CN109182548B - Primer and method for detecting GR gene expression characteristics of agasicles hygrophila - Google Patents

Abstract

The invention provides a primer and a method for detecting GR gene expression characteristics of agasicles hygrophila, wherein the sequence of the primer is shown as SEQ ID NO.1-2, and the invention establishes that agasicles hygrophila male and female worms eat different CO₂The fluorescence quantitative PCR method for detecting GR gene expression after the alligator alternanthera is cultivated at concentration and carries out sequencing of transcriptome, compares the expression trend of GR gene fluorescence quantification with the expression trend of the transcriptome, and lays a foundation for researching a defense mechanism and GR gene expression characteristics generated when the agapanthus praecox is stressed by the environment.

Description

Primer and method for detecting GR gene expression characteristics of agasicles hygrophila

Technical Field

The invention relates to a primer and a method for detecting GR gene expression characteristics of agasicles hygrophila, belonging to the technical field of biology.

Background

Lotus herb, Thymus ananastus, belongs to Coleoptera, Leptospermum, is one of the main natural enemies of alternanthera philoxeroides in biocontrol. George Vogt found that the lotus seed thoracocentesis diver's beetle has a good control effect on alternanthera philoxeroides for the first time in 1962. Then, the lotus seed flea beetle is widely applied to the control of the alternanthera philoxeroides in the United states, Australia and the like, and achieves better control effect. Lily grass fleabane was introduced from the United states in 1986 in China, and the application of the Limonium sinense oliver to biological control of the alternanthera philoxeroides has succeeded to a certain extent in Sichuan, Zhejiang, Fujian, Guangxi and the like.

The olfactory and gustatory systems play a vital role in the survival and reproduction processes of insects, the insects recognize various different chemical substances through sensitive chemoreceptors to finish the processes of foraging, feeding, mating, selecting a spawning site and the like, and the olfactory and gustatory systems recognize some nonvolatile substances in the environment to distinguish nutrient substances and avoid toxic substances. Taste sensory nerves are widely distributed on the surface of insects, and different nerve cells can cause different behavioral responses after being stimulated. For example, stimulation of the gustatory nerves of the insect foreleg causes the insect to open the labial flap to produce feeding behavior, while stimulation of the gustatory nerves on the ovipositor causes mating and oviposition behavior of the insect.

Clyne et al (2000) screened 19 genes with 7 transmembrane domains in a part of the Drosophila genome, and found that 18 of them were specifically expressed on the labial flaps by PCR detection, and the 18 labial flap-specifically expressed genes were defined as taste genes. Subsequently, the remaining taste receptor genes of Drosophila were identified, and 60 taste receptor genes were shared by Drosophila, which encoded 68 taste receptor proteins, by selectively splicing gene expression patterns. The GR genes from other insect species were subsequently identified.

The homology between taste receptors is very low, typically 8% to 12%. A large number of taste receptor genes have been identified using bioinformatics, but most taste receptor functions are unclear, probably because the GR's own expression is low and cannot be easily targeted by conventional methods. In recent years, transgenic lines of Drosophila have been used to study GR function, focusing mainly on bitter taste receptors, sweet taste receptors, and CO in Drosophila₂Receptors and the amphipathic pheromone receptor. Where the protein encoded by Drosophila GR5a recognizes and senses trehalose, but it is not the only receptor that senses trehalose, GR64f may also affect the response of Drosophila to trehalose, suggesting that different taste receptors of insects may bind the same chemical. Insect taste receptors in addition to taste receptor expression, some taste receptors are also expressed in olfactory organs, and deletion of Gr63a in the drosophila antennal nerve results in the loss of CO recognition by drosophila₂Ability to silence or knock-out the Gr21a gene also enables Drosophila to fight CO₂The sensing ability of the gene(s) is reduced, and the presence of only one of the Gr63a and Gr21a alone cannot make the fruit fly produce CO₂However, Drosophila has sensitivity to CO only when Gr63a and Gr21a are CO-expressed₂The perception of, thisIndicating that Gr63a and Gr21a are synergistically involved in CO pairing₂The perception of (2). Recent studies have shown that the taste of insects may have a close relationship with egg laying behavior, and Ryan (2012) study of fruit flies found that Gr66a, the antepodium of fruit flies, may be involved in egg laying behavior.

Taste receptors are relatively poorly studied for their function compared to olfactory receptors. The key point of future research is to perform large-scale functional analysis on taste receptors in different insects and to perform interaction between upstream and downstream proteins of the taste receptors, so as to further analyze the complex network of the taste sensory nervous system, explore the generation, transmission and termination mechanisms of taste signals, and finally clarify the molecular mechanisms for regulating the behaviors of feeding, mating and the like of the insects. The expression level of the taste receptor is extremely low, chemosensory nerves expressed by the receptor genes can be intuitively positioned by methods such as in situ hybridization, transgenic fluorescent protein gene expression and the like, and a transgenic technology and a heterologous expression system are effective means for researching the function of the taste receptor in the future. The study about the expression of agasicles hygrophila GR gene is not reported at home and abroad, so that the real-time fluorescent quantitative PCR is adopted to study different COs₂The expression characteristic of the agasicles hygrophila GR gene under concentration treatment shows that the expression characteristic is along with CO₂The concentration is increased, the expression level of the male and female GR genes is increased, which is consistent with the change trend of the up-regulation of the expression level of the transcriptome, and the results show that the CO is₂Elevated concentrations can affect the regulation of expression of the GR gene. The function of the chemoreceptors is clarified from the molecular level, so that the regulation mechanism of insect chemosensory and the relation between the chemosensory and insect feeding complex behaviors can be further deeply disclosed. Therefore, a new pest control strategy is designed aiming at the specific taste receptor gene by utilizing a genetic engineering means. The traditional pesticide is easy to generate drug resistance, has unstable effect and can cause environmental pollution. Therefore, the molecular biological method for controlling the insect behaviors and controlling the pests has important practical significance.

Disclosure of Invention

The invention aims to provide a primer and a method for detecting the expression characteristics of the agasicles hygrophila GR gene, which are designed for comprehensively knowing the expression characteristics of the agasicles hygrophila GR geneDifferent treatment of CO₂And (4) concentration.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

will eat different CO₂The nelumbo nucifera gaertn gynandra of the nelumbo lutea cultured in concentration is respectively collected into 9 Eppendorf tubes and divided into 3 biological replicates, and 12 groups of samples are total.

Designing a pair of primers for detecting the GR gene expression characteristics of the agasicles hygrophila, which is characterized by comprising an upstream primer and a downstream primer which accord with the characteristics of fluorescent quantitative PCR reaction:

GR-F：5`-AGAGTGAAGGAAGACCGTAAGATTA-3`

GR-R：5`-ACTGCTATGATGGACCTGATGA-3`

and upstream and downstream primers as reference genes:

Tubulin-F: 5`-AGATGTCCGCCACCTTCA-3`

Tubulin-R: 5`-GCCTCTTGGTATTGTTGGTATTCA-3`

the invention relates to a fluorescence quantitative PCR method for detecting the GR gene expression characteristic of agasicles hygrophila, which is characterized by comprising the following steps:

(1) first strand cDNA Synthesis: extracting and purifying total RNA of a sample, and obtaining cDNA obtained by reverse transcription by using the extracted RNA as a template by adopting a reverse transcription kit;

(2) the following primers were subjected to conventional PCR detection

Fluorescent quantitative upstream and downstream primers of the gene:

GR-F：5`-AGAGTGAAGGAAGACCGTAAGATTA-3`

GR-R：5`-ACTGCTATGATGGACCTGATGA-3`

and upstream and downstream primers as reference genes:

Tubulin-F: 5`-AGATGTCCGCCACCTTCA-3`

Tubulin-R: 5`-GCCTCTTGGTATTGTTGGTATTCA-3`

the conventional PCR amplification system is 25 muL: 10 × buffer 2.5 muL, dNTP 1.0 muL, an upstream primer 0.5 muL, a downstream primer 0.5 muL, a 100 ng/muL cDNA template 1.0 muL, Ex-TaqE 0.15 muL and water 19.35 muL;

the conventional PCR reaction procedure is as follows: pre-denaturation at 94 deg.C for 5 min, denaturation at 94 deg.C for 30 s, annealing at 56 deg.C for 30 s, and extension at 72 deg.C for 1 min, under the condition for 35 cycles, and final extension at 72 deg.C for 10 min;

(3) real-time fluorescent quantitative PCR reaction:

and (3) taking the cDNA obtained in the step (1) as a template, adding the primer in the step (2) to perform fluorescent quantitative PCR reaction, setting 3 times of repetition for each sample, and taking an average value after amplification.

The real-time fluorescent quantitative PCR amplification system is as follows: SYBR^® Premix Ex Taq^TM12.5 muL, 0.5 muL of an upstream primer, 0.5 muL of a downstream primer, 1.0 muL of 100 ng/muL cDNA, and supplementing water to 25 muL;

the real-time fluorescent quantitative PCR reaction program is as follows: pre-denaturation at 95 ℃ for 30 s, followed by denaturation at 95 ℃ for 5 s and annealing at 60 ℃ for 30 s for 40 cycles.

The more detailed test method of the present invention is as follows:

the real-time fluorescence quantitative PCR detection method of agasicles hygrophila GR gene can be realized by the following steps:

(1) designing a primer: according to the sequence of the agasicles hygrophila GR gene obtained by the transcriptome sequencing result, DNAMAN software is used for designing a specific primer suitable for fluorescent quantitative PCR detection, and the primer sequence is as follows:

GR-F：5`-AGAGTGAAGGAAGACCGTAAGATTA-3`

GR-R：5`-ACTGCTATGATGGACCTGATGA-3`

meanwhile, according to the sequence of the lotus grass flea-beetle tubulin gene obtained by the sequencing result of the transcriptome, a primer for a fluorescent quantitative PCR internal control is designed, and the sequence of the primer is as follows:

Tubulin-F: 5`-AGATGTCCGCCACCTTCA-3`

Tubulin-R: 5`-GCCTCTTGGTATTGTTGGTATTCA-3`

(2) lotus grass thoracocentesis scurf treatment test: in control CO₂Concentration (420. mu.L. L)^－1) And high CO₂Concentration (750. mu.L.L)^－1) The artificial climate box is used for cultivating alternanthera philoxeroides which is used for cultivating alternanthera philoxeroides male and female flea beetles with different CO₂The female and male worms with the concentration are respectively collected into 9 Eppendorf tubes and divided into 3 biological repeatsTotal 12 samples. After being treated, the insect sample is quickly put into liquid nitrogen for fixation and is stored at minus 80 ℃ for standby.

(3) First strand cDNA Synthesis: with reference to the whole body of goldTransZol ^TMTotal RNA was extracted using Up Plus RNA Kit instructions, and the first strand cDNA was synthesized according to One-Step gDNA Removal and cDNA Synthesis SuperMix Kit instructions from TransScript.

(4) Real-time fluorescent quantitative PCR reaction: the real-time fluorescent quantitative PCR adopts SYBR of TGRara company^® Premix Ex Taq^TMAnd (4) carrying out kit. And (3) performing a fluorescent quantitative PCR program by using the first strand of the synthesized cDNA as a template and the GR-F, GR-R and Tubulin-F, Tubulin-R as specific primers, setting 3 parallel repeats for each sample, and taking the average of parallel Ct values obtained after amplification.

The real-time fluorescent quantitative PCR amplification system is as follows: SYBR^® Premix Ex Taq^TM12.5 muL, 0.5 muL of an upstream primer, 0.5 muL of a downstream primer, 1.0 muL of 100 ng/muL cDNA, and supplementing water to 25 muL;

the real-time fluorescent quantitative PCR reaction program is as follows: pre-denaturation at 95 ℃ for 30 s, followed by denaturation at 95 ℃ for 5 s and annealing at 60 ℃ for 30 s for 40 cycles.

(5) The expression of the agasicles hygrophila GR gene relative to the tubulin gene is calculated by the following formula: relative mRNA expression = 2^-ΔΔCtX 100%, where Ct value = target gene Ct value-tubulin Ct value.

(6) FIG. 3 and FIG. 4 show that the male and female insects of agasicles hygrophila feed different CO₂Differential expression of GR gene after the alternanthera philoxeroides is cultivated in concentration. The results show that with CO₂The concentration is increased, the expression quantity of the male and female GR genes is increased and is consistent with the expression quantity change trend of a transcriptome, and important basic data are provided for deeply developing the research of the agasicles hygrophila GR genes.

Compared with the prior art, the invention has the following advantages and effects:

(1) different CO in the present invention₂Concentration treatment measures are applicable to most of the taste receptor genes of insects, and are suitable for thorough research on gene expression characteristicsHas important significance.

(2) The efficient and fast fluorescence quantitative PCR method comprises a fluorescence quantitative PCR program and the like, is actually used for 50 min, greatly shortens the reaction time compared with the prior art, and has the characteristics of high efficiency and fast speed.

(3) The fluorescence quantitative PCR method provided by the invention provides a conventional PCR electrophoresis result picture, and can intuitively and quickly reflect the specificity of the primer.

Drawings

The attached figure is a fluorescence quantitative PCR detection result of the transcription level of the female male sex now GR gene of the agasicles hygrophila.

FIG. 1: electrophoresis results of conventional PCR products of the fluorescence quantitative primers of agasicles hygrophila GR gene: the length of the product is 105 bp, and the Marker bands are sequentially from top to bottom: 2000. 1000, 750, 500, 250 and 100 bp.

FIG. 2: electrophoresis results of conventional PCR products of fluorescence quantitative primers of agasicles hygrophila tubulin gene: the length of the product is 199 bp, and the Marker bands are sequentially from top to bottom: 2000. 1000, 750, 500, 250 and 100 bp.

FIG. 3: feeding by female Dactylicapnos lunulatus (F) with different CO₂Differential expression of GR gene after the alternanthera philoxeroides is cultivated in concentration, the column and left coordinate axes are expression amounts of fluorescence quantification, and scatter dots and right coordinate axes are expression amounts of transcriptome.

FIG. 4: feeding Nelumbo Nucifera Gaertn with different CO₂Differential expression of GR gene after the alternanthera philoxeroides is cultivated in concentration, the column and left coordinate axes are expression amounts of fluorescence quantification, and scatter dots and right coordinate axes are expression amounts of transcriptome.

Detailed description of the preferred embodiments

The present invention is described below with reference to the following embodiments and the accompanying drawings, wherein the embodiments are not limited to the invention, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be regarded as equivalent replacements within the scope of the present invention.

Example 1

Treatment of test materials

In control CO₂Concentration (420. mu.L. L)^－1) And high CO₂Concentration (750. mu.L.L)^－1) The artificial climate box is used for cultivating alternanthera philoxeroides which is used for cultivating alternanthera philoxeroides male and female flea beetles with different CO₂The female and male worms with the concentration are respectively taken into 9 Eppendorf tubes and divided into 3 biological replicates, and 12 groups of samples are obtained. The insect sample is collected and then quickly placed into liquid nitrogen for fixation, and is stored at the temperature of minus 80 ℃ for standby.

Example 2

Design of primers

(1) Designing a primer: according to the sequence of the agasicles hygrophila GR gene obtained by transcriptome sequencing, DNAMAN software is used for designing a specific primer suitable for fluorescent quantitative PCR detection, and the primer sequence is as follows:

GR-F：5`-AGAGTGAAGGAAGACCGTAAGATTA-3`

GR-R：5`-ACTGCTATGATGGACCTGATGA-3`

the length of the fluorescence quantitative PCR product of the agasicles hygrophila GR gene is 105 bp, and the agarose gel electrophoresis result shows that the amplified products are consistent in length and are single strips, which indicates that the designed primer has strong specificity and is suitable for real-time fluorescence quantitative PCR detection, and the agarose gel electrophoresis result is shown in figure 1.

(2) Meanwhile, according to the sequence of the lotus grass fleabane tubulin gene obtained by sequencing the transcriptome, a primer for a fluorescent quantitative PCR internal control is designed, and the sequence of the primer is as follows:

Tubulin-F: 5`-AGATGTCCGCCACCTTCA-3`

Tubulin-R: 5`-GCCTCTTGGTATTGTTGGTATTCA-3`

the length of the fluorescence quantitative PCR product of the agasicles hygrophila tubulin gene is 199 bp, and the agarose gel electrophoresis result shows that the amplified products have the same length and are single bands, which indicates that the designed primer has strong specificity and is suitable for real-time fluorescence quantitative PCR detection, and the agarose gel electrophoresis result is shown in figure 2.

Example 3

Extraction of Total RNA

With reference to the whole body of goldTransZol ^TMUp Plus RNA Kit instructions for total RNA extraction, liquid nitrogen grinding the worm body into powder, adding 1mlTransZol ^TMUp, transferred to a 1.5 ml centrifuge tube, left to stand at room temperature for 5 min, and added with 200. mu.L chloroform/1 mlTransZol ^TMUp, vigorously shaken for 30 s and incubated at room temperature for 3 min. Centrifuging at 4 deg.C for 15 min at 10000 g, and transferring the upper aqueous phase (generally<80%) into a new centrifuge tube, 1/3 volumes of absolute ethanol were added and mixed by gentle inversion. Sheathing the RNA centrifugal column in a 2 ml collecting pipe, transferring the mixture in the previous step into the centrifugal column, centrifuging at 12000 g for 30-60 s, discarding the mobile phase, and reusing the collecting pipe. Add 500 μ LCB9, centrifuge at 12000 g at room temperature for 30 s, discard mobile phase, add 500 μ LCB9, centrifuge at 12000 g at room temperature for 30 s, discard mobile phase. Diluted 500. mu. LWB9 was added, 12000 g was centrifuged for 30 s, the mobile phase was discarded, and diluted 500. mu. LWB9, 12000 g was added, centrifuged for 30 s, and the mobile phase was discarded. Centrifuging at 12000 g for 2 min to completely remove residual ethanol, standing at room temperature for several minutes, and completely air drying the centrifugal column. The column was placed in RNase-free Tube, 50. mu.L Nase-free Water was added to the center of the column, and the column was left standing at room temperature for 1 min, centrifuged at 12000 g for 1 min, and RNA was eluted. The RNA obtained was stored at-80 ℃ until use.

Example 4

First strand cDNA Synthesis: the first strand of cDNA was generated by reverse transcription using RNA as template according to the procedure of One-Step gDNA Removal and cDNA Synthesis SuperMix kit (TransScript Co., Ltd.) as follows:

(1) reverse transcription system

(2) Incubate at 42 ℃ for 30 min.

(3) Heating at 85 deg.C for 5 min, and storing at-20 deg.C and-80 deg.C.

Example 5

And carrying out fluorescent quantitative PCR reaction. The real-time fluorescent quantitative PCR adopts SYBR of TGRara company^® Premix Ex Taq^TMAnd (4) carrying out kit. As cDN in example 4A is a template, the primers in the example 2 are used for carrying out real-time fluorescent quantitative PCR amplification reaction, 3 parallel repeats are set for each sample, and the average of parallel Ct values obtained after amplification is taken.

(1) The real-time fluorescent quantitative PCR amplification system comprises the following components:

SYBR^® Premix Ex Taq^TM 12.5 muL, 0.5 muL of an upstream primer, 0.5 muL of a downstream primer, 1.0 muL of 100 ng/muL cDNA, and supplementing water to 25 muL;

(2) the real-time fluorescent quantitative PCR reaction program is as follows: pre-denaturation at 95 ℃ for 30 s, followed by denaturation at 95 ℃ for 5 s and annealing at 60 ℃ for 30 s for 40 cycles.

(3) After the real-time fluorescent quantitative PCR is finished, calculating the ratio 2 of relative expression amounts under different treatment conditions according to the Ct value^-ΔΔCt. The expression of the agasicles hygrophila GR gene relative to the tubulin gene is calculated by the following formula: relative mRNA expression = 2^-ΔΔCtX 100%, where Ct value = target gene Ct value-tubulin Ct value.

Table 1: feeding by female Dactylicapnos lunulatus (F) with different CO₂C (T) value, average value, standard deviation, fluorescent quantitative expression level and transcriptome expression level of GR gene after cultivation of alligator alternanthera at concentration

Table 2: feeding Nelumbo Nucifera Gaertn with different CO₂C (T) value, average value, standard deviation, fluorescent quantitative expression level and transcriptome expression level of GR gene after cultivation of alligator alternanthera at concentration

(4) FIG. 3 and FIG. 4 show that the male and female insects of agasicles hygrophila feed different CO₂Differential expression of GR gene after the alternanthera philoxeroides is cultivated in concentration. The results show that with CO₂The increase of the concentration, the increase of the expression level of the male and female GR genes, and the change of the up-regulation of the expression level of the transcriptomeThe trend of the formation is consistent. The method provides important basic data for deeply developing the study of the GR gene of the agasicles hygrophila.

SEQUENCE LISTING

<110> institute of agricultural quality standards and detection technology of agricultural academy of sciences of Fujian province

<120> primers and method for detecting GR gene expression characteristics of agasicles hygrophila

<130> 4

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 25

<212> DNA

<213> Artificial sequence

<400> 1

AGAGTGAAGGAAGACCGTAAGATTA 25

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence

<400> 2

ACTGCTATGATGGACCTGATGA 22

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence

<400> 3

AGATGTCCGCCACCTTCA 18

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<400> 4

GCCTCTTGGTATTGTTGGTATTCA 24

Claims (2)

1. A fluorescence quantitative PCR primer for detecting the GR gene expression characteristic of the agasicles hygrophila is characterized in that: comprises upstream and downstream primers which accord with the characteristics of fluorescent quantitative PCR reaction:

GR-F：5`-AGAGTGAAGGAAGACCGTAAGATTA-3`，

GR-R：5`-ACTGCTATGATGGACCTGATGA-3`。

2. a fluorescence quantitative PCR method for detecting the GR gene expression characteristic of the agasicles hygrophila by adopting the primer of claim 1, which is characterized in that: comprises the following steps:

(1) first strand cDNA Synthesis: extracting and purifying total RNA of a sample, and obtaining cDNA obtained by reverse transcription by using the extracted RNA as a template by adopting a reverse transcription kit;

(2) the following primers were used for routine PCR detection

Fluorescent quantitative upstream and downstream primers of the gene:

GR-F：5`-AGAGTGAAGGAAGACCGTAAGATTA-3`

GR-R：5`-ACTGCTATGATGGACCTGATGA-3`

and upstream and downstream primers as reference genes:

Tubulin-F: 5`-AGATGTCCGCCACCTTCA-3`

Tubulin-R: 5`-GCCTCTTGGTATTGTTGGTATTCA-3`

the conventional PCR amplification system is 25 muL: 10 × buffer 2.5 muL, dNTP 1.0 muL, an upstream primer 0.5 muL, a downstream primer 0.5 muL, a 100 ng/muL cDNA template 1.0 muL, Ex-TaqE 0.15 muL and water 19.35 muL;

the conventional PCR reaction procedure was: pre-denaturation at 94 deg.C for 5 min, denaturation at 94 deg.C for 30 s, annealing at 56 deg.C for 30 s, and extension at 72 deg.C for 1 min, under the condition for 35 cycles, and final extension at 72 deg.C for 10 min;

(3) real-time fluorescent quantitative PCR reaction:

adding the primers obtained in the step (2) into the cDNA obtained in the step (1) as a template to perform fluorescent quantitative PCR reaction, setting 3 times of repetition for each sample, and averaging after amplification;

the real-time fluorescent quantitative PCR amplification system is as follows: SYBR^® Premix Ex Taq^TM 12.5 muL, 0.5 muL of an upstream primer, 0.5 muL of a downstream primer, 1.0 muL of 100 ng/muL cDNA, and supplementing water to 25 muL;

the real-time fluorescent quantitative PCR reaction program is as follows: pre-denaturation at 95 ℃ for 30 s, followed by denaturation at 95 ℃ for 5 s and annealing at 60 ℃ for 30 s for 40 cycles.

Images