene of Leptospira devises 3 pairs of consistent PCR primers of annealing temperature, increases popularity, the specificity of detection
And sensibility.
In order to achieve the object of the present invention, technical scheme is as follows:
The present invention provides a kind of PCR primer of pathogenic leptospire of detection extensively, and the primer is as follows:
Upstream primer: 5 '-CAGGCGACGGAGACTTAG-3 '；
5'- CAGGCGACGGAGACTTAG-3'；
5'- CGGGCGACGGAGATTTAG-3'；
Downstream primer: 5 '-AGACTCTTCAGCAGCGATAG -3 '；
5'- AGATTCTTCGGCGGCGATAG-3'；
5’- AGATTCTTCAGCTGCTATGG-3’。
The expanding fragment length of the primer is 468bp.
A kind of kit of pathogenic leptospire of detection extensively of the present invention, which is characterized in that the reagent
Box includes: above-mentioned PCR primer, positive control, negative control, Taq enzyme, dNTP, 10 × Buffer, ddH2O；It is specific as follows:
1) positive control 20uL*1 is managed；
2) negative control 20uL*1 is managed；
3) reaction tube 23ul*8 is managed.
A kind of reagent box preparation method of pathogenic leptospire of detection extensively of the present invention, including following step
It is rapid:
1) 56601 coupler bodies are cultivated in the preparation of positive control, extract 108The DNA of a coupler body is washed with 50ul TE buffer
It is de-, nucleic acid concentration is detected, and be diluted to 1ng/uL with TE buffer, -20 DEG C of preservations after packing；
2) preparation of negative control carries out high pressure sterilization processing, -20 DEG C after packing by distilled water after 0.22um membrane filtration
It saves；
3) preparation of reaction tube, by 3 pairs of primers, Taq enzyme, dNTP, 10 × Buffer and ddH2O is uniformly mixed, wherein every is drawn
The final concentration of 0.5uM of object, the volume ratio of Taq enzyme are 1:50, and the volume ratio of dNTP is 4:50, the volume ratio of 10 × Buffer
For 1:10, ddH is added2O constant volume is to 4.6ml, -20 DEG C of preservations after packing；
4) DNA for extracting sample to be tested, 2uL sample DNA is added in reaction tube；
5) it takes positive control 2uL in reaction tube as the positive control of detection, while negative control 2uL being taken to do in reaction tube
For the negative control of detection；
6) PCR instrument, 94 DEG C of initial denaturation 3min are put into；94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 35 recycle；
72 DEG C of extension 5min；
7) product is carried out to 1% nucleic acid gel electrophoresis, 110v, 20min are observed with gel imager, purpose band size
For 468bp.
Since the amplified fragments of the primer are able to demonstrate that the presence of Leptospira LigL32 gene, to prove to cause a disease
Property Leptospira presence, therefore, the primer can be used to prepare the kit of detection pathogenic leptospire extensively；Make
The primer can farthest increase reaction success rate and reaction effect.
The beneficial effects of the present invention are:
It is consistent that the present invention devises 3 pairs of annealing temperatures, and the identical primer combination of purpose band size can be placed on same reactant
System, can accurately detect 15 kinds of coupler body serotypes.Select LigL32 gene as test object, using 3 pairs of specific primers,
Realize the purpose of detection pathogenic leptospire extensively.The present invention provides a kind of time saving and energy saving, specificity and sensibility are excellent
It is different, the PCR primer and kit of Leptospira can be detected extensively.Primer and kit provided by the invention, can be used for hook end
The early diagnosis of spirochetosis in this experiment, establishes and the extensive detection pathogenic leptospire disease PCR method assembled is special
It is anisotropic strong, and the sensitivity for detecting coupler body concentration can reach the DNA content of 1 coupler body.
Detailed description of the invention
Fig. 1 is the PCR effect picture of embodiment 1；
Fig. 2 is the PCR effect picture of embodiment 2；(P.S:M is expressed as DNAmaker, 1-15 respectively indicates: Leptospira mark
Quasi- bacterial strain relies type 56601, Java type 56602, dog type 56603, visits homotopy type 56604, pyrogenicity type 56605, autumn type 56606,
Australia type 56607, pomona type 56608 face type 56609, nanukayami type 56610, Ba Yezan type 56612, Maksim Tarasov type
56613, clear water type 56615, Wu Erfu type 56635, bright Buddhist nun's type 56655)
Fig. 3 is the PCR effect picture of test example 1；
Fig. 4 is the PCR effect picture of test example 2；(P.S:1-3 is respectively as follows: negative control, Escherichia coli, non-pathogenic hook end spiral shell
Revolve body)；
Fig. 5 is the PCR effect picture of test example 3.
Specific embodiment
The preferred embodiment of the present invention is described in detail below in conjunction with embodiment.It will be appreciated that following real
Providing merely to play the purpose of explanation for example is applied, is not used to limit the scope of the present invention.The skill of this field
Art personnel without departing from the spirit and purpose of the present invention, can carry out various modifications and replace to the present invention.
Experimental method used in following embodiments is conventional method unless otherwise specified.Institute in following embodiments
Material, reagent etc., are commercially available unless otherwise specified.
1, bacterial strain and clinical sample
Leptospira reference culture relies type 56601, Java type 56602, and dog type 56603 visits homotopy type 56604, pyrogenicity type
56605, autumn type 56606, Australia type 56607, pomona type 56608 faces type 56609, nanukayami type 56610, Ba Yezan
Type 56612, Maksim Tarasov type 56613, clear water type 56615, Wu Erfu type 56635, bright Buddhist nun's type 56655, non-pathogenic coupler body
566505, laboratory passage culture saves where project.
2, key instrument and reagent
Gel electrophoresis images analysis system (Liuyi Instruments Plant, Beijing, China)；Grads PCR instrument (Biometra UNO, Germany)；
CO2 constant incubator (SANYO, Japan), bacterial genomes DNA extraction kit and plastic recovery kit are public purchased from Tiangeng
Department；The conventional reagents such as Taq enzyme, agarose are purchased from domestic company.
Embodiment 1
Design of primers and synthesis
According to the LigL32 gene order for the coupler body different serotypes delivered in GenBank, using Primer Premier
5.0 software designs obtain different primers, obtain the consistent specific primer of 3 pairs of return of goods temperature of the present invention through screening.
It screens obtained primer and specificity identification is carried out by the BLAST in NCBI, as shown in table 1.Primer is by library beauty
Biotech firm's synthesis.
Upstream primer:
5'- CAGGCGACGGAGACTTAG-3'；
5'- CAGGCGACGGAGACTTAG-3'；
5'- CGGGCGACGGAGATTTAG-3'；
Downstream primer:
5'- AGACTCTTCAGCAGCGATAG -3'；
5'- AGATTCTTCGGCGGCGATAG-3'；
5’- AGATTCTTCAGCTGCTATGG-3’。
Embodiment 2
The PCR reaction of 2 kinds of primers
Using 3 pairs of primers of the invention, 15 kinds of coupler body serotypes are detected, common LipL-32 242 in documents
Primer analyzes the superiority of 3 pairs of primers of the invention in test；
According to the bacterium group DNA extraction kit description of product, DNA is extracted as template from well-grown coupler body bacterium solution；
Using coupler body DNA as template, reaction system and condition: 12.5 μ L, Taq enzyme, 1 μ L, upstream and downstream primer described in embodiment 1 is each,
Template 1.5 μ L, ddH2O 5 μ L supply, system be 25 μ L；
Reaction condition: 94 DEG C of 3min；94 DEG C of 30s, annealing temperature 60 DEG C of 30s, 72 DEG C of 30s, 35 circulations；72℃ 5min.
PCR reaction is carried out, and agarose gel electrophoresis is carried out to PCR product and observes result.Three pairs of primers can be this paper institute referring to fig. 2
Stating bacterial strain all detected, and band is clear, and detection effect is good；
By attached drawing 2 it is found that 242 primer of LipL-32 cannot detect whole bacterial strains, and band is not especially clearly, to distinguish
It is not bad.
Embodiment 3
The assembling of kit:
1) 56601 coupler bodies are cultivated in the preparation of positive control, extract 108The DNA of a coupler body is washed with 50ul TE buffer
It is de-, nucleic acid concentration is detected, and be diluted to 1ng/uL with TE buffer, -20 DEG C of preservations after packing；
2) preparation of negative control carries out high pressure sterilization processing, -20 DEG C after packing by distilled water after 0.22um membrane filtration
It saves；
3) preparation of reaction tube, by 3 pairs of primers, Taq enzyme, dNTP, 10 × Buffer and ddH2O mixed uniform, wherein every is drawn
The final concentration of 0.5uM of object, the volume ratio of Taq enzyme are 1:50, and the volume ratio of dNTP is 4:50, the volume ratio of 10 × Buffer
For 1:10, ddH is added2O constant volume is to 4.6ml, -20 DEG C of preservations after packing；
4) DNA for extracting sample to be tested, 2uL sample DNA is added in reaction tube；
5) it takes positive control 2uL in reaction tube as the positive control of detection, while negative control 2uL being taken to do in reaction tube
For the negative control of detection；
6) PCR instrument, 94 DEG C of initial denaturation 3min are put into；94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 35 recycle；
72 DEG C of extension 5min；
7) product is carried out to 1% nucleic acid gel electrophoresis, 110v, 20min are observed with gel imager, purpose band size
For 468bp；
In PCR detection kit, including positive control and each pipe of negative control article, upstream and downstream described in embodiment 1
Primer and Taq enzyme, dNTP, 10 × Buffer and ddH2O are then lumped together into reaction tube, and the volume of reaction tube is
23uL, so kit one shares 10 pipe products.
Test example 1
Sensitivity test
It chooses well-grown 56601 coupler body bacterium solution to be counted, is diluted to 109 thallus/mL, extract phage gene group DNA, institute
Obtaining liquid is 50 μ L, then carries out 10 times of gradient dilutions with DNA of the Buffer TE to thallus: the extracted DNA liquid of 10 μ L being taken to add
Enter be made in the TE of 90 μ L 108 thallus DNA liquid, then 10 times of gradient dilutions to 100, PCR reaction can detect minimum bacterium
Body DNA concentration, the 9th hole are the amount of DNA of 1 coupler body, and shown in Figure 3 (P.S:M is expressed as DNAmaker, 1-15 difference tables
Show: Leptospira reference culture relies type 56601, Java type 56602, and dog type 56603 visits homotopy type 56604, pyrogenicity type
56605, autumn type 56606, Australia type 56607, pomona type 56608 faces type 56609, nanukayami type 56610, Ba Yezan
Type 56612, Maksim Tarasov type 56613, clear water type 56615, Wu Erfu type 56635, bright Buddhist nun's type 56655).
Test example 2
Repetitive test
Using same concentrations coupler body DNA standard items as template, in a PCR reaction, carries out multitube and reflected simultaneously, configured
1% Ago-Gel carries out before electrophoresis when being loaded, and the sample-adding amount in every hole is consistent, as a result as shown in the figure.Referring to fig. 4 may be used
Know, the band of each sample is bright, and repeatability is good.
Test example 3
Specific test
Since designed primer can detected coupler body described in example 1, so utilizing primer described in embodiment 1
Carry out the PCR reaction to negative control, Escherichia coli, non-pathogenic Leptospira.As a result as shown in figure 5, negative control, its
His strain and non-pathogenic Leptospira do not occur band, show specific good.
It determines storage life: two kinds of kits being placed at -20 DEG C and are saved, interval is detected for two weeks, determines its storage life.
After six months, testing result is still good, determines that preservation condition is -20 DEG C, it is six months that storage life is most short.
The detection of kit recall rate: clinical acquisitions blood and urine sample, it is micro- solidifying in the goldstandard method that coupler body detects
Collection test (MAT) method, and the PCR method established are detected, and recall rate is compared.The positive sample that PCR method detects
Consistent with MAT method detection positive sample number, recall rate is good.
One couple of PCR primers is contained only in conventional PCR product system, which has limited the popularity of its detection range, if
In order to increase the popularity of detection, and arbitrarily add different primers in system, then it can be due to the return of goods temperature of different primers
It is inconsistent and cause reaction fail.3 pairs of coupler body PCR primers that the present invention designs, return of goods temperature is consistent, is all 60 DEG C, and purpose
Clip size is also identical, is all 468bp, can accurately detect 15 kinds of coupler body type strains, reproducible.
Sequence table
<120>a kind of kit and primer that can detect pathogenic leptospire extensively
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213>artificial sequence ()
<400> 1
caggcgacgg agacttag 18
<210> 2
<211> 18
<212> DNA
<213>artificial sequence ()
<400> 2
caggcgacgg agacttag 18
<210> 3
<211> 18
<212> DNA
<213>artificial sequence ()
<400> 3
cgggcgacgg agatttag 18
<210> 4
<211> 20
<212> DNA
<213>artificial sequence ()
<400> 4
agactcttca gcagcgatag 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence ()
<400> 5
agattcttcg gcggcgatag 20
<210> 6
<211> 20
<212> DNA
<213>artificial sequence ()
<400> 6
agattcttca gctgctatgg 20
Claims (3)
1. the PCR primer that one kind can detect pathogenic leptospire extensively, it is characterised in that:
The primer is as follows:
Upstream primer:
5'- CAGGCGACGGAGACTTAG-3'；
5'- CAGGCGACGGAGACTTAG-3'；
5'- CGGGCGACGGAGATTTAG-3'；
Downstream primer:
5'- AGACTCTTCAGCAGCGATAG -3'；
5'- AGATTCTTCGGCGGCGATAG-3'；
5'- AGATTCTTCAGCTGCTATGG-3'；
Above-mentioned 3 pairs of PCR primer annealing temperatures are consistent, and purpose band is in the same size, and it is anti-to can be placed on progress PCR in same reaction system
It answers.
2. a kind of kit of the pathogenic leptospire of detection extensively, it is characterised in that:
Including PCR primer described in claim 1, positive control, negative control, Taq enzyme, dNTP, 10 × Buffer, ddH2O,
It is specific as follows:
1) positive control 20uL*1 is managed；
2) negative control 20uL*1 is managed；
3) reaction tube 23ul*8 is managed.
3. a kind of preparation method of the kit of pathogenic leptospire of detection extensively according to claim 2, including
Following steps:
1) 56601 coupler bodies are cultivated in the preparation of positive control, extract 108The DNA of a coupler body is eluted with 50ul TE buffer,
Nucleic acid concentration is detected, and is diluted to 1ng/uL with TE buffer, -20 DEG C of preservations after packing；
2) preparation of negative control carries out high pressure sterilization processing, -20 DEG C after packing by distilled water after 0.22um membrane filtration
It saves；
3) preparation of reaction tube, by 3 pairs of primers, Taq enzyme, dNTP, 10 × Buffer and ddH2O mixed uniform, wherein every is drawn
The final concentration of 0.5uM of object, the volume ratio of Taq enzyme are 1:50, and the volume ratio of dNTP is 4:50, the volume ratio of 10 × Buffer
For 1:10, ddH is added2O constant volume is to 4.6ml, -20 DEG C of preservations after packing；
4) DNA for extracting sample to be tested, 2uL sample DNA is added in reaction tube；
5) it takes positive control 2uL in reaction tube as the positive control of detection, while negative control 2uL being taken to do in reaction tube
For the negative control of detection；
6) PCR instrument, 94 DEG C of initial denaturation 3min are put into；94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, 35 recycle；
72 DEG C of extension 5min；
7) product is carried out to 1% nucleic acid gel electrophoresis, 110v, 20min are observed with gel imager, purpose band size
For 468bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811088581.3A CN109182565A (en) | 2018-09-18 | 2018-09-18 | A kind of kit and primer that can detect pathogenic leptospire extensively |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811088581.3A CN109182565A (en) | 2018-09-18 | 2018-09-18 | A kind of kit and primer that can detect pathogenic leptospire extensively |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109182565A true CN109182565A (en) | 2019-01-11 |
Family
ID=64908160
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811088581.3A Pending CN109182565A (en) | 2018-09-18 | 2018-09-18 | A kind of kit and primer that can detect pathogenic leptospire extensively |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109182565A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012066576A2 (en) * | 2010-11-16 | 2012-05-24 | Godavari Biorefineries Limited | Oligonucleotide primer sequences for detection of leptospira |
| CN106755394A (en) * | 2016-12-16 | 2017-05-31 | 上海市动物疫病预防控制中心 | A kind of fluorescence PCR primer for detecting pathogenic leptospire, probe and kit |
-
2018
- 2018-09-18 CN CN201811088581.3A patent/CN109182565A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012066576A2 (en) * | 2010-11-16 | 2012-05-24 | Godavari Biorefineries Limited | Oligonucleotide primer sequences for detection of leptospira |
| CN106755394A (en) * | 2016-12-16 | 2017-05-31 | 上海市动物疫病预防控制中心 | A kind of fluorescence PCR primer for detecting pathogenic leptospire, probe and kit |
Non-Patent Citations (2)
| Title |
|---|
| ZUZANA CERMAKOVA ET AL.: "Real-time PCR method for detection of the detection of the gene encoding surface lipoprotein LipL32 of pathogenic Leptospira:use in the laboratory diagnosis of the acute form of leptospirosis", 《SCANDINAVIAN JOURNAL OF INFECTIOUS DISEASES》 * |
| 姜理平: "lipL32-PCR应用于钩端螺旋体检测", 《中国媒介生物学及控制杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| CN108048584A (en) | The brucellar probe of RAA Fluorometric assays and kit | |
| CN105018485A (en) | Primer and probe for detecting peste des petits ruminants virus by virtue of RPA (Recombinase Polymerase Amplification) technique | |
| CN104059975B (en) | To Providence O3, the Nucleotide that O4, O8, O12, O13 and O20 are special and application thereof | |
| CN105936935B (en) | PCR detection kit for rapidly identifying specific serotype salmonella | |
| CN114438214A (en) | Colorectal cancer tumor marker and detection method and device thereof | |
| Gou et al. | The colorimetric isothermal multiple-self-matching-initiated amplification using cresol red for rapid and sensitive detection of porcine circovirus 3 | |
| CN109337995B (en) | PCR detection method and kit for eubacterium terrae and subspecies thereof | |
| CN103333903A (en) | Target sequence, primer and probe for detecting helicobacter pylori and kit thereof | |
| Li et al. | Preliminary evaluation of rapid visual identification of Burkholderia pseudomallei using a newly developed lateral flow strip-based recombinase polymerase amplification (LF-RPA) system | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| CN108796106A (en) | Giardia bovis, Cryptosporidium multiple PCR detection kit and its method | |
| CN115747361A (en) | Real-time fluorescent MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method | |
| CN100449005C (en) | Multiple fluorescence PCR detection reagent for detecting pathogenicity of streptococcus suis serotype 2 and method | |
| CN110438248A (en) | Primer sets, product and detection method and application for Real-time PCR detection Fusobacterium nucleatum | |
| CN110218803A (en) | For rodent-borne disease pathogenic microorganism PCR primer to, kit and application thereof | |
| CN105154559A (en) | Specific nucleotide for vibrio parahaemolyticus K36, K37 and K68 and application thereof | |
| CN109182565A (en) | A kind of kit and primer that can detect pathogenic leptospire extensively | |
| CN108315451A (en) | Primer and probe for detecting C.perfringens and its application | |
| Wang et al. | Establishment and clinical application of a RPA-LFS assay for detection of capsulated and non-capsulated haemophilus influenzae | |
| CN105256041B (en) | The nucleotide special to aeromonas hydrophila O44, O24, O25 and O28 and application | |
| CN105200044B (en) | The nucleotides special to vibrio fluvialis O1, O6, O7, O8 and O9 and its application | |
| CN105200045B (en) | The nucleotides special to vibrio fluvialis O11, O14, O16 and O17 and its application | |
| CN103074427B (en) | Target gene and kit for detecting Bartonella vinsonii subsp. berkhoffii | |
| CN105002302A (en) | Primer and probe for detecting rift valley fever virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190111 |