CN109182346A - Safflower CYP75A1 gene and its application - Google Patents

Safflower CYP75A1 gene and its application Download PDF

Info

Publication number
CN109182346A
CN109182346A CN201811043346.4A CN201811043346A CN109182346A CN 109182346 A CN109182346 A CN 109182346A CN 201811043346 A CN201811043346 A CN 201811043346A CN 109182346 A CN109182346 A CN 109182346A
Authority
CN
China
Prior art keywords
gene
safflower
leu
cyp75a1
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201811043346.4A
Other languages
Chinese (zh)
Other versions
CN109182346B (en
Inventor
刘秀明
李海燕
姚娜
董园园
王南
李晓薇
王法微
刘欣
高延妍
刘伟灿
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jilin Agricultural University
Original Assignee
Jilin Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jilin Agricultural University filed Critical Jilin Agricultural University
Priority to CN201811043346.4A priority Critical patent/CN109182346B/en
Publication of CN109182346A publication Critical patent/CN109182346A/en
Application granted granted Critical
Publication of CN109182346B publication Critical patent/CN109182346B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/795—Porphyrin- or corrin-ring-containing peptides
    • C07K14/80—Cytochromes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Nutrition Science (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

It is the amplification for carrying out coding region sequence using the cDNA of the RNA reverse transcription of safflower petal as template the invention discloses safflower CYP75A1 gene, obtains the gene that sequence is 1287bp, be named as CtCYP75A1；Utilize the gene constructed carrier transformation of tobacco blade of safflower CYP75A1, our experiments show that, CtCYP75A1 gene can reduce flavones content after the synthesis of flavones, CtCYP75A1 gene can be promoted to be suppressed, and have broad prospects in terms of cultivating high-content chromocor compound genetically modified plants.

Description

Safflower CYP75A1 gene and its application
Technical field
The invention belongs to bioengineering fields, and in particular to safflower CYP75A1 gene and its improve plant flavone content in Application.
Background technique
Safflower (Carthamus tinctorius L. it is) annual herb plant, belongs to the dry tubular flower of compositae plant. Safflower has blood circulation, and stasis eliminatings are cured the wound, and declares malicious promoting eruption and other effects, and principle active component is that carthamin yellow and safflower are red Element.Carthamin yellow is the mixture of a variety of water-soluble chalcone ingredients in safflower, not still of great value edible pigment, and And there is promoting blood circulation and removing obstruction in channels, anti-inflammatory analgesic and other effects, also have in fermentation such as vascular conditions, hypertension, diabetic complications important Effect.Cytochrome P450 (cytochromeP450 or CYP450, abbreviation CYP450) is a kind of heme.It is ferrous blood red Element is the superfamily of thiolate proteins, it participates in endogenous material and the exogenous material including drug, environmental compound Metabolism, studies have shown that CYP450 can participate in the different physiological roles of cell, catalyzing endogenous property substance for example lipid, flavonoids, The biosynthetic metabolism of terpene, alkaloids etc., in addition, CYP especially plays vital work in the biosynthesis of flavones With the synthesis of the substances such as major regulatory anthocyanidin determines the type of the synthesis of anthocyanins and the color of flower.The result of study of forefathers , it was also found that CYP subfamily member can be catalyzed the continuous oxidation reaction of the end w in plant petals, to influence its secondary generation Thank the synthesis and signal transduction of product.CYP protein family rises emphatically in terms of regulating growth of plants and Secondary Metabolic Regulation of Callus It acts on, focuses mostly on the plants such as corn, wheat, rice, soybean about research in this respect, and on medicinal plant safflower Research have not been reported.
Summary of the invention
Object of the present invention is to be raising plant flavone content, and provide safflower CYP75A1 gene.
Safflower CYP75A1 gene, nucleotide sequence is as shown in sequence table SEQ NO.1；
The safflower CYP75A1 gene, it is that safflower petal total serum IgE reverse transcription is cDNA, using cDNA as template, with primer:
CYP75A1R:ATGCTCATTCACTTTGGTAGTTT
CYP75A1F:TCACCGAGCACTTAACTTGAC
Carry out PCR amplification acquisition.
A kind of expression vector, it is to insert nucleotides sequence shown in sequence table SEQ NO.1 in the plant expression vector Column；
The expression vector is pBASTA.
The safflower CYP75A1 gene is in the application for cultivating high-content chromocor compound genetically modified plants；
The plant is tobacco.
It the present invention provides safflower CYP75A1 gene, is carried out by template of the cDNA of the RNA reverse transcription of safflower petal The amplification of coding region sequence obtains the gene that sequence is 1287bp, is named as CtCYP75A1；Utilize safflower CYP75A1 gene structure Carrier transformation of tobacco blade is built, our experiments show that, CtCYP75A1 gene can promote the synthesis of flavones, 1 gene of CtCYP75A It can reduce flavones content after being suppressed, have broad prospects in terms of cultivating high-content chromocor compound genetically modified plants.
Detailed description of the invention
Fig. 1 safflower petal RNA extracts electrophoresis result figure；
1 coding sequence of Fig. 2 CtCYP75A verifies electrophoretogram；A:RT-PCR result；B: bacterium solution PCR；C: restriction enzyme mapping；
The structure figures of Fig. 3 safflower CtCYP75A1 gene plant expression vector；
Fig. 4 safflower CtCYP75A1 gene bacterium solution PCR identification；
Fig. 5 safflower CtCYP75A1 gene digestion qualification figure；
Fig. 6 overexpresses the flavones content comparison of the transgenic plant of CtCYP75A1 gene；
The flavones content comparison of the transgenic plant of Fig. 7 RNAi interference expression CtCYP75A1 gene.
Specific embodiment
1 safflower petal RNA of embodiment is extracted
Safflower (Carthamus tinctorius L.) petal RNA is extracted, and extraction step is as follows:
1) tweezers, mortar, pestle and spoon are wrapped with masking foil, are placed on hot air sterilization 4h in 180 DEG C of baking ovens, spare；
2) 1.5mL centrifuge tube, suction pipette head are stayed overnight with 0.1%DEPC water process, and then 120 DEG C of high pressure sterilization 20min, put Drying is set into 60 DEG C of baking ovens, it is spare；
3) safflower petal about 100mg is taken, liquid nitrogen is added and is ground to fine powder rapidly, is dispensed into two 1.5mLEP pipes, it is each to be added It is uniformly mixed after 1mL RNAiso Plus, is stored at room temperature 5min；
4) 4 DEG C, 12000rpm is centrifuged 5min, and supernatant is taken to be transferred in new 1.5mL centrifuge tube；
5) chloroform of 1/5 RNAiso Plus volume is added, vibrates, mixes, is stored at room temperature 5min；
6) 4 DEG C, 12000rpm is centrifuged 15min, and supernatant is taken to be transferred in new 1.5mL centrifuge tube；
7) addition and the isometric isopropanol of supernatant are stored at room temperature 10min, and 4 DEG C, 12000rpm is centrifuged 10min；
8) it abandons supernatant and takes precipitating, 75% ethyl alcohol of 1mL cleaning precipitating is added into precipitating, 4 DEG C, 12000rpm is centrifuged 5min, this step Suddenly it is repeated once；
9) it abandons supernatant and retains precipitating, room temperature is dried；
10) RNA-Free water back dissolving RNA, the RNA of extraction be stored in -80 DEG C it is spare.
11) safflower total serum IgE sample concentration is surveyed with NanoDrop2000 ultramicrospectrophotometer (being purchased from Thermo company) It is fixed；
12) detect RNA purity with 2% agarose gel electrophoresis, nucleic acid staining dye used after electrophoresis, ultraviolet gel at As taking pictures in system, safflower petal Total RNAs extraction is shown in Fig. 1, by Fig. 1 it can be seen that 28S and 18S clearly two band, and 28S item The brightness of band is about 2 times of 18S.It is complete to illustrate that RNA is extracted, no degradation can satisfy follow-up test needs.
The synthesis of 2 first chain cDNA of embodiment
The RNA for taking -80 DEG C of preservations detects the concentration of RNA by nanogrop, and the RNA concentration of extraction is on the left side 1000ng/ul It is right；The reverse transcription of cDNA is carried out according to the operating instruction of reverse transcription reagent box, reverse transcription reaction system is shown in Tables 1 and 2, reverse transcription CDNA afterwards is stored in spare in -20 DEG C of refrigerators.
Above-mentioned reaction system is reacted in PCR instrument: 65 DEG C, 5min, rapidly as chilling on ice.
Reverse transcription reaction condition, 42 DEG C, 55min；70 DEG C, 10min；It is placed in cooled on ice, cDNA is obtained and is used for subsequent reactions, It is frozen at -20 DEG C spare to stay.
The clone of 3 safflower CYP75A of embodiment, 1 coding sequence
According to the coding region sequence obtained in safflower gene order-checking result, specific primer is designed:
CYP75A1R:ATGCTCATTCACTTTGGTAGTTT
CYP75A1F:TCACCGAGCACTTAACTTGAC；
Carry out the clone of coding region sequence；The amplification of coding region sequence is carried out using safflower petal cDNA as template, obtains purpose base Because of segment (Fig. 2A), PCR overall reaction system is 50 μ L, in which:
cDNA 1μL
dNTP Mixture 8μL
10×LA Buffer 5μL
LA Taq 0.5μL
ERF1f (10µM) 1μL
ERF1r(10 μM) 1 μ L
H2O 33.5μL；
PCR reaction condition are as follows: 94 DEG C of 10 min, 94 DEG C of 30 s, 62 DEG C of 30 s, 72 DEG C of 90s, 30 circulations；It is returned by glue Receipts are connected to the Beijing Quanshijin Biotechnology Co., Ltd cloning vector pEASY-T1() on, further schemed by bacterium solution PCR( 2B) and (Fig. 2 C) is identified in digestion, and sequencing result is correct, is named as CtCYP75A1.
The sequence measured carries out the derivation at nucleotide sequence editor and amino acid sequence using DNAMAN software, BLAST is carried out on the website NCBI searches for homology sequence, using clustalW1.83 software building phylogenetic tree, Composition, the average molecular of the amino acid sequence of ProtParam software (http://web.expasy.org/) analysis of encoding albumen The physicochemical properties such as quality, isoelectric point；Sequence analysis shows, safflower CYP75A1 gene be 1287bp, base sequence such as sequence table Shown in SEQ NO.1,428 amino acid (sequence table SEQ NO.2) are encoded.
The building of the plant overexpression vector of 4 safflower CYP75A1 gene of embodiment
Overexpression vector building is as follows:
(1) firstly, the bar gene order of chemical synthesis both ends I containing BamH and EcoR I restriction enzyme site, then by the sequence of synthesis Column insertion pCAMBIA1304(is purchased from pcambia company) in carrier, replace hygromycin gene；With BamH I and EcoR I Substep digested plasmid behind Taq enzyme filling-in end, connects flat end with T4 ligase.Obtain the plant table containing bar resistance marker Up to carrier, it is named as pCAMBIA1304-bar.By the carrier and the pEASY-T1 carrier (Beijing for being connected with CtCYP75A1 sequence Quan Shijin Bioisystech Co., Ltd) BamH I and EcoR I double digestion 3h, 100 μ L digestion systems are used, expression vector map is shown in Fig. 3；The bar gene order of synthesis is as shown in sequence table SEQ NO.3；
(2) digestion products are recycled into the large fragment of pBASTA and the small fragment digestion products of pEASY-T1 through gel electrophoresis；
(3) by the CtCYP75A1 small fragment recycled and pBASTA segment T4 DNA Ligase enzyme, reaction system is as follows, 16 DEG C of connections are overnight；
Overall reaction system 15ul, in which:
10×T4 DNALigase 1.5ul
CHI small fragment 6ul
Carrier large fragment 2ul
T4 DNALigase 1.5ul
DdH2O 4ul
(4) connexon is converted to Escherichia coliE. coli In DH5 α competent cell.
(5) transformant is screened with the resistant panel of (50mg/L) containing kanamycin, chooses bacterium solution PCR after monoclonal shakes bacterium and reflects Fixed (Fig. 4) and plasmid enzyme restriction identification (Fig. 5), there is purpose band, illustrates expression vector establishment success, is named as pBASTA-ctCHI。
The building of 5 interference expression vector of embodiment
Interference expression vector building is as follows:
Utilize interference carrier pHellsgate4 and a pair of of restriction endonucleaseBamH I andEcoR I, by the code area of CtCYP75A1 gene Sequence be inserted into interference carrier introne two sides formed palindromic sequence, then by digestion connect method by this section of sequence with 121 expression vector of pBI connection, found after restriction enzyme digestion and electrophoresis detects, the interference sequence of 1 gene of CtCYP75A with expression Carrier is successfully connected.
The preparation and conversion of 6 Agrobacterium competent cell of embodiment
Preparing for competence is as follows:
1) the Agrobacterium EHA105 competent cell saved at -80 DEG C is taken out, the fresh LB liquid medium of 5ml is inoculated into In, 180 ~ 250r/min, 28 DEG C are incubated overnight；
2) it takes 2ml to be incubated overnight liquid to be inoculated into the fresh LB liquid medium of 50ml, 28 DEG C, 250r/min shakes bacterium to OD600= 0.5~1.0；
3) 15min is stood on ice, 4 DEG C, 5000r/min, is centrifuged 5min；
4) supernatant is abandoned, with 1ml 20mMCaCl2Thallus is resuspended in solution, and 4 DEG C, 5000 r/min are centrifuged 5min；
5) supernatant is abandoned, with 1ml 20mMCaCl2Thallus is resuspended in solution again, and packing is into 1.5ml ice pre-cooling EP pipe, every tube body Product is 0.1ml, then refrigerates 5min in liquid nitrogen again, is placed in -80 DEG C of ultra low temperature freezers and saves；
Target gene is transformed into Agrobacterium using freeze-thaw method, process is as follows:
1) 1 μ l pBASTA- is addedctCHIPlasmid DNA refrigerates 5min in the competence of Agrobacterium EHA105 in liquid nitrogen；
2) it places it in 37 DEG C of water-baths rapidly, thermal shock 5min；
3) the fresh LB culture solution of 1ml is added into centrifuge tube in shaking bacterium 2 ~ 4 hours on 28 DEG C of shaking tables；
4) 50 μ l-100 μ l transformed bacteria solutions is taken to be applied to the solid of+50 μ g/ml Str containing 50 μ g/ml kan+100 μ g/ml Rif It on LB plate, is cultivated 2 ~ 3 days in 28 DEG C of insulating boxs, screens transformant；
5) picking monoclonal bacterium is inoculated in Agrobacterium fluid nutrient medium, 28 DEG C of cultures to OD600≈ 0.5 takes 1 μ l bacterium solution to be used for PCR detection, method are same as above；
6) remaining bacterium solution is quick-frozen in liquid nitrogen after being mixed well with glycerol by 4:1 (V:V), then saves backup for -80 DEG C.
7 safflower CtCYP75A of embodiment, 1 genetic transformation and flavones content measurement
By the overexpression built and RNAi carrier transformation of tobacco blade, respectively to 8 plants of transgenosis for carrying out PCR detection after conversion Strain carries out flavones content measurement, the results showed that, the flavones content of the transgene tobacco of CtCYP75A1 gene is overexpressed than non- Transgene tobacco increases (Fig. 6), shows that the synthesis of flavones can be promoted by overexpressing CtCYP75A1 gene.It is interfered in conversion In the tobacco of carrier, flavones content is below the non-transgenic plant (Fig. 7) of control, and 1 gene of CtCYP75A can after being suppressed Reduce flavones content.
Sequence table
<110>Jilin Agriculture University
<120>safflower CYP75A1 gene and its application
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1287
<212> DNA
<213>safflower (Carthamus tinctorius L.)
<400> 1
atgctcattc actttggtag tttgcctacg cttatagcct catccgctga tgcagctcga 60
gagatcatga aaacacatga tttatcattc tctagtcgac caagtttaac catccccaac 120
atagtgttat atggtagtaa agacatatcg ttttctcctt atggggaata ctggagacag 180
ttgaaaagca tcgtggtact tcatcttcta agtaatacgc gagtcaagtc attccgacaa 240
gtaagagaag aagagatggc tcttgtgatg ggcatacttg aagaaagtta tggttcattg 300
gttaatttga gcgagttgat cctttcactt acaaataaca taatttgtag agtagccctc 360
ggaaggacat atcatggatc aaagttcact gagttgttaa gaaagctcat ggatgtgttg 420
ggtgttttta gcgttgggaa ttatatttca tggttgtcgt gggtggatcg actaagtggt 480
gtagagggaa aagcaaaaaa aattgctaca gaatttgacg agtttcttga aggtgttctt 540
gaagaacatg taaataagga aaaaggggtg gatgctaaaa gtgatgaacg caaagactta 600
gttgacatct tattggaagt ccaaagagaa aagacaacag gttttaccct tcaaagagat 660
aaccttaaag ctgtcatcct ggatgtattc ggtggtggaa ttgatactac atccacaact 720
atagattggg caatcagcga actagtaaaa cacccaagag taatgaaaaa gttgcagcaa 780
gaagtgactg aaatagcaca aggaaggtca atgattcctg aagaggattt ggagaagatg 840
gggtatctta aagccgtaat aaaagaaacc ttaaggttac acgttccagt acctcttctt 900
gttcctcgag aatcaacaca agatgttaag cttatgggat acaacattcc agcaggcaca 960
caagtgatta tcaatgcttg ggcaatagga agagatccta cctcatggga agagccaatg 1020
gagtttaggc cagagaggtt tctaaacaac tccattgact acaaagggtt tcattttgag 1080
tggcttccat ttggcgctgg tcgaagaggg tgtccgggta ttcaatttgg cgtaactatt 1140
attgagcttg tcttagcaaa tatcgtatat aagtttgatt tggcattgcc aaacggagcc 1200
agaaatgagg atttggacat gagtgaggca tatggcattg cgctccatag gaagtcctct 1260
ttattggtca agttaagtgc tcggtga 1287
<210> 2
<211> 428
<212> PRT
<213>safflower (Carthamus tinctorius L.)
<400> 2
Met Leu Ile His Phe Gly Ser Leu Pro Thr Leu Ile Ala Ser Ser Ala
1 5 10 15
Asp Ala Ala Arg Glu Ile Met Lys Thr His Asp Leu Ser Phe Ser Ser
20 25 30
Arg Pro Ser Leu Thr Ile Pro Asn Ile Val Leu Tyr Gly Ser Lys Asp
35 40 45
Ile Ser Phe Ser Pro Tyr Gly Glu Tyr Trp Arg Gln Leu Lys Ser Ile
50 55 60
Val Val Leu His Leu Leu Ser Asn Thr Arg Val Lys Ser Phe Arg Gln
65 70 75 80
Val Arg Glu Glu Glu Met Ala Leu Val Met Gly Ile Leu Glu Glu Ser
85 90 95
Tyr Gly Ser Leu Val Asn Leu Ser Glu Leu Ile Leu Ser Leu Thr Asn
100 105 110
Asn Ile Ile Cys Arg Val Ala Leu Gly Arg Thr Tyr His Gly Ser Lys
115 120 125
Phe Thr Glu Leu Leu Arg Lys Leu Met Asp Val Leu Gly Val Phe Ser
130 135 140
Val Gly Asn Tyr Ile Ser Trp Leu Ser Trp Val Asp Arg Leu Ser Gly
145 150 155 160
Val Glu Gly Lys Ala Lys Lys Ile Ala Thr Glu Phe Asp Glu Phe Leu
165 170 175
Glu Gly Val Leu Glu Glu His Val Asn Lys Glu Lys Gly Val Asp Ala
180 185 190
Lys Ser Asp Glu Arg Lys Asp Leu Val Asp Ile Leu Leu Glu Val Gln
195 200 205
Arg Glu Lys Thr Thr Gly Phe Thr Leu Gln Arg Asp Asn Leu Lys Ala
210 215 220
Val Ile Leu Asp Val Phe Gly Gly Gly Ile Asp Thr Thr Ser Thr Thr
225 230 235 240
Ile Asp Trp Ala Ile Ser Glu Leu Val Lys His Pro Arg Val Met Lys
245 250 255
Lys Leu Gln Gln Glu Val Thr Glu Ile Ala Gln Gly Arg Ser Met Ile
260 265 270
Pro Glu Glu Asp Leu Glu Lys Met Gly Tyr Leu Lys Ala Val Ile Lys
275 280 285
Glu Thr Leu Arg Leu His Val Pro Val Pro Leu Leu Val Pro Arg Glu
290 295 300
Ser Thr Gln Asp Val Lys Leu Met Gly Tyr Asn Ile Pro Ala Gly Thr
305 310 315 320
Gln Val Ile Ile Asn Ala Trp Ala Ile Gly Arg Asp Pro Thr Ser Trp
325 330 335
Glu Glu Pro Met Glu Phe Arg Pro Glu Arg Phe Leu Asn Asn Ser Ile
340 345 350
Asp Tyr Lys Gly Phe His Phe Glu Trp Leu Pro Phe Gly Ala Gly Arg
355 360 365
Arg Gly Cys Pro Gly Ile Gln Phe Gly Val Thr Ile Ile Glu Leu Val
370 375 380
Leu Ala Asn Ile Val Tyr Lys Phe Asp Leu Ala Leu Pro Asn Gly Ala
385 390 395 400
Arg Asn Glu Asp Leu Asp Met Ser Glu Ala Tyr Gly Ile Ala Leu His
405 410 415
Arg Lys Ser Ser Leu Leu Val Lys Leu Ser Ala Arg
420 425
<210> 3
<211> 565
<212> DNA
<213>artificial (synthetic)
<400> 3
aggatccatg agcccagaac gacgcccggc cgacatccgc cgtgccaccg aggcggacat 60
gccggcggtc tgcaccatcg tcaaccacta catcgagaca agcacggtca acttccgtac 120
cgagccgcag gaaccgcagg agtggacgga cgacctcgtc cgtctgcggg agcgctatcc 180
ctggctcgtc gccgaggtgg acggcgaggt cgccggcatc gcctacgcgg gcccctggaa 240
ggcacgcaac gcctacgact ggacggccga gtcgaccgtg tacgtctccc cccgccacca 300
gcggacggga ctgggctcca cgctctacac ccacctgctg aagtccctgg aggcacaggg 360
cttcaagagc gtggtcgctg tcatcgggct gcccaacgac ccgagcgtgc gcatgcacga 420
ggcgctcgga tatgcccccc gcggcatgct gcgggcggcc ggcttcaagc acgggaactg 480
gcatgacgtg ggtttctggc agctggactt cagcctgccg gtaccgcccc gtccggtcct 540
gcccgtcacc gagatctgaa gaatt 565

Claims (5)

1. safflower CYP75A1 gene, nucleotide sequence is as shown in sequence table SEQ NO.1.
2. safflower CYP75A1 gene according to claim 1, it is characterised in that: it is safflower petal total serum IgE reverse transcription For cDNA, using cDNA as template, with primer:
CYP75A1R:ATGCTCATTCACTTTGGTAGTTT
CYP75A1F:TCACCGAGCACTTAACTTGAC
Carry out PCR amplification acquisition.
3. a kind of expression vector, it is to insert the nucleotides sequence as shown in sequence table SEQ NO.1 in the plant expression vector Column.
4. a kind of expression vector according to claim 3, it is characterised in that: the expression vector is pBASTA.
5. safflower CYP75A1 gene described in claim 1 is in the application for cultivating high-content chromocor compound genetically modified plants.
CN201811043346.4A 2018-09-07 2018-09-07 Safflower CYP75A1 gene and application thereof Expired - Fee Related CN109182346B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811043346.4A CN109182346B (en) 2018-09-07 2018-09-07 Safflower CYP75A1 gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811043346.4A CN109182346B (en) 2018-09-07 2018-09-07 Safflower CYP75A1 gene and application thereof

Publications (2)

Publication Number Publication Date
CN109182346A true CN109182346A (en) 2019-01-11
CN109182346B CN109182346B (en) 2022-02-15

Family

ID=64915490

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811043346.4A Expired - Fee Related CN109182346B (en) 2018-09-07 2018-09-07 Safflower CYP75A1 gene and application thereof

Country Status (1)

Country Link
CN (1) CN109182346B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114350674A (en) * 2022-01-07 2022-04-15 吉林农业大学 Application of safflower CtFT1 gene in improving flavone content in plant

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6376753B1 (en) * 1997-07-31 2002-04-23 Centre National De La Recherche Scientifique Purified cytochrome p450 polypeptide cyp76b1 from helianthus tuberosus and its applications as biocatalyst in particular for the degradation of environmental pollutants and for altering the resistance of plants sensitive to phenylurea family of herbicides
CN103820478A (en) * 2014-02-08 2014-05-28 吉林农业大学 Safflower chalcone isomerase (CHI) gene and application thereof
CN104845978A (en) * 2015-05-19 2015-08-19 吉林农业大学 Safflower MYB (v-myb myeloblastosis viral oncogene homolog (avian)) gene and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6376753B1 (en) * 1997-07-31 2002-04-23 Centre National De La Recherche Scientifique Purified cytochrome p450 polypeptide cyp76b1 from helianthus tuberosus and its applications as biocatalyst in particular for the degradation of environmental pollutants and for altering the resistance of plants sensitive to phenylurea family of herbicides
CN103820478A (en) * 2014-02-08 2014-05-28 吉林农业大学 Safflower chalcone isomerase (CHI) gene and application thereof
CN104845978A (en) * 2015-05-19 2015-08-19 吉林农业大学 Safflower MYB (v-myb myeloblastosis viral oncogene homolog (avian)) gene and application thereof

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
HUANG LULIN 等: "The First Illumina -Based De Novo Transcriptome Sequencing and Analysis of Safflower Flowers", 《PLOS ONE》 *
LIU JIANYU 等: "Unprecedented evolution and transcriptional reprogramming of CYP81 E subfamily in Carthamus tinctorius during avonoid biosynthesis", 《RESEARCH SQUARE》 *
NCBI: "cytochrome P45071 A4-like [Cynara cardunculus var. scolymus]", 《GENPEPT DATABSE》 *
NCBI: "PREDICTED: Cynara cardunculus var. scolymus cytochrome P450 71A4-like (LOC112510947), mRNA", 《GENBANK DATABASE》 *
刘秀明 等: "红花(Carthamus tinctorius L.)不同开花时期的 转录组测序及黄酮合成相关基因的验证", 《中国细胞生物学学报》 *
汪思远 等: "植物细胞色素P450的研究进展", 《吉林蔬菜》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114350674A (en) * 2022-01-07 2022-04-15 吉林农业大学 Application of safflower CtFT1 gene in improving flavone content in plant

Also Published As

Publication number Publication date
CN109182346B (en) 2022-02-15

Similar Documents

Publication Publication Date Title
US6495742B1 (en) Genes encoding plant transcription factors
US20060195949A1 (en) Environmental stress-tolerant plants
CN103088027B (en) PDR transport protein gene promoter for controlling ginsenoside accumulation, and its application
CN113430180B (en) Sweet potato flavonol synthase IbFLS1, and coding gene and application thereof
CN104845978B (en) Safflower MYB12 genes and its application
CN109182346A (en) Safflower CYP75A1 gene and its application
US6677506B1 (en) DNA coding for a Mg2+/H+ or Zn2+/H+ exchanger and transgenic plants expressing same
CN117645658A (en) Birch BpMYB86 protein, and coding gene and application thereof
KR101465692B1 (en) Method for producing transgenic plant with regulated anthocyanin biosynthesis using AtbHLH113 gene and the plant thereof
CN108588098A (en) Eucalyptus urophylla CAD genes and its application
WO1989012230A1 (en) Agrichemical screens
KR101730074B1 (en) A flavonol synthase gene and a transgenic plant with the same
CN103820478B (en) Safflower enzyme, namely chalcone isomerase CHI gene and application
CN115197951B (en) Tea tree flavonol synthesis candidate gene CsNAC086 and application thereof
CN103103193B (en) Ginseng PDR transmembrane transport protein gene promoter and application thereof
CN112795580B (en) Pitaya gene HuAAE3 and application thereof in regulation and control of high temperature stress resistance of plants
CN109679972A (en) A kind of gene being catalyzed red bayberry UDP- rhamnose biosynthesis and coding albumen and application
CN110042107B (en) Safflower CtACO1 gene, and coding protein and application thereof
CA1340974C (en) Plant universal stress-inducible regulatory element
CN106967735B (en) Safflower CtCHS1 gene, and coding protein and application thereof
CN114480448B (en) Gene GbF3&#39; H for promoting synthesis of ginkgo flavonol glycosides, and vector, protein and application thereof
CN113372422B (en) ZmGLK44 gene for regulating and controlling moisture utilization efficiency of corn under drought and application thereof
CN114350674B (en) Application of safflower CtFT1 gene in improving flavone content in plant
CN108913669A (en) A kind of drought resisting protein, the nucleic acid molecules of separation and application
CN111620934B (en) Application of protein GmHSFB2b in regulation and control of accumulation of plant flavonoids

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20220215