CN109182328B - Mitochondrial DNA extraction kit and method - Google Patents
Mitochondrial DNA extraction kit and method Download PDFInfo
- Publication number
- CN109182328B CN109182328B CN201811072615.XA CN201811072615A CN109182328B CN 109182328 B CN109182328 B CN 109182328B CN 201811072615 A CN201811072615 A CN 201811072615A CN 109182328 B CN109182328 B CN 109182328B
- Authority
- CN
- China
- Prior art keywords
- dna
- mitochondrial dna
- mitochondrial
- washing
- plasma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
Abstract
The invention discloses a mitochondrial DNA extraction kit and a method, and relates to the technical field of mitochondrial DNA extraction. The mitochondrial DNA extraction kit provided by the invention comprises proteinase K, a suspension, a lysate and an eluent; wherein the suspension is PBS buffer solution; the lysate contains: Tris-HCl, NaCl, EDTA, SDS and RNA carrier; the eluent contains: Tris-HCl and EDTA. The mitochondrial DNA extraction kit can directly take plasma as a sample by proper reagent matching, so that high-quality and high-purity mitochondrial DNA can be extracted from the sample, and the mitochondrial DNA extracted by the kit can be directly used for fluorescence quantitative PCR detection.
Description
Technical Field
The invention relates to the technical field of mitochondrial DNA extraction, and particularly relates to a mitochondrial DNA extraction kit and a method.
Background
Mitochondria (mitochondrion) is a two-layer membrane-coated organelle present in most cells, is known as the structure in the cell that produces energy, is the main site of aerobic respiration of the cell, and is called "power house". Mitochondria can be divided into four functional regions, namely, an Outer Mitochondrial Membrane (OMM), a mitochondrial membrane gap, an Inner Mitochondrial Membrane (IMM) and a mitochondrial matrix from outside to inside. The mitochondrial matrix is an internal space of mitochondria, which is surrounded by an inner mitochondrial membrane, and contains numerous proteins such as enzymes involved in biochemical reactions such as tricarboxylic acid cycle, fatty acid oxidation, amino acid degradation, and malate dehydrogenase. The mitochondrial matrix typically also contains DNA from the mitochondria themselves (i.e., mitochondrial DNA), RNA, and ribosomes (i.e., mitochondrial ribosomes).
Mitochondrial DNA is genetic material in mitochondria, in the form of a double-stranded loop. One or several mitochondrial DNA molecules may be present in a single mitochondrion. Normally, due to newcastle disease metabolism, very little mitochondrial DNA is present in the blood. However, when the structure of the tissue cell is damaged, even when the structure of the mitochondria is damaged, matrix substances in the mitochondria are released, the mitochondria DNA can be released in a large amount in the plasma, and the amount of the mitochondria DNA in the plasma is related to the damage degree of the tissue cell. There is no kit and method for extracting mitochondrial DNA from blood currently on the market. Therefore, the invention provides a kit and a method for extracting mitochondrial DNA in blood plasma.
Because of its special structure, mitochondria not only have a bilayer similar to that of cells, but also have a structure different from that of cells, and in addition, mitochondrial DNA has a structure similar to that of bacteria and is completely different from that of cell genomes. A recent study at the university of virginia, usa, shows that mitochondria in animal and plant cells are actually parasitic bacteria, and early parasitic bacteria can provide energy to animals and plants, and exist as energy parasites in cells, and are very beneficial to inhabitants. The new generation of DNA sequence technology decodes the genome of 18 bacteria, which are mitochondrial relatives. Therefore, extraction of mitochondrial DNA is also different from extraction of cellular DNA and bacterial DNA.
In addition, mitochondria are functionally semi-autonomous organelles. Recent studies have shown that mitochondria participate in cell aging and apoptosis and play a role in the treatment of anti-HIV drugs and in the development and progression of cancer. Mitochondrial DNA has a high mutation rate and these mutations are associated with diseases such as diabetes, senile dementia, and muscle disorders. Extraction and quantification of mitochondrial DNA is required in studying the relationship of mitochondrial DNA to disease. The current mitochondrial DNA extraction kit provides a convenient tool for extracting mitochondrial DNA from various cells and tissues. The purified mitochondrial DNA can be used for enzyme digestion, southern blotting, cloning, PCR analysis and amplification. However, it is clinically difficult to obtain tissues and cells, and peripheral blood is easy to obtain and is a more convenient material for research. However, there is no method for extracting mitochondrial DNA from peripheral blood. The invention provides an extraction kit and method for plasma mitochondrial DNA, and the extracted mitochondrial DNA can be used for various molecular biological analyses.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide a mitochondrial DNA extraction kit which can be used for extracting mitochondrial DNA in a plasma sample.
Another object of the present invention is to provide a method for extracting mitochondrial DNA, which can extract mitochondrial DNA from a plasma sample.
The invention is realized by the following steps:
in one aspect, the present invention provides a mitochondrial DNA extraction kit, comprising: proteinase K, suspension, lysate and eluent;
wherein the suspension is PBS buffer solution;
the lysate contains: Tris-HCl, NaCl, EDTA, SDS and RNA carrier;
the eluent contains: Tris-HCl and EDTA.
The kit comprises a lysis solution, a surfactant, a protease K, a protease carrier, a suspension solution, a lysis solution, a nuclease inhibitor, a surfactant SDS (sodium dodecyl sulfate), a surfactant, a yeast tRNA (ribonucleic acid), a buffer system, NaCl, an isotonic system, a nuclease inhibitor and a surfactant, wherein the protease K is used for dissolving membrane proteins, the suspension solution is used for balancing extracted substances, the lysis solution contains Tris-HCl and is used as the buffer system, the NaCl is used as the isotonic system, the EDTA is used as the nuclease inhibitor, the surfactant SDS is used for destroying mitochondrial structures, and the RNA carrier, namely the yeast tRNA, is used for protecting nucleic acids.
Further, in some embodiments of the invention, the lysis solution comprises: 10-55mM Tris-HCl, 100-.
In the lysis solution, the following components were used:
the concentration of Tris-HCl may be in a range of any one or between any two of 10mM, 15mM, 20mM, 25mM, 30mM, 35mM, 40mM, 45mM, 50mM and 55 mM;
the concentration of NaCl may be any one or a range between any two of 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM, and 200 mM;
the concentration of EDTA may be any one or a range between any two of 0.5mM, 1.5mM, 2.0mM, 2.5mM, 3.0mM, 3.5mM, 4.0mM, 4.5mM, 4.6mM, 4.8mM, and 5.0 mM;
the concentration (mass percentage, g/g) of SDS may be any one or a range between any two of 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, and 2.5%;
the concentration of the RNA carrier may be any one of 0.5mg/ml, 0.6mg/ml, 0.7mg/ml, 0.8mg/ml, 0.9mg/ml, 1mg/ml, 1.1mg/ml, 1.2mg/ml, 1.3mg/ml, 1.4mg/ml, and 1.5mg/ml or a range between any two.
Further, in some embodiments of the invention, the eluent comprises: 5-10mM Tris-HCl and 0.08-0.12mM EDTA.
In the eluent, the following were:
the concentration of Tris-HCl may be in the range of any one or between any two of 5mM, 6mM, 7mM, 8mM, 9mM and 10 mM;
the concentration of EDTA may be any one of 0.08mM, 0.09mM, 0.1mM, 0.11mM, and 0.12mM or a range between any two.
Further, in some embodiments of the invention, the mitochondrial DNA extraction kit further comprises: washing solution 1 and washing solution 2.
Further, in some embodiments of the invention, wash 1 comprises: 5M guanidine hydrochloride, 20mM Tris-HCl, and 40% (v/v, ml/ml) absolute ethanol, pH 6.6. The washing solution 1 can be used for removing impurities such as protein.
Further, in some embodiments of the invention, wash 2 comprises: 20mM NaCl, 2mM Tris-HCl, 80% (v/v, ml/ml) absolute ethanol, pH 7.5. Washing solution 2 can be used to remove impurities such as salt.
Further, in some embodiments of the invention, the sample for which the mitochondrial DNA extraction kit is directed is plasma.
In another aspect, the present invention provides a method for extracting mitochondrial DNA, comprising:
a sample processing step: suspending the plasma sample with the suspension liquid, centrifuging to obtain a precipitate and obtaining a suspended mitochondrial fluid;
a digestion step: adding protease K and a lysis solution into the suspended mitochondria body fluid, and digesting to obtain a digestive juice;
DNA precipitation step: adding absolute ethyl alcohol into the digestive juice, uniformly mixing, and standing at room temperature to obtain DNA precipitate;
a washing step: washing the DNA precipitate with a washing solution;
an elution step: dissolving the DNA precipitate with eluent to obtain mitochondrial DNA solution;
wherein the suspension is PBS buffer solution;
the lysate contains: Tris-HCl, NaCl, EDTA, SDS and RNA carrier;
the eluent contains: Tris-HCl and EDTA.
Further, in some embodiments of the invention, the lysis solution comprises: 10-55mM Tris-HCl, 100-.
In the lysis solution, the following components were used:
the concentration of Tris-HCl may be in a range of any one or between any two of 10mM, 15mM, 20mM, 25mM, 30mM, 35mM, 40mM, 45mM, 50mM and 55 mM;
the concentration of NaCl may be any one or a range between any two of 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM, and 200 mM;
the concentration of EDTA may be any one or a range between any two of 0.5mM, 1.5mM, 2.0mM, 2.5mM, 3.0mM, 3.5mM, 4.0mM, 4.5mM, 4.6mM, 4.8mM, and 5.0 mM;
the concentration (mass percentage, g/g) of SDS may be any one or a range between any two of 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2.0%, 2.1%, 2.2%, 2.3%, 2.4%, and 2.5%;
the concentration of the RNA carrier may be any one of 0.5mg/ml, 0.6mg/ml, 0.7mg/ml, 0.8mg/ml, 0.9mg/ml, 1mg/ml, 1.1mg/ml, 1.2mg/ml, 1.3mg/ml, 1.4mg/ml, and 1.5mg/ml or a range between any two.
Further, in some embodiments of the invention, the eluent comprises: 5-10mM Tris-HCl and 0.08-0.12mM EDTA.
In the eluent, the following were:
the concentration of Tris-HCl may be in the range of any one or between any two of 5mM, 6mM, 7mM, 8mM, 9mM and 10 mM;
the concentration of EDTA may be any one of 0.08mM, 0.09mM, 0.1mM, 0.11mM, and 0.12mM or a range between any two.
Further, in some embodiments of the invention, the concentration of proteinase K is 0.8-1.2 mg/ml.
The concentration of proteinase K may be any one or a range between any two of 0.8mg/ml, 0.9mg/ml, 1mg/ml, 1.1mg/m and 1.2 mg/ml.
Further, in some embodiments of the present invention, in the digestion step, the volume ratio of the suspended mitochondrial fluid, proteinase K and lysate is: (9-11):(0.9-1.1):(9-11).
Further, in some embodiments of the present invention, in the digestion step, the volume ratio of the suspended mitochondrial fluid, proteinase K and lysate is: 10:1:10.
Further, in some embodiments of the invention, in the DNA precipitation step: adding absolute ethyl alcohol into the digestive juice, uniformly mixing, standing at room temperature, transferring into a centrifuge tube with a filter element, centrifuging, and removing the penetrating liquid;
in the washing step:
adding a washing liquid 1 to the filter element, centrifuging, discarding the penetrating liquid, and keeping the filter element; then washing liquid 2 is put on the filter element, and after centrifugation, the penetrating liquid is discarded, and the filter element is used.
In the elution step, eluent is added to the washed filter element, and after standing at room temperature, the filter element is centrifuged, and filtrate is collected.
Further, in some embodiments of the invention, wash 1 comprises: 5M guanidine hydrochloride, 20mM Tris-HCl, and 40% (v/v, ml/ml) absolute ethanol, pH 6.6.
Further, in some embodiments of the invention, wash 2 comprises: 20mM NaCl, 2mM Tris-HCl, 80% (v/v, ml/ml) absolute ethanol, pH 7.5.
The invention has the following beneficial effects:
the mitochondrial DNA extraction kit provided by the invention comprises proteinase K, a suspension, a lysate and an eluent; wherein the suspension is PBS buffer solution; the lysate contains: Tris-HCl, NaCl, EDTA, SDS and RNA carrier; the eluent contains: Tris-HCl and EDTA. The mitochondrial DNA extraction kit can directly take plasma as a sample by proper reagent matching, so that high-quality and high-purity mitochondrial DNA can be extracted from the sample, and the mitochondrial DNA extracted by the kit can be directly used for fluorescence quantitative PCR detection.
According to the mitochondrial DNA extraction method provided by the invention, plasma is directly extracted by using the mitochondrial DNA extraction kit, the precipitate obtained after the plasma sample is centrifuged is taken as an extraction sample during extraction, high-quality and high-purity mitochondrial DNA can be extracted from the extraction sample, and the mitochondrial DNA extracted by using the kit can be directly used for fluorescence quantitative PCR detection.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 shows YOYO-1 stained free DNA in the supernatant after centrifugation of human plasma in Experimental example 1.
FIG. 2 shows mitochondria stained with mitochondrial antibodies in the pellet after centrifugation of human plasma in Experimental example 1.
FIG. 3 shows YOYO-1 stained free DNA in the supernatant of the plasma of healthy rats in Experimental example 1 after centrifugation.
FIG. 4 shows mitochondria stained with mitochondrial antibodies in the pellet after centrifugation of plasma of healthy rats in Experimental example 1.
FIG. 5 shows YOYO-1 stained free DNA in the supernatant obtained after centrifugation of plasma from liver-injured rat in Experimental example 1.
FIG. 6 shows mitochondria stained with mitochondrial antibodies in the pellet after centrifugation of plasma from liver-injured rats in example 1.
FIG. 7 shows the result of the fluorescence quantitative PCR amplification detection of the extracted mitochondrial DNA in example 2.
FIG. 8 shows the results of fluorescence quantitative PCR amplification detection of the extracted mitochondrial DNA in example 3.
FIG. 9 shows the results of fluorescence quantitative PCR amplification detection of the extracted mitochondrial DNA in example 4.
FIG. 10 shows the results of fluorescence quantitative PCR amplification detection of the extracted mitochondrial DNA in example 5.
FIG. 11 shows the results of electrophoretic detection of plasma mitochondrial DNA of healthy rabbits and rats extracted in example 6.
FIG. 12 shows the results of the quantitative fluorescent PCR amplification of genomic DNA of mitochondrial DNA extracted in example 7.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The features and properties of the present invention are described in further detail below with reference to examples and experimental examples.
Experimental example 1
First, mitochondrial (Mit) specific antibody fluorescence staining test and plasma mitochondrial DNA (mtDNA) YOYO-1 fluorescence staining test
1. Human plasma
1.1 method:
50ml of blood was collected from a healthy person, plasma was separated, and then 16000g of centrifugation was carried out to obtain an upper supernatant containing free mtDNA and a lower pellet containing mitochondria, respectively. The supernatant of the upper layer was stained with YOYO, and the precipitate of the lower layer was stained with a fluorescent dye, a specific antibody for mitochondrial staining, observed under a fluorescent microscope and photographed.
1.2 results:
the results indicate that mitochondrial DNA is present in plasma in a variety of forms: YOYO-1 stained free DNA in the supernatant, varying in brightness and size (FIG. 1); mitochondria stained with mitochondrial antibodies were precipitated, larger and brighter than the colored particles in the supernatant (FIG. 2).
The human plasma mtDNA and mitochondrial fluorescent staining test result shows two points:
1) mitochondria exist in plasma in a variety of forms: free mitochondrial DNA, complexes of mitochondrial DNA and mitochondrial proteins, free mitochondria;
2) the precipitate is more mtDNA and mitochondria than the supernatant and is contaminated with genomic DNA, whereas the precipitate is more pure in mitochondrial DNA, which is a suitable subject for extraction of mitochondrial DNA.
2. Plasma of healthy rats:
2.1, method:
1ml of blood from healthy rats was collected, plasma was separated, and then 16000g of centrifugation was carried out to obtain an upper supernatant containing free mtDNA and a lower pellet containing mitochondria, respectively. The supernatant of the upper layer was stained with YOYO, and the precipitate of the lower layer was stained with a fluorescent dye, a specific antibody for mitochondrial staining, observed under a fluorescent microscope and photographed.
2.2 results:
the results indicate that mitochondrial DNA is present in plasma in a variety of forms: YOYO-1 stained free DNA in the supernatant, varying in brightness and size (FIG. 3); mitochondria stained with mitochondrial antibodies were precipitated, larger and brighter than the colored particles in the supernatant (fig. 4).
The fluorescent staining test results of rat plasma mtDNA and mitochondria show two points:
1) mitochondria exist in plasma in a variety of forms: free mitochondrial DNA, complexes of mitochondrial DNA and mitochondrial proteins, free mitochondria;
2) the mtDNA and mitochondria are more in the pellet and there is genomic DNA contamination in the supernatant, while the mitochondrial DNA is purer in the pellet, which is the subject of suitable mtDNA extraction.
3. Liver injury rat plasma:
3.1 method:
blood of a liver-injured rat of 16ml was collected, plasma was separated, and then 16000g was centrifuged to obtain an upper supernatant containing free mtDNA and a lower pellet containing mitochondria, respectively. The supernatant of the upper layer was stained with YOYO, and the precipitate of the lower layer was stained with a fluorescent dye, a specific antibody for mitochondrial staining, observed under a fluorescent microscope and photographed.
3.2 results:
the results indicate that mitochondrial DNA is present in plasma in a variety of forms: YOYO-1 stained free DNA in the supernatant, varying in brightness and size (FIG. 5); mitochondria stained with mitochondrial antibodies were precipitated, larger and brighter than the colored particles in the supernatant (FIG. 6).
The fluorescent staining test results of rat plasma mtDNA and mitochondria show two points:
1) mitochondria exist in plasma in a variety of forms: free mitochondrial DNA, complexes of mitochondrial DNA and mitochondrial proteins, free mitochondria;
2) the mtDNA and mitochondria are more in the pellet and there is genomic DNA contamination in the supernatant, while the mitochondrial DNA is purer in the pellet, which is the subject of suitable mtDNA extraction.
Example 1
The mitochondrial DNA extraction kit provided by the embodiment comprises the following reagents:
proteinase K, suspension, washing solution 1, washing solution 2, lysis solution and eluent;
wherein the concentration of proteinase K is 1 mg/ml.
The suspension was 0.1M PBS buffer.
Washing solution 1: 5M guanidine hydrochloride, 20mM Tris-HCl, 40% absolute ethanol (v/v), pH 6.6.
Washing solution 2: 20mM NaCl, 2mM Tris-HCl, 80% absolute ethanol (v/v), pH 7.5.
The lysate contains: 20mM Tris-HCl (pH 8.0), 150mM NaCl, 5mM EDTA, 1.0% SDS and 1mg/ml RNA carrier.
The eluent contains: 10mM Tris-HCl and 0.1mM EDTA.
The preparation method of the lysis solution comprises the following steps: 877.5mg of NaCl and 37.42mg of EDTA-2 Na were weighed, dissolved in 100. mu.l of ultrapure water, and then 2ml of 1M Tris-HCl (pH 8.8, available from SIGMA) was added to clarify the solution, followed by adding ultrapure sterile water to adjust pH 8.0 to a constant volume of 90 ml. Before use, 10ml of SDS (10% (mass ratio, available from SIGMA) is added and mixed, and the total volume is 100ml of lysate. 100mg of RNA carrier was dissolved in 200. mu.l of sterile ultrapure water and dispensed into 2.0. mu.l/tube and frozen at-20 ℃. Before loading, the sample was removed and 1ml of lysate was added to each tube.
Preparation method of washing solution 1: 47.765g of guanidine hydrochloride was weighed, 2ml of 1M Tris-HCl (pH 8.8, available from SIGMA) was added, and sterile ultrapure water was added to adjust the pH to 6.6 to 100 ml. 60ml of the mixture is taken before use, 40ml of absolute ethyl alcohol is added, and the mixture is uniformly mixed.
Preparation method of washing solution 2: NaCl 46.8mg was weighed, 80. mu.l of 1M Tris-HCl (pH 8.8, available from SIGMA) was added, and sterile ultrapure water was added to adjust the pH to 7.5 to a volume of 40 ml. 20ml of the mixture is taken before use, 80ml of absolute ethyl alcohol is added, and the mixture is uniformly mixed.
The preparation method of the eluent comprises the following steps: EDTA-2 Na 7.48mg was weighed, 1ml of Tris-HCl 1M (pH 8.8, available from SIGMA) was added, ultrapure sterile water was added, pH 8.0 was adjusted, and the volume was adjusted to 100 ml.
2 the method for extracting plasma mitochondrial DNA by using the mitochondrial DNA extraction kit provided in this example is operated as follows:
2.1 sample pretreatment (collection of mitochondria): 0.1ml of fresh plasma was centrifuged at 16000g for 10 min, the supernatant was discarded and the pellet was suspended with 200. mu.l of 100-.
It should be noted that: the greater the blood volume, the greater the fold of mitochondrial concentration, and if the plasma volume exceeds 0.2ml, the subsequent reagents need to be increased.
2.2 digestion: 20 μ l proteinase K was added to the bottom of 1.5ml EPPENDOF tube, then 200 μ l suspended mitochondrial fluid was added to 100-.
2.3 DNA precipitation: adding 200 μ l of anhydrous ethanol (precooled in a refrigerator), mixing, standing at room temperature for 5 minutes, transferring to a centrifuge tube with a filter element (injection: adding to a membrane), centrifuging at 12000rpm for 2 minutes, and removing the penetrating liquid. And (6) replacing the sleeve.
The 1.5ml EPPENDORF tubes, 2ml centrifuge tube cannulas and centrifuge tubes with filter elements used were purchased from shanghai bioengineering, ltd.
2.4 removing impurities such as protein: 500. mu.l of washing solution 1 was added, centrifuged at 10000rpm for 2 minutes, and the solution was discarded. And (6) replacing the sleeve.
2.5 removing impurities such as salt: add 500. mu.l of Wash 2, centrifuge at 10000rpm for 2 minutes and discard the permeate. Replacing the sleeve; centrifuge again at 14000rpm for 3 minutes.
2.6 elution of DNA: mu.l of the eluent was added, and after standing at room temperature for 2 minutes, the mixture was centrifuged at 12000rpm for 2 minutes, and the eluted solution was applied to the same filter element membrane, and after standing at room temperature for 1 minute, the mixture was centrifuged at 12000rpm for 2 minutes.
2.7 the filtrate is mitochondrial DNA solution containing mitochondrial DNA, and is stored at 2-8 ℃ for a short time for 1-2 days, and needs to be frozen at-20 ℃ for a long time.
Example 2
Extraction of plasma mitochondrial DNA and PCR amplification detection in Normal rats Using the kit and method of example 1
Plasma mitochondrial DNA extraction and PCR amplification detection in 3.14 normal rats (purchased from the laboratory animal center, Yangzhou university)
3.1.1 plasma mitochondrial Collection: normal SD rats were treated with sodium citrate anticoagulated, centrifuged at 1600g for 10 min, and the supernatant plasma carefully collected. 200 μ l of plasma was centrifuged at 16000g for 10 min, the supernatant was discarded and the pellet was suspended in 200 μ l of suspension.
3.1.2 digestion: adding 20 μ l proteinase K to the bottom of 1.5ml EPPENDOF tube, then adding 200 μ l suspended mitochondria solution, then adding 200 μ l lysis solution, mixing, digesting for 2 hours at 56 ℃;
3.1.3 DNA precipitation: adding 200 μ l of anhydrous ethanol (precooled in a refrigerator), mixing, standing at room temperature for 5 minutes, transferring to a centrifuge tube with a filter element (injection: adding to a membrane), centrifuging at 12000rpm for 2 minutes, and removing the penetrating liquid. Replacing the sleeve;
3.1.4 removing protein and other impurities: 500. mu.l of washing solution 1 was added, centrifuged at 10000rpm for 2 minutes, and the solution was discarded. Replacing the sleeve;
3.1.5 removing impurities such as salt: add 500. mu.l of Wash 2, centrifuge at 10000rpm for 2 minutes and discard the permeate. Replacing the sleeve; centrifuging for 3 minutes at the maximum speed;
3.1.6 elution of DNA: mu.l of the eluent was added, and after standing at room temperature for 2 minutes, the mixture was centrifuged at 12000rpm for 2 minutes, and the eluted solution was applied to the same filter element membrane, and after standing at room temperature for 1 minute, the mixture was centrifuged at 12000rpm for 2 minutes.
3.1.7 the filtrate is mitochondrial DNA and is stored frozen at-20 ℃.
3.1.8 fluorescent quantitative PCR detection of extracted mitochondrial DNA (20. mu.l system): 2 × SYBR Master Mix 10 μ l, 10 μ M upstream primer Mito _16Sr RNA _ F1 CCCAACACAGGCGTGCTT (SEQ ID NO.1)0.4 μ l, 10 μ M downstream primer Mito _16Sr RNA _ R1 ACCGCGGCCGTTTAACTT (SEQ ID NO.2)0.4 μ l, 50 × ROX Reference Dye 10.4 μ l, DNA template 2.0 μ l, d H2O (sterilized distilled water) 6.8. mu.l. Reaction conditions are as follows: 95 ℃ for 5 min; 40 cycles of 95 ℃ for 10s and 60 ℃ for 30 s. Melting curve, 95 ℃ for 15s, 60 ℃ for 60s, 95 ℃ for 15 s.
3.1.9 sample control: d H2O (sterilized distilled water) was used as a negative control, and hepatocyte mitochondrial DNA was used as a positive control. The amplification results are shown in FIG. 7:
negative control has no amplification curve, no CT value; positive control has an amplification curve with obvious logarithmic growth, CT value is 18.54 + -0.05 (liver mitochondrial DNA 1: 1000 times dilution, average of three results + -SD); 4 rats all had significant logarithmically increasing amplification curves with CT values of 20.23 + -0.08, 20.34 + -0.02, 21.61 + -0.01, 21.72 + -0.04 (mean of three results + -SD) (see amplification curves). Samples with amplification curves show consistent melting curves (see melting plots). The results indicate that 4 SD rats can effectively extract plasma mitochondrial DNA using the kit and method of example 1, and the extracted mitochondrial DNA can be used for fluorescent quantitative PCR detection.
Example 3
Plasma mitochondrial DNA extraction and PCR amplification detection of liver-injured rats using the kit and method of example 1
3.2.1 plasma mitochondrial Collection: liver injury SD rats 5 (purchased from the laboratory animal center of Yangzhou university, the liver injury model was constructed in this laboratory), anticoagulated with sodium citrate, centrifuged at 1600g for 10 min, and upper plasma was carefully collected. 200 μ l of plasma was centrifuged at 16000g for 10 min, the supernatant was discarded and the pellet was suspended in 200 μ l of suspension.
3.2.2 digestion: adding 20 μ l proteinase K to the bottom of 1.5ml EPPENDOF tube, then adding 200 μ l suspended mitochondria solution, then adding 200 μ l lysis solution, mixing, digesting for 2 hours at 56 ℃;
3.2.3 DNA precipitation: adding 200 μ l of anhydrous ethanol (precooled in a refrigerator), mixing, standing at room temperature for 5 minutes, transferring to a centrifuge tube with a filter element (injection: adding to a membrane), centrifuging at 12000rpm for 2 minutes, and removing the penetrating liquid. Replacing the sleeve;
3.2.4 removal of impurities such as protein: 500. mu.l of washing solution 1 was added, centrifuged at 10000rpm for 2 minutes, and the solution was discarded. Replacing the sleeve;
3.2.5 removal of impurities such as salt: add 500. mu.l of Wash 2, centrifuge at 10000rpm for 2 minutes and discard the permeate. Replacing the sleeve; centrifuging for 3 minutes at the maximum speed;
3.2.6 elution of DNA: mu.l of the eluent was added, and after standing at room temperature for 2 minutes, the mixture was centrifuged at 12000rpm for 2 minutes, and the eluted solution was applied to the same filter element membrane, and after standing at room temperature for 1 minute, the mixture was centrifuged at 12000rpm for 2 minutes.
3.2.7 the filtrate is mitochondrial DNA and is stored frozen at-20 ℃.
3.2.8 fluorescent quantitative PCR detection of extracted mitochondrial DNA (20. mu.l system): 2 × SYBR Master Mix 10 μ l, 10 μ M upstream primer Mito _16Sr RNA _ F1 CCCAACACAGGCGTGCTT 0.4.4 μ l, 10 μ M downstream primer Mito _16Sr RNA _ R1 ACCGCGGCCGTTTAACTT 0.4.4 μ l, 50 × ROX Reference Dye 10.4 μ l, DNA template 2.0 μ l, d H2O (sterilized distilled water) 6.8. mu.l. Reaction conditions are as follows: 95 ℃ for 5 min; 40 cycles of 95 ℃ for 10s and 60 ℃ for 30 s. Melting curve, 95 ℃ for 15s, 60 ℃ for 60s, 95 ℃ for 15 s.
3.2.9 sample control: dH2O (sterilized distilled water) was used as a negative control, and hepatocyte mitochondrial DNA was used as a positive control. The amplification results are shown in FIG. 8:
negative control has no amplification curve, no CT value; the positive control has an amplification curve with obvious logarithmic growth, and the CT value is 15.78 +/-0.07 (liver mitochondrial DNA is diluted by 1: 100 times, and the average of three results is +/-SD); 5 rats all had significant logarithmically increasing amplification curves with CT values of 17.42. + -. 0.17, 17.52. + -. 0.11, 16.45. + -. 0.06, 16.72. + -. 0.03, 16.55. + -. 0.05 (mean. + -. SD of three results) (see amplification curves). Samples with amplification curves show consistent melting curves (see melting plots). The results show that 8 SD rats with liver injury can effectively extract plasma mitochondrial DNA by using the kit and the method of example 1, and the extracted mitochondrial DNA can be used for fluorescent quantitative PCR detection.
Example 4
Plasma mitochondrial DNA extraction and PCR amplification detection in rats with heart damage using the kit and method of example 1
3.3.1 plasma mitochondrial Collection: heart injury SD rats 4 (purchased from the laboratory animal center, university of promiscuous, where heart injury models were constructed) were anticoagulated with sodium citrate, centrifuged at 1600g for 10 min, and the supernatant plasma carefully collected. 200 μ l of plasma was centrifuged at 16000g for 10 min, the supernatant was discarded and the pellet was suspended in 200 μ l of suspension.
3.3.2 digestion: adding 20 μ l proteinase K to the bottom of 1.5ml EPPENDOF tube, then adding 200 μ l suspended mitochondria solution, then adding 200 μ l lysis solution, mixing, digesting for 2 hours at 56 ℃;
3.3.3 DNA precipitation: adding 200 μ l of anhydrous ethanol (precooled in a refrigerator), mixing, standing at room temperature for 5 minutes, transferring to a centrifuge tube with a filter element (injection: adding to a membrane), centrifuging at 12000rpm for 2 minutes, and removing the penetrating liquid. Replacing the sleeve;
3.3.4 removal of impurities such as proteins: 500. mu.l of washing solution 1 was added, centrifuged at 10000rpm for 2 minutes, and the solution was discarded. Replacing the sleeve;
3.3.5 removing impurities such as salt: add 500. mu.l of Wash 2, centrifuge at 10000rpm for 2 minutes and discard the permeate. Replacing the sleeve; centrifuging for 3 minutes at the maximum speed;
3.3.6 elution of DNA: mu.l of the eluent was added, and after standing at room temperature for 2 minutes, the mixture was centrifuged at 12000rpm for 2 minutes, and the eluted solution was applied to the same filter element membrane, and after standing at room temperature for 1 minute, the mixture was centrifuged at 12000rpm for 2 minutes.
3.3.7 the filtrate is mitochondrial DNA and is stored at-20 deg.C.
3.3.8 fluorescent quantitative PCR detection of extracted mitochondrial DNA (20. mu.l system): 2 × SYBR Master Mix 10. mu.l, 10. mu.M upstream primer Mix u16Sr RNA _ F1 CCCAACACAGGCGTGCTT 0.4.4. mu.l, 10. mu.M downstream primer Mito _16Sr RNA _ R1 ACCGCGGCCGTTTAACTT 0.4.4. mu.l, 50 XROX Reference Dye 10.4. mu.l, DNA template 2.0. mu.l, d H2O (sterilized distilled water) 6.8. mu.l. Reaction conditions are as follows: 95 ℃ for 5 min; 40 cycles of 95 ℃ for 10s and 60 ℃ for 30 s. Melting curve, 95 ℃ for 15s, 60 ℃ for 60s, 95 ℃ for 15 s.
3.3.9 sample control: dH2O (sterilized distilled water) was used as a negative control, and hepatocyte mitochondrial DNA was used as a positive control. The amplification results are shown in FIG. 9:
negative control has no amplification curve, no CT value; the positive control has an amplification curve with obvious logarithmic growth, and the CT value is 20.23 +/-0.08 (liver mitochondrial DNA is diluted by 1: 10000 times, and the average of three results is +/-SD); 4 rats all had a significant logarithmic increase in the amplification curve, with CT values of 18.96. + -. 0.08, 18.95. + -. 0.03, 18.54. + -. 0.05, 18.83. + -. 0.02 (mean. + -. SD of three results) (see amplification plot). Samples with amplification curves show consistent melting curves (see melting plots). The results show that plasma mitochondrial DNA can be effectively extracted from 4 SD rats with heart injury by using the kit and the method of example 1, and the extracted mitochondrial DNA can be used for fluorescent quantitative PCR detection.
Example 5
Plasma mitochondrial DNA extraction and PCR amplification detection of spleen-injured rats by using the kit and method of example 1
3.4.1 plasma mitochondrial Collection: spleen injury SD rats 4 (purchased from the university of Yangzhou laboratory animal center, the spleen injury model was constructed in this laboratory), anticoagulated with sodium citrate, centrifuged at 1600g for 10 min, and the supernatant plasma was carefully collected. 200 μ l of plasma was centrifuged at 16000g for 10 min, the supernatant was discarded and the pellet was suspended in 200 μ l of suspension.
3.4.2 digestion: adding 20 μ l proteinase K to the bottom of 1.5ml EPPENDOF tube, then adding 200 μ l suspended mitochondria solution, then adding 200 μ l lysis solution, mixing, digesting for 2 hours at 56 ℃;
3.4.3 DNA precipitation: adding 200 μ l of anhydrous ethanol (precooled in a refrigerator), mixing, standing at room temperature for 5 minutes, transferring to a centrifuge tube with a filter element (injection: adding to a membrane), centrifuging at 12000rpm for 2 minutes, and removing the penetrating liquid. Replacing the sleeve;
3.4.4 removal of impurities such as protein: 500. mu.l of washing solution 1 was added, centrifuged at 10000rpm for 2 minutes, and the solution was discarded. Replacing the sleeve;
3.4.5 removing impurities such as salt: add 500. mu.l of Wash 2, centrifuge at 10000rpm for 2 minutes and discard the permeate. Replacing the sleeve; centrifuging for 3 minutes at the maximum speed;
3.4.6 elution of DNA: mu.l of the eluent was added, and after standing at room temperature for 2 minutes, the mixture was centrifuged at 12000rpm for 2 minutes, and the eluted solution was applied to the same filter element membrane, and after standing at room temperature for 1 minute, the mixture was centrifuged at 12000rpm for 2 minutes.
3.4.7 the filtrate is mitochondrial DNA and is stored frozen at-20 ℃.
3.4.8 fluorescent quantitative PCR detection of extracted mitochondrial DNA (20. mu.l system): 2 × SYBR Master Mix 10 μ l, 10 μ M upstream primer Mito _16Sr RNA _ F1 CCCAACACAGGCGTGCTT 0.4.4 μ l, 10 μ M downstream primer Mito _16Sr RNA _ R1 ACCGCGGCCGTTTAACTT 0.4.4 μ l, 50 × ROX Reference Dye 10.4 μ l, DNA template 2.0 μ l, dH2O (sterilized distilled water) 6.8. mu.l. Reaction conditions are as follows: 95 ℃ for 5 min; 40 cycles of 95 ℃ for 10s and 60 ℃ for 30 s. Melting curve, 95 ℃ for 15s, 60 ℃ for 60s, 95 ℃ for 15 s.
3.4.9 sample control: dH2O (sterilized distilled water) was used as a negative control, and hepatocyte mitochondrial DNA was used as a positive control. The amplification results are shown in FIG. 10:
negative control has no amplification curve, no CT value; the positive control has an amplification curve with obvious logarithmic growth, and the CT value is 19.26 +/-0.14 (liver mitochondrial DNA is diluted by 1: 10000 times, and the average of three results is +/-SD); 4 rats all had a significant logarithmic increase in the amplification curve, with CT values of 15.51. + -. 0.13, 16.00. + -. 0.23, 15.28. + -. 0.03, 15.40. + -. 0.03 (mean. + -. SD of triplicate results) (see amplification plot). Samples with amplification curves show consistent melting curves (see melting plots). The results show that plasma mitochondrial DNA can be effectively extracted from 4 SD rats with spleen injury by using the kit and the method in example 1, and the extracted mitochondrial DNA can be used for fluorescent quantitative PCR detection.
Example 6
Plasma mitochondrial DNA extraction and electrophoretic detection in healthy rabbits and rats using the kit and method of example 1
3.5.1 plasma mitochondrial Collection: healthy rabbits 2 (purchased from the breeding farm of the Qinglongshan animals) and healthy rats 3 (purchased from the center of the laboratory animals of Yangzhou university), anticoagulated with sodium citrate, and centrifuged at 1600g for 10 minutes, and the upper plasma was carefully collected. 10.0ml and 22.5ml of plasma were taken from rabbits, 7.5ml and 18.0ml of plasma were taken from rats, centrifuged at 16000g for 10 minutes, the supernatant was discarded, and the pellet was suspended in 1000. mu.l of the suspension.
3.5.2 digestion: adding 200 μ l proteinase K to the bottom of 1.5ml EPPENDOF tube, then adding 200 μ l suspended mitochondria body fluid (5 tubes are made for each sample at the same time), adding 200 μ l lysis buffer, mixing, digesting at 56 ℃ for 2 hours;
3.5.3DNA precipitation: adding 200 μ l of anhydrous ethanol (precooled in a refrigerator), mixing, standing at room temperature for 5 minutes, transferring to a centrifuge tube with a filter element (injection: adding to a membrane), centrifuging at 12000rpm for 2 minutes, and removing the penetrating liquid. Replacing the sleeve; transferring the liquid in the other tube into the same centrifugal tube with the filter element, and repeating the operation until 5 tubes of the same liquid are completely transferred (5 samples are simultaneously made);
3.5.4 removal of impurities such as proteins: 500. mu.l of washing solution 1 was added, centrifuged at 10000rpm for 2 minutes, and the solution was discarded. Replacing the sleeve;
3.5.5 removal of impurities such as salt: add 500. mu.l of Wash 2, centrifuge at 10000rpm for 2 minutes and discard the permeate. Replacing the sleeve; centrifuging for 3 minutes at the maximum speed;
3.5.6 elution of DNA: mu.l of the eluent was added, and after standing at room temperature for 2 minutes, the mixture was centrifuged at 12000rpm for 2 minutes, and the eluted solution was applied to the same filter element membrane, and after standing at room temperature for 1 minute, the mixture was centrifuged at 12000rpm for 2 minutes.
3.5.7 the filtrate is mitochondrial DNA and is stored frozen at-20 ℃.
3.5.8 electrophoresis: 0.8% agarose gel was prepared using 1 XTBE, and the extracted DNA was analyzed by electrophoresis in an amount of 20. mu.l. Electrophoresis at 80 volts fixed voltage for 1 hour. With 15,000 BP MARKER as the standard molecular weight control, the mitochondrial DNA had a bright band at about 16500BP, which is the mitochondrial DNA band. Furthermore, only mitochondrial DNA bands were seen, and no genomic bands were seen (see FIG. 11). The result shows that plasma mitochondrial DNA can be effectively extracted by the reagent and the method for the plasma of healthy rabbits and rats, and the extracted mitochondrial DNA has no genomic DNA pollution and can be used for agarose gel electrophoresis detection.
Example 7
Fluorescent quantitative PCR detection of genome DNA in plasma mitochondrial DNA extracting solution
3.6.1 fluorescent quantitative PCR detection of genomic DNA in mitochondrial DNA extracted in the above examples (4 healthy rats in example 2, liver-injured rats in example 3, heart-injured rats in example 4, spleen-injured rats in example 5) (20. mu.l system): 2 × SYBR Master Mix 10. mu.l, 10. mu.M upstream primer Sense: 5'-TATGTCGTGGAGTCTACTGGCGTCT-3' (SEQ ID NO.3), 0.4. mu.l, 10. mu.M reverse primer Antisense: 5 '-AAGCAGTTGGTGGTGCAGGATG 3' (SEQ ID NO.4) 0.4. mu.l, 50 XROX Reference Dye 10.4. mu.l, DNA template 2.0. mu.l, d H2O (sterilized distilled water) 6.8. mu.l. Reaction conditions are as follows: 95 ℃ for 5 min; 40 cycles of 95 ℃ for 10s and 60 ℃ for 30 s. Melting curve, 95 ℃ for 15s, 60 ℃ for 60s, 95 ℃ for 15 s.
3.6.2 sample controls: dH2O (sterilized distilled water) is used as a negative control, and the genomic DNA of the liver cells is used as a positive control. The amplification results are shown in FIG. 12:
negative control has no amplification curve, no CT value; the positive control has an amplification curve with obvious logarithmic growth, and the CT value is 24.06 +/-0.06 (the average of three results +/-SD); no significant log-growth amplification curves were observed in all of 4 healthy rats, 5 liver-injured rats, 4 heart-injured rats and 4 spleen-injured rats (see amplification graphs), and no genomic DNA was detected. In summary, only the positive control showed amplification and melting curves, and none of the other samples (see amplification and melting plots). The result shows that plasma mitochondrial DNA can be effectively extracted by the reagent and the method for healthy rats and injured SD rats, and the extracted mitochondrial DNA has no genomic DNA pollution and higher purity.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
SEQUENCE LISTING
<110> Song Yong, xu Wu Jian, Yi Shi Qiang, Yang Shi Jian, Zhang Hongyang, Peak peak
<120> mitochondrial DNA extraction kit and method
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 18
<212> DNA
<213> Artificial sequence
<400> 1
<210> 2
<211> 18
<212> DNA
<213> AAGCAGTTGGTGGTGCAGGATG
<400> 2
<210> 3
<211> 25
<212> DNA
<213> AAGCAGTTGGTGGTGCAGGATG
<400> 3
tatgtcgtgg agtctactgg cgtct 25
<210> 4
<211> 22
<212> DNA
<213> AAGCAGTTGGTGGTGCAGGATG
<400> 4
aagcagttgg tggtgcagga tg 22
Claims (3)
1. A method for extracting mitochondrial DNA, comprising:
a sample processing step: suspending the plasma sample by using the suspension liquid, centrifuging the plasma sample at the speed of 16000g for 10 minutes to obtain a precipitate and obtaining a suspended mitochondrial fluid;
a digestion step: adding protease K and a lysis solution into the suspended mitochondria body fluid, and digesting to obtain a digestive juice;
DNA precipitation step: adding absolute ethyl alcohol into the digestive juice, uniformly mixing, and standing at room temperature to obtain DNA precipitate;
a washing step: washing the DNA precipitate with a washing solution;
an elution step: dissolving the DNA precipitate with eluent to obtain mitochondrial DNA solution;
wherein the suspension is PBS buffer solution;
the lysis solution contains: 20mM Tris-HCl (pH 8.0), 150mM NaCl, 5mM EDTA, 1.0% SDS and 1mg/ml RNA carrier;
the eluent contains: 10mM Tris-HCl and 0.1mM EDTA;
the washing liquid comprises a washing liquid 1 and a washing liquid 2, wherein the washing liquid 1 contains: 5M guanidine hydrochloride, 20mM Tris-HCl and 40% absolute ethanol (v/v), pH 6.6; the washing solution 2 contained: 20mM NaCl, 2mM Tris-HCl and 80% absolute ethanol (v/v), pH 7.5.
2. The method for extracting mitochondrial DNA according to claim 1, wherein the amount by volume of the suspended mitochondrial fluid, proteinase K and the lysate in the digestion step is: (9-11):(0.9-1.1):(9-11).
3. The method for extracting mitochondrial DNA according to claim 2, wherein the DNA is extracted from the sample,
in the DNA precipitation step: adding absolute ethyl alcohol into the digestive juice, uniformly mixing, standing at room temperature for 5-10 minutes, transferring into a centrifuge tube with a filter element, centrifuging, and removing the penetrating liquid;
in the washing step:
adding a washing liquid 1 to the filter element, centrifuging, and then discarding the penetrating liquid; then washing liquid 2 is put on the filter element, and after centrifugation, the penetrating liquid is discarded;
in the elution step, eluent is added to the filter element, and after standing at room temperature, the filter element is centrifuged, and filtrate is collected.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811072615.XA CN109182328B (en) | 2018-09-13 | 2018-09-13 | Mitochondrial DNA extraction kit and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811072615.XA CN109182328B (en) | 2018-09-13 | 2018-09-13 | Mitochondrial DNA extraction kit and method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109182328A CN109182328A (en) | 2019-01-11 |
| CN109182328B true CN109182328B (en) | 2022-01-07 |
Family
ID=64910915
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811072615.XA Active CN109182328B (en) | 2018-09-13 | 2018-09-13 | Mitochondrial DNA extraction kit and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109182328B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630208A (en) * | 2015-02-11 | 2015-05-20 | 杭州百迈生物技术有限公司 | Kit and method for extracting genome DNA (deoxyribonucleic acid) |
| CN107312771A (en) * | 2017-01-11 | 2017-11-03 | 华东医药（杭州）基因科技有限公司 | A kind of method of efficient extracting serum and plasma DNA |
| CN108070584A (en) * | 2016-11-16 | 2018-05-25 | 江苏然科生物技术有限公司 | The silica gel adsorption column extracts kit and method of a kind of blood plasma or free serum DNA and RNA |
-
2018
- 2018-09-13 CN CN201811072615.XA patent/CN109182328B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104630208A (en) * | 2015-02-11 | 2015-05-20 | 杭州百迈生物技术有限公司 | Kit and method for extracting genome DNA (deoxyribonucleic acid) |
| CN108070584A (en) * | 2016-11-16 | 2018-05-25 | 江苏然科生物技术有限公司 | The silica gel adsorption column extracts kit and method of a kind of blood plasma or free serum DNA and RNA |
| CN107312771A (en) * | 2017-01-11 | 2017-11-03 | 华东医药（杭州）基因科技有限公司 | A kind of method of efficient extracting serum and plasma DNA |
Non-Patent Citations (3)
| Title |
|---|
| Development of a rapid mitochondrial DNA extraction method for species identification in milk and milk products;J. Liao et al;《J. Dairy Sci.》;20171231;第100卷(第9期);第7035-7040页 * |
| Simultaneous extraction of nuclear and mitochondrial DNA from human blood;Shazia Ahmad et al;《Genes Genet.Syst.》;20071231;第82卷;第429-432页 * |
| 高纯度线粒体DNA的快速提取;梅玉屏等;《广州师院学报（自然科学版）》;19981231;第3卷(第21期);第70-73页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109182328A (en) | 2019-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2452874T3 (en) | Reagents and methods for the isolation of purified RNA | |
| US5972613A (en) | Methods of nucleic acid isolation | |
| CN103097531B (en) | The preprocess method of biological specimen, the detection method of RNA and pretreating reagent box | |
| CN108929874B (en) | Nucleic acid aptamer specifically binding to cell with high-expression PDL1 protein and application of nucleic acid aptamer | |
| JP2012502632A (en) | Small RNA isolation method | |
| CN111658775B (en) | Role of long-chain non-coding RNA in osteogenic differentiation and adipogenic differentiation of stem cells | |
| WO2012155577A1 (en) | Method for separating and purifying rna from biomaterial | |
| CN112501162A (en) | Kit for extracting new coronavirus RNA by using nano magnetic beads and extraction method | |
| CN110938624A (en) | Kit for extracting genome DNA and application thereof | |
| CN104152436B (en) | DNA isolation and purification methods and its kit | |
| CN109182328B (en) | Mitochondrial DNA extraction kit and method | |
| CN107683335A (en) | Automatic mode for nucleic acid separation | |
| CN111019940A (en) | Extracting solution for directly extracting whole blood genome DNA and extracting method thereof | |
| WO2022068826A1 (en) | Method for isolating and purifying nucleic acid solid from biological material | |
| CN113667664A (en) | Kit for extracting nucleic acid by using nano magnetic beads and extraction method | |
| RU2678988C1 (en) | Method for isolating extracellular vesicles from biological fluids | |
| CN102191238A (en) | Method for extracting small molecular RNA | |
| KR102587121B1 (en) | Composition for isolating rna | |
| CN110804611A (en) | Method for extracting genome DNA (deoxyribonucleic acid) suitable for bacteria and/or fungi | |
| RU2422532C2 (en) | Method of recovery low-molecular nuclear ribonucleoproteids (rnp) from tissues and organs of mammals | |
| Jarallah et al. | Design of a new rapid and efficient kit for extracting DNA from blood sample | |
| CN106434640A (en) | Method for extracting RNA (ribonucleic acid) by aid of conventional reagents | |
| JP2014060965A (en) | Method of crushing cell and method of separating nucleic acid of cell | |
| JP2004105009A (en) | Reagent for separating nucleic acid comprising tetraphenylboron compound and method for separating nucleic acid using the same | |
| CN114908081A (en) | Nucleic acid extraction reagent, kit thereof and method for rapidly extracting, separating and purifying nucleic acid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |