CN109182273A - Express cell model, construction method and the application of the FLNB gene of missense mutation - Google Patents
Express cell model, construction method and the application of the FLNB gene of missense mutation Download PDFInfo
- Publication number
- CN109182273A CN109182273A CN201810955114.XA CN201810955114A CN109182273A CN 109182273 A CN109182273 A CN 109182273A CN 201810955114 A CN201810955114 A CN 201810955114A CN 109182273 A CN109182273 A CN 109182273A
- Authority
- CN
- China
- Prior art keywords
- flnb
- cell
- gene
- mutation
- atdc5
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0693—Tumour cells; Cancer cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Oncology (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of cell model of the FLNB gene of expression mutation, cell used in the FLNB gene of the expression missense mutation is ATDC5 cell.The present invention sufficiently shows that the physiology of FLNB gene and pathology sexual function have significant cell type specificity, also explains why FLNB gene only influences skeletal system.The invention also provides the missense mutation of different loci to pass through the mutual containing between the effects of it is to cellular morphology, apoptosis, migration and the signal transduction pathway in downstream, leads to the phenotype of mutually different skeletal system deformity to each other.
Description
Technical field
The present invention relates to biomedicine fields, and in particular to it is a kind of express missense mutation FLNB gene cell model,
Construction method and application.
Background technique
Existing research shows missense mutation site tenuin 1 B gene (Filamin B, FLNB) of nonrandomness distribution
It can lead to one group of autosomal dominant inheritance, the skeleton deformity disease secondary to osteodysplasty (bone hypoplasia), wrap
Include Larsen syndrome (Larsen syndrome, LS), Atelosteogenesis (atelosteogenesis, AO), boomerang sample
Atelosteogenesis (boomerang dysplasia, BD).In addition the FLNB gene nonsense mutation of Non-random distribution can cause
A kind of skeleton deformity disease of stealthy heredity, i.e. backbone-wrist-instep synostosis (spondylocarpotarsal
synostosis syndrome,SCT).LS is one end that osteodysplasty degree is minimum in the spectrum of disease, and the then position BD
Highest one end of osteodysplasty degree in the spectrum of disease.The skeleton deformity that LS is shown includes scoliosis, trachelokyphosis
Deformity, carpal bone and shank increase, the dislocation of large joint and before frontal process, eye distance be broadening and nasal bridge etc. is lopsided.BD is
A kind of thanatophoric dysplasia disease, it is characterized in that the depauperation of limbs long bone, centrum and acetabular bone, even above-mentioned bone knot
The defect of structure or completely missing.Backbone-wrist-instep synostosis (spondylocarpotarsal synostosis
Syndrome, SCT, OMIM 272460), typical performance is the fusion in advance of carpal bone or shank and is caused by intervertebral fusion
Spinal growth it is uneven and in turn caused by scoliosis deformity.
According to existing report, FLNB gene mutation includes that long bone growth plate ossification is prolonged to the pathogenic mechanism of skeleton deformity
Late, the transfer ability decline and proliferation, differentiation and the disorder of apoptotic process of cartilage cell of cartilage cell.However, these grind
Study carefully major part all to concentrate on SCT caused by there is the FLNB nonsense mutation of negligible amounts, and it is a fairly large number of for occurring
Disease caused by FLNB gene missense mutation, then study less.
Summary of the invention
The purpose of the present invention is to provide a kind of cell model of the FLNB gene of expression mutation, which is research missense
Disease caused by the FLNB gene of mutation provides Research foundation.
To achieve the above object, present invention firstly provides a kind of cell model of the FLNB gene of expression mutation, features
It is, cell used in the FLNB gene of the expression mutation is ATDC5 cell.
Preferably, the FLNB gene of the mutation include containing mutational site c.4756G > the FLNB gene of A, containing prominent
Displacement point c.512T > G FLNB gene, the mutated gene for leading to osteodysplasty, the bone for causing ossification centre to be merged in advance
The mutated gene of malformation disorders or the mutated gene for leading to congenital scoliosis.
Preferably, the mutation of the FLNB gene different loci, by it to cellular morphology, apoptosis, migration and downstream
Mutual containing between the effects of signal transduction pathway can lead to the ATDC5 cell and generate different skeletal system deformities
Phenotype.The second aspect of the present invention provides the construction method of cell model described above, includes the following steps:
(1) it is expanded after 5 ' end assembling marker gene of FLNB full-length cDNA gene；
(2) by the gene obtained in step (1) carry out site c.4756G > A or site c.512T > rite-directed mutagenesis of G；
(3) mutated gene obtained in step (2) is connected construction of expression vector with carrier；
(4) expression vector for obtaining step (3) imports ATDC5 cell by transfection, obtains surely by screening and identification
Surely the cell model of the FLNB gene of missense mutation is expressed.
Preferably, marker gene described in step (1) is Enhanced green fluorescent protein gene.
Preferably, rite-directed mutagenesis described in step (2) induces rite-directed mutagenesis using PCR.
Preferably, PCR induction the used primer of rite-directed mutagenesis is as follows:
FLNB-G4756A-F:ACAAGACTaGGCGCTATATGATTGGAGTCACC
FLNB-G4756A-R:ATAGCGCCtAGTCTTGTCGGGGATGTAGGTGA
FLNB-T512G-F:AAGACGGCAAAGCCCgGGGAGCCCTGGTAGACAG CT
FLNB-T512G-R:CCGGGCTTTGCCGTCTTGCCAGTTCTGGTTAA。
Preferably, carrier described in step (3) is pCR3.1 (-) carrier.
Preferably, transfection described in step (4) uses jet PRIME transfection reagent.
Another aspect of the invention provides following any application of above-described cell model:
(1) as the application on Larsen syndrome cell model；
(2) as the application on boomerang sample Atelosteogenesis cell model.
Beneficial effects of the present invention are as follows:
For the pathogenesis for studying the mutational site FLNB, selecting a suitable cell model is to carry out cytology and molecule
The prerequisite of biological experiment.The cell experiment part that forefathers carry out about the pathogenesis in FLNB missense mutation site
Mainly carry out in HEK293 cell, it is perhaps related to FLNB plasmid transfection efficiency with higher with the cell.But
HEK293 cell line derives from kidney, and applicant thinks that the cell line can not accurately simulate bone development, therefore right
In the FLNB gene to skeletal system with high degree of specificity, it is a suitable cell membrane that applicant, which thinks the cell line not,
Type.The cell model of the FLNB gene of expression mutation of the invention is based on ATDC5 cell, since ATDC5 cell is one
Cell line with precartilage (prechondrogenic) stem cell properties, therefore FLNB can be showed by ATDC5 cell comprehensively
The high degree of specificity of gene pairs bone tissue, such as the change of cellular morphology, cell migration ability, apoptosis rate, these phenomenons can only be
FLNB is transfectedL171RAnd FLNBG1586RIt is showed in the ATDC5 cell of mutant plasmid, and is transfecting identical mutation plasmid
Performance is had no in the cell of HEK293.Experimental result of the invention sufficiently shows that the physiology of FLNB gene and pathology sexual function have
Therefore significant cell type specificity also explains why FLNB gene only influences skeletal system.
The invention also provides the missense mutation of different loci by it to cellular morphology, apoptosis, migration and the letter in downstream
Mutual containing between the effects of number conduction path, leads to the phenotype of mutually different skeletal system deformity to each other.By turning
Contaminate FLNBL171RAnd FLNBG1586RThe ATDC5 cell of mutant plasmid simulates the entochondrostosis process of two kinds of diseases of BD and LS
The effect that initial phase is FLNB in bone development provides new research direction.
Detailed description of the invention
Fig. 1 is the Western blot result figure in the embodiment of the present invention 1.
Fig. 2 is that FLNB albumen and actin are distributed in endochylema in ATDC5 cell under microscope in the embodiment of the present invention 2
The case where scheme.
FLNB albumen and actin are distributed in endochylema in HEK293 cell under microscope in Fig. 3 embodiment of the present invention 2
The case where scheme.
Fig. 4-A is the Apoptosis streaming figure that the ATDC5 cell of empty carrier is expressed in the embodiment of the present invention 3；Wherein, early stage
Apoptotic cell 8.67%, non-viable apoptotic cell 5.05%.Fig. 4-B is to express FLNB in the embodiment of the present invention 3WTATDC5 cell
Apoptosis streaming figure；Wherein, viable apoptotic cell 7.37%, non-viable apoptotic cell 4.48%.Fig. 4-C is that the present invention is implemented
FLNB is expressed in example 3L171RATDC5 cell Apoptosis streaming figure；Wherein, viable apoptotic cell 18.74%, late apoptic
Cell 25.16%.Fig. 4-D is to express FLNB in the embodiment of the present invention 3G1586RATDC5 cell Apoptosis streaming figure；Its
In, viable apoptotic cell 6.44%, non-viable apoptotic cell 2.76%.Fig. 4-E be the embodiment of the present invention 3 in express empty carrier,
FLNBWT、FLNBL171R(related to BD) and FLNBG1586RThe apoptosis rate of the ATDC5 cell of (related to LS) counts column
Figure.
Fig. 5-A is the Apoptosis streaming figure that the HEK293 cell of empty carrier is expressed in the embodiment of the present invention 3；Wherein, early
Phase apoptotic cell 5.89%, non-viable apoptotic cell 7.71%.Fig. 5-B is to express FLNB in the embodiment of the present invention 3WTHEK293 it is thin
The Apoptosis streaming figure of born of the same parents；Wherein, viable apoptotic cell 4.77%, non-viable apoptotic cell 8.50%.Fig. 5-C is that the present invention is real
It applies in example 3 and expresses FLNBL171RHEK293 cell Apoptosis streaming figure；Wherein, viable apoptotic cell 5.65%, advanced stage wither
Die cell 8.19%.Fig. 5-D is to express FLNB in the embodiment of the present invention 3G1586RHEK293 cell Apoptosis streaming figure；
Wherein, viable apoptotic cell 6.00%, non-viable apoptotic cell 9.43%.Fig. 5-E be the embodiment of the present invention 3 in express empty carrier,
FLNBWT、FLNBL171R(related to BD) and FLNBG1586RThe apoptosis rate of the HEK293 cell of (related to LS) counts column
Figure.
Fig. 6-A is the ATDC5 cell migration figure for expressing empty carrier in the embodiment of the present invention 4 under microscope；Fig. 6-B is this hair
FLNB is expressed under microscope in bright embodiment 4WTATDC5 cell migration figure；Fig. 6-C is under microscope in the embodiment of the present invention 4
Express FLNBL171RATDC5 cell migration figure；Fig. 6-D is to express FLNB under microscope in the embodiment of the present invention 4G1586R's
ATDC5 cell migration figure；Fig. 6-E is to express empty carrier, FLNB in the embodiment of the present invention 4 under microscopeWT、FLNBL171R(with BD
It is related) and FLNBG1586RThe ATDC5 cell migration rate of (related to LS) counts histogram；
Fig. 7-A is the HEK293 cell migration figure for expressing empty carrier in the embodiment of the present invention 4 under microscope；Fig. 7-B is this
FLNB is expressed under microscope in inventive embodiments 4WTHEK293 cell migration figure；Fig. 7-C is microscope in the embodiment of the present invention 4
Lower expression FLNBL171RHEK293 cell migration figure；Fig. 7-D is to express FLNB under microscope in the embodiment of the present invention 4G1586R's
HEK293 cell migration figure；Fig. 7-E is to express empty carrier, FLNB in the embodiment of the present invention 4 under microscopeWT、FLNBL171R(with
BD is related) and FLNBG1586RThe HEK293 cell migration rate of (related to LS) counts histogram；
Fig. 8 A is the Western blot result figure in the embodiment of the present invention 5.Fig. 8 B is that sky is expressed in the embodiment of the present invention 5
Carrier, FLNBWT、FLNBL171R(related to BD) and FLNBG1586RIn the ATDC5 cell of (related to LS), different molecular mark
The expression quantity of object counts histogram.
Specific embodiment
The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..Unless otherwise specified, embodiment
Used in the conventional means that are well known to those skilled in the art of technological means, reagent used can be commercially available.
Test method without specific conditions in embodiment, usually conventional method in that art.
Main experimental materials, instrument and the reagent that the present invention uses:
Main material:
FLNB gene of the invention is known, the reference sequences number of full-length cDNA are as follows: NM_001457.3；
The construction method for the wild type FLNB plasmid that the present invention uses is shown in document (Daniel PB, Morgan T, Alanay
Y,Bijlsma E,Cho TJ,Cole T,Collins F,David A,Devriendt K,Faivre L,Ikegawa S,
Jacquemont S,Jesic M,Krakow D,Liebrecht D,Maitz S,Marlin S, Morin G,Nishikubo
T,Nishimura G,Prescott T,Scarano G,Shafeghati Y, Skovby F,Tsutsumi S,
Whiteford M,Zenker M and Robertson SP. Disease-associated mutations in the
actin-binding domain of filamin B cause cytoplasmic focal accumulations
correlating with disease severity.Hum Mutat 2012；33:665-673.)；
HEK293 cell is purchased from US mode from Beijing consonance cell resource center (CRC/PUMC) purchase, ATDC5 cell
Culture Collection (ATCC).HEK293 and ATDC5 cell is all in (the fetal bovine containing 10% fetal calf serum
Serum, FBS) it cultivates in DMEM culture solution, the temperature of culture environment is 37 DEG C, 5%CO2.Before transfection, more by culture solution
It is changed to the culture solution of antibiotic-free；
PCR3.1 (-) carrier (Invitrogen, Carlsbad, CA).
Key instrument:
Confocal immunofluorescence microscopy microscope (Japan Olympus)；
Flow cytometer (Beckman Coulter (Cytomics FC 500).
Main agents:
Jet PRIME transfection reagent (Polyplus)；
Lipofectamine RNAiMAX transfection reagent (USA, Invitrogen Company)；
Enhance chemiluminescence (enhanced chemiluminescence, ECL) kit (Millipore)；
Antibody used in Western blot:
Anti-FLNB (UK, Abcam)；
anti-Runx2(1:1000；Cat No.ab23981, Abcam), anti-pSmad3 (phosphorylation site T179)
(1:500；Cat No.ab193297, Abcam), anti-pSmad3 (phosphorylation site: S423+ S425) (1:1000；cat
No.ab52903,Abcam),anti-Smad3(1:3000；cat No.ab75512, Abcam),and anti-GAPDH(1:
1000；cat No.sc-25778,Santa Cruz)；
Anti- rabbit igg (1:1000；Cat No.14708, CST) or anti-mouse IgG (1:1000；cat No. 14079,
CST)。
Hoechst reagent (Germany, AG Company)；
Phalloidine (Phalloidin, USA, Invitrogen Company).
1 plasmid construction of embodiment and transfection
One, plasmid construction
EGFP (enhanced is assembled by conventional gene recombinant technique at 5 ' ends of FLNB full-length cDNA
Green fluorescence protein, EGFP), and assembled gene is inserted on pCR3.1 (-) carrier and is expressed.It is right
The relevant mutational site LS (Larsen syndrome) c.4756G > A (p.Gly1586Arg) and BD (boomerang sample dysosteogenesis
Disease) relevant mutational site c.512T > G (p.Leu171Arg) by positive and reverse primer realizes that PCR is mutated to be formed
(mutagenesis) to realize single nucleotide mutation.
Specific mutation method is as follows:
1, mutant primer is separately designed using methods of homologous recombination
FLNB-G4756A-F:ACAAGACTaGGCGCTATATGATTGGAGTCACC (SEQ ID NO.1)
FLNB-G4756A-R:ATAGCGCCtAGTCTTGTCGGGGATGTAGGTGA (SEQ ID NO.2)
FLNB-T512G-F:AAGACGGCAAAGCCCgGGGAGCCCTGGTAGACAG CT(SEQ ID NO.3)
FLNB-T512G-R:CcGGGCTTTGCCGTCTTGCCAGTTCTGGTTAA(SEQ ID NO.4)
2, PCR amplification
Respectively with 2 pairs of primer amplification FLNB wild plasmids, amplification system and condition are.
It is expanded with Dongyang spinning company KOD-NEO-PLUS amplification kit, system condition is as follows:
PCR condition is as follows:
Reaction system: 10 × KOD Buffer:5 μ l；DNTP:5 μ l；MgSO4: 3 μ l；KOD-NEO-PLUS:1 μ l；FLNB
Template plasmid: 0.1 μ l；FLNB- mutant primer F:1.5 μ l；FLNB- mutant primer R:1.5 μ l；ddH2O:32.9 μ l；It amounts to:
50μl。
Reaction condition:
94 DEG C, initial denaturation 2min, a circulation；98 DEG C, it is denaturalized 10s；58 DEG C, anneal 30s；68 DEG C, extend 420s, 30
Circulation.
Above-mentioned PCR product is separately recovered in 1% Ago-Gel.
3, it recombining reaction and converts
3.1 recombination systems
PCR product after mutation: 1 μ l；2 × recombination Buffer:5 μ l；ddH2O:4 μ l；Amount to 10 μ l.
55 DEG C of successive reaction 30min after mixing.After reaction immediately by recombining reaction liquid ice bath 5min.
3.2 conversion
50 μ l ToP10 competent cells are added in the product recombinated, mix 42 DEG C of heat shock 60s, ice-water bath 120s,
The mixture converted is equably coated in the LB plate containing ammonia benzyl resistance and is incubated overnight for 37 DEG C.
The screening of 3.3 positive colonies and identification
Picking monoclonal carries out PCR identification reaction.
Identify primer:
FLNB-CX-2F:GCTGGGGACACTATTCCTAAGA (SEQ ID NO.5)
FLNB-CX-2R:CCCTGTTTTCCAGCCCATTGAG (SEQ ID NO.6)
3.4 by positive colony send to Beijing Qing Ke company be sequenced display FLNB wild plasmid be mutated successfully.
Two, cell is transfected
Using jet PRIME transfection reagent (Polyplus), illustrate according to reagent, by empty carrier, wild type FLNB plasmid,
Containing mutational site c.4756G > plasmid of the FLNB of A (p.Gly1586Arg) and containing mutational site c.512T > G
(p.Leu171Arg) plasmid of FLNB is transfected respectively into ATDC5 cell.
Using Lipofectamine RNAiMAX transfection reagent (USA, Invitrogen Company), said according to reagent
It is bright, above-mentioned plasmid is transfected respectively into HEK293 cell.Cell is collected after 48 hours.
Part cell is taken, total protein is extracted and carries out the intracellular correlative protein expression situation of Western blot verifying,
Specific step is as follows by Western blot:
After transfection 48 hours, vitellophag simultaneously prepares single cell suspension, after centrifugation, reject supernatant, again with PBS liquid
It dispels.Under the protection of phosphorglase inhibitor and protease inhibitors, RIPA buffer (China, Beijing are used
Solarbio cell) is decomposed, with 8,000rpm revolving speed centrifugation 15min after 4 DEG C of maintenances 30min.Use protein quantification kit
(BCA, China, Beijing Solarbio) quantifies the protein of cracking, and the albumen (12 μ g) of equivalent is in 12% gel
(SDS-PAGE) it is separated by electrophoresis in, and goes to polyvinylidene fluoride (polyvinylidene fluoride, PVDF) film
On.In TBST (Tris-buffered saline-Tween), closing 1 hour is carried out to pvdf membrane using 5% milk, then
Hatching is softly rocked in diluted 3% primary antibody of BSA/TBST, maintains 4 DEG C to stay overnight.Secondary daily PBS liquid cleans three times, in room temperature
It is middle that 1h is hatched to pvdf membrane with secondary antibody, then with enhancing chemiluminescence (enhanced chemiluminescence, ECL) reagent
Box and robotics fluorescence exposure system (Tanon 4200) detect target protein.Use Image-J software
(https: //imagej.nih.gov/ij/) quantifies protein band intensity gray values.It tests in triplicate, and uses t-
It examines and carries out comparison among groups.
Antibody used in the Western blot of the present embodiment:
Primary antibody: Anti-FLNB (UK, Abcam).
Secondary antibody: anti-rabbit igg (1:1000；Cat No.14708, CST) or anti-mouse IgG (1:1000；cat No.
14079,CST)。
As can be seen from Figure 1 expression of the various transfected plasmids in cell.Blank: not turning any plasmid, only adds
Transfection reagent；WT: transfection includes the plasmid (pCR-FLNB of wild type FLNB geneWT- EGFP plasmid)；Mut1: transfection includes
C.512T the plasmid of the mutational site > G (p.Leu171Arg) FLNB gene, (pCR-FLNBL171R- EGFP plasmid)；Mut2: transfection
Plasmid comprising the mutational site c.4756G > A (p.Gly1586Arg) FLNB gene, (pCR-FLNBG1586R- EGFP plasmid)；
Marker:NEB-protein ladder (P7711S)；By albumen size, (FLNB-EGFP size is more than 240kDa, and GAPDH is big
Small is 37kDa) film is cut into two pieces, it closes off, the colour developing of primary antibody secondary antibody.
2 immunofluorescence of embodiment and PHOTOGRAPHIC ANALYSIS FLNB mutain form and distribution
Using the cell 5min after being transfected in the fixed embodiment 1 of 4% paraformaldehyde, then cleaned using PBS liquid, and
Dyeing 30min is carried out to nucleus using the Hoechst reagent (Germany, AG Company) of 0.5 μ g/ml.Use Phallus ring
Peptide (Phalloidin, USA, Invitrogen Company) dyes actin (actin) cytoskeleton.Using exempting from
Epidemic disease confocal microscope (Japan Olympus) observes cell.Hoechst is dyed using the path UV of 20ms and is exposed,
EGFP is exposed using the laser of wavelength 488nm, duration 100ms, using wavelength 590nm, duration 1s laser to ghost
Cyclic peptide is exposed.
It is distributed in endochylema using FLNB albumen in the micro- sem observation ATDC5 cell of confocal immunofluorescence microscopy and actin
The case where (see Fig. 2).Nucleus is dyed with Hoechst and is marked.In FLNBWTIn the cell of plasmid transfection, enhancing green is glimmering
The FLNB albumen of photoprotein (EGFP) label is evenly distributed in cytoplasm, distribution situation and actin cytoskeleton
(being marked using phalloidine) is consistent.In the relevant FLNB of BDL171RIn the ATDC5 cell of mutant plasmid transfection, it can be observed that
There is spherical clustering phenomena in the same position of FLNB mutain and actin in endochylema.In the relevant FLNB of LSG1586R
In the ATDC5 cell of mutant plasmid transfection, the clustering phenomena of apparent FLNB albumen and actin is not found.
Divided in endochylema using FLNB albumen in the micro- sem observation HEK293 cell of confocal immunofluorescence microscopy and actin
The case where cloth (see Fig. 3).Observe that FLNB albumen and actin are combined and agglomerated in endochylema.Nucleus is contaminated with Hoechst
Color marker.In expression FLNBWTAnd FLNBG1586RIn the HEK293 cell of (related to LS), marked with green fluorescent protein (EGFP)
The FLNB albumen of note is evenly distributed in endochylema, shows fine reticular structure, and with actin cytoskeleton (Phallus
Cyclic peptide label) distribution is unanimously.Express FLNBG1586RThe HEK293 cell of mutain is to show substantially changeing for cellular morphology.
However, in expression FLNBL171RIn the HEK293 cell of (related to BD) mutain, the conglobulation of FLNB albumen is observed.
In the application, WT:wild type, wild type；BD:boomerang dysplasia, boomerang sample bone development is not
It is good；LS:Larsen syndrome, Larsen syndrome.It is not repeated to describe below.
It can be seen that according to the result of the present embodiment and express FLNBWTThe ATDC5 cell of albumen is compared, expression
FLNBL171RAnd FLNBG1586RThe ATDC5 cells show of albumen is the change of apparent cellular morphology.Express FLNBL171RAlbumen
ATDC5 cells show is being obviously reduced for cell volume, and plate foot (lamellipodia) disappears, this may be attributed to
FLNBL171RWith the spherical damage for agglomerating caused actin cytoskeleton of actin.The amino acid in the 171st site of FLNB albumen
In actin-binding domains domain (ABD).By internal (in vivo) and external (in vitro) experiment, existing research shows
The missense mutation in the region FLNB albumin A BD causes FLNB to enhance the binding force of actin.Actin cytoskeleton albumen is to thin
Born of the same parents' structure provides mechanical support, plays an important role during maintaining cellular morphology, plays decision to the survival of most cells
Property effect.Express FLNBG1586RThere are not significant changes in cellular morphology in the ATDC5 cell of albumen, illustrates that its is intracytoplasmic
Actin structure changes little.The amino acid in the 1586th site of FLNB albumen is close to the region Hinge-1.Tenuin
The region Hinge-1, which is one, has certain flexible structural domain, connects two important functional domains in tenuin, is struck
Except the mechanical sensing characteristics of changeable tenuin.Express FLNBG1586RThe morphological change of the ATDC5 cell of albumen may return
Because the character of the structure near Hinge-1 changes, rather than because FLNBG1586RAffinity changes between albumen and actin
Become.The structural domain in the downstream Hinge-1 is related to the change of Mechanics of Machinery and signal transduction in the studies have shown that FLNA albumen of forefathers.
Therefore, applicant thinks that the Hinge-1 structure of FLNB albumen has the characteristic of Mechanics of Machinery, its change can also change downstream letter
Number conduction path.
In short, FLNBL171RActin cytoskeleton caused by albumen changes and FLNBG1586RDownstream signal caused by albumen passes
The change of guiding path all may be the reason of cellular morphology changes during leading to entochondrostosis, they may also lead to carefully
The change of the transfer ability and apoptosis rate of born of the same parents.
3 Transfected cells apoptosis of embodiment and apoptosis rate statistics
Using the cell after transfecting 48 hours in embodiment 1, vortex oscillation 5s prepares single cell suspension, and 1mg/mL is added
Hoechst reagent, maintain 37 DEG C of water-bath 7min, carry out nuclear targeting.Subsequent cooled on ice single cell suspension, and be centrifuged,
Cell precipitation is dispelled again with PBS liquid after reject supernatant.Single cell suspension is configured at 5mg/mL propidium iodide
(Propidium Iodide, PI, China, Best-reagent Company), maintains 37 DEG C of water-bath 7min, continues thin
Karyon dyeing.Subsequent cooled on ice single cell suspension, and be centrifuged, cell precipitation is dispelled again with PBS liquid after reject supernatant,
On flow cytometer (Beckman Coulter (Cytomics FC 500)), indigo plant of the wavelength between 400-500nm is captured
The red fluorescence that color fluorescence and wavelength are 630nm.The nucleus of Hoechst dyeing represents the cell of early apoptosis, PI dyeing
Nucleus represents the cell of late apoptic.
Express FLNBL171RThe ATDC5 cell of mutain (related to BD), with expression empty carrier (Fig. 4-A), FLNBWT
(Fig. 4-B) and FLNBG1586RThe ATDC5 cell of mutain (with LS correlation) (Fig. 4-D) is compared, and show as significantly increasing withers
Die rate (Fig. 4-C).
Empty carrier (Fig. 5-A), FLNB are expressed respectivelyWT(Fig. 5-B), FLNBL171R(related to BD) (Fig. 5-C) and
FLNBG1586RBetween the apoptosis rate of the cell of (related to LS) (Fig. 5-D) and no significant difference.
FLNBL171RThe ATDC5 apoptosis rate of mutant plasmid transfection significantly increases, either early apoptosis rate or evening
Phase apoptosis rate is all significantly higher than with empty carrier, FLNBWTAnd FLNBG1586RThe ATDC5 cell of transfection.On the other hand, empty carrier,
FLNBWT、FLNBL171RAnd FLNBG1586RThe HEK293 cell of any one transfection does not all occur significant apoptosis rate and changes.It is (real
It tests and is repeated 3 times, p value compares calculating (t inspection) according to every group of data with the data of empty carrier).
Table 1: empty carrier, FLNB are used respectivelyWT、FLNBL171RAnd FLNBG1586RThe ATDC5 cell and HEK293 of plasmid transfection
The apoptosis ratio of cell
All numerical value are compared with empty plasmid (Empty vector) group.Ns: no difference of science of statistics (not
significant)；Value < 0.001 *: p- *；Value < 0.01 *: p-；*: p-value < 0.05.Error line (Error bars) generation
Table standard deviation (standard deviation, SD).
Result according to the present invention is it is inferred that the phenotypic difference between two kinds of diseases of LS and BD is mainly due in cartilage
The apoptosis rate difference of the cartilage cell of skeletonization.Actin cytoskeleton plays decisive role to the survival of cell.Express FLNBL171R
The ATDC5 apoptosis rate of albumen significantly increases, and with the damage of actin cytoskeleton, and expresses FLNBG1586RAlbumen
The apoptosis rate of ATDC5 cell is without substantially changeing, with its intracytoplasmic actin cytoskeleton by being influenced smaller be consistent.
Applicant thinks that exactly excessive Apoptosis results in FLNBL171RThere is the missing of long bone in caused BD patient.It is dynamic in vertebra
In object, bone growth and development including long bone and vertebrae is carried out by entochondrostosis, and this process is after filling
The differentiation and mineralising for gathering cartilage cell of matter stem cell.The mescenchymal stem cell of aggregation can be divided into cartilage cell.One
There is mineralising in denier extracellular matrix (ECM) and cartilage cell enters the terminal loose phase, and apoptosis, cartilage knot occurs in cartilage cell
Structure also transitions into bone structure.In any one of entochondrostosis in stage, the apoptosis of cartilage cell receive interference can all influence it is soft
Skeletonization in bone.Forefathers researches show that in the bis- knockout (FLNB of FLNB-/-) mouse in, the apoptosis of cartilage cell occurs significant
Increase, however, such animal model is the SCT in simulation autosomal dominant inheritance, shows the clinic opposite with BD
Phenotype.ATDC5 cell without induction, with the characteristic of mescenchymal stem cell before aggregation.Therefore, FLNB is expressedL171RIt is prominent
There is this phenomenon that apoptosis rate significantly increases in the white ATDC5 cell of a kink of preserved egg, and applicant is made to have reason to consider what BD patient occurred
Lethal skeleton development is low or a large amount of apoptosis of ossification centre's missing of long bone and mescenchymal stem cell in cartilage growth plate into
And interfere ossification centre's ossification related.In expression FLNBG1586RIn the ATDC5 cell of mutain, does not observe and significantly change
Apoptosis rate.This experimental result and FLNBG1586RThe clinical phenotypes of relevant LS match, i.e. the bone system of LS patient
The severity of system Underdevelopment is far below BD patient.
The migration of 4 Transfected cells of embodiment and mobility statistics
Using the cell after transfecting 48 hours in embodiment 1, vitellophag simultaneously prepares single cell suspension, after centrifugation, reject
Supernatant is dispelled again with PBS liquid, is chosen wherein 40,000 (100 μ l) cell and is added to transwell (USA, Corning
Company upper chamber), 600 μ l of addition contain the DMEM culture solution of 10% fetal calf serum to lower room.37 DEG C, 5%CO2Under environment
After standing 24 hours, cell is fixed with 4% paraformaldehyde, and softly strike off ventricular cell, DAPI dye is carried out to lower ventricular cell
Color.Under fluorescence microscope, 4 visuals field are randomly selected to each cell using 20 × light microscopic.Using Image-J software to each
The visual field carries out cell count, and each cell is tested in triplicate, and carries out comparison among groups with t- inspection.
With expression empty carrier (Fig. 6-A), FLNBWT(Fig. 6-B) and FLNBL171RThe ATDC5 of (related to BD) (Fig. 6-C) is thin
Cell phase ratio expresses FLNBG1586RThe ATDC5 cells show of mutain (related to LS) (Fig. 6-D) is cell migration ability
It is decreased obviously.
In transfection empty carrier (Fig. 7-A), FLNBWT(Fig. 7-B), FLNBL171R(Fig. 7-C) (related to BD) and FLNBG1586R
In (Fig. 7-D) (related to LS) between any HEK293 cell, there is not significantly changing for cell migration ability.
Table 2: empty carrier, FLNB are used respectivelyWT、FLNBL171RAnd FLNBG1586RThe ATDC5 cell migration ability of plasmid transfection
Data statistics (number of cells passed through with same field of view calculates.Experiment is repeated 3 times, and p value is according to every group of data and empty carrier
Data compare calculating.(t inspection))
All numerical value are compared with empty plasmid (Empty vector) group.Ns: no difference of science of statistics (not
significant)；Value < 0.001 *: p- *；Value < 0.01 *: p-；*: p-value < 0.05.Error line (Error bars) generation
Table standard deviation (standard deviation, SD).
Table 3: empty carrier, FLNB are used respectivelyWT、FLNBL171RAnd FLNBG1586RThe HEK293 cell migration energy of plasmid transfection
The data statistics of power (is calculated with the number of cells that same field of view passes through.Experiment is repeated 3 times, and p value is according to every group of data and empty carrier
Data compare calculating.(t inspection))
All numerical value are compared with empty plasmid (Empty vector) group.Ns: no difference of science of statistics (not
significant)；Value < 0.001 *: p- *；Value < 0.01 *: p-；*: p-value < 0.05.Error line (Error bars) generation
Table standard deviation (standard deviation, SD).
Embodiment 5 detects the significant molecule in ossific process
The cell after transfecting 48 hours in section Example 1 is taken, (implementation is shown in concrete operations using Western blot technology
Example 1) detection ossific process in significant molecule.
The expression of different albumen is using glyceraldehyde phosphate dehydrogenase (GAPDH) as internal reference.The expression quantity of Runx2 exists
Express FLNBL171RAnd FLNBG1586RSignificantly raised (see Fig. 8-A and Fig. 8-B) is all shown in the ATDC5 cell of mutain.
The Smad3 (phosphorylation site: T179 and S423/S425) of phosphorylation is in expression FLNBL171RAnd FLNBG1586RMutation
It is all increased in the ATDC5 cell of albumen, and the expression quantity of Smad3 and expression FLNBWTATDC5 cell in Smad3 table
Up to amount no significant difference (see Fig. 8-A and Fig. 8-B).
In the present embodiment, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, glyceraldehyde phosphate
Dehydrogenase.
Antibody used in the Western blot of the present embodiment:
Primary antibody: anti-Runx2 (1:1000；Cat No.ab23981, Abcam), anti-pSmad3 (phosphorylation site
T179)(1:500；Cat No.ab193297, Abcam), anti-pSmad3 (phosphorylation site: S423+S425) (1:1000；
cat No.ab52903,Abcam),anti-Smad3(1:3000；cat No. ab75512,Abcam),and anti-GAPDH
(1:1000；catNo.sc-25778,Santa Cruz).
Secondary antibody: anti-rabbit igg (1:1000；CatNo.14708, CST) or anti-mouse IgG (1:1000；cat No. 14079,
CST)。
Table 4: FLNB is used respectivelyWT、FLNBL171RAnd FLNBG1586RIn the ATDC5 cell of plasmid transfection, Smad3, phosphorylation
The expression quantity of Smad3 and Runx2 (calculates the gray value of each band by Image J software.Experiment is repeated 3 times, and p value is according to every
Group data compare calculating with the data of empty carrier.(t inspection))
All numerical value are compared with empty plasmid (Empty vector) group.Ns: no difference of science of statistics (not
significant)；Value < 0.001 *: p- *；Value < 0.01 *: p-；*: p-value < 0.05.Error line (Error bars) generation
Table standard deviation (standard deviation, SD).
The clinical phenotypes of embodiment 6LS and BD case compare
One, peripheral blood full-length genome (whole exome) DNA is extracted
One 8 years old LS male patient to our hospital is included into this research.By to he or she and kinsfolk
Detailed interrogation, physical examination and to there may be the position of bone and joint deformity carry out imageological examination.The disease incidence of BD is much
Disease incidence lower than LS, and most of BD patient is in foetal period and non-neonate, that is, dead.Our hospital's case system is retrieved, not
It was found that once there are the confirmed cases of BD, thus c.T512G related to BD disease and that the number that is reported is most are selected
(p.Leu171Arg) goals research gene of the mutational site as the application research.
The informed consent form of gene sequencing is signed with patient and its kinsfolk.With Puregene Blood kit from trouble
Sample is extracted in the peripheric venous blood of person and its father, mother and elder sister.This research obtains BJ Union Hospital ethics committee member
The audit approval of meeting.
Using Puregene Blood kit kit (GentraSystems, Inc., Minneapolis, MN) from patient
And its genomic DNA is extracted in the peripheric venous blood of father, mother and elder sister.
(1) 1mL is passed through and is added in the blood of EDTA (0.01M, China, Huamei Bioengineer) anticoagulation
1mL CL cell pyrolysis liquid is gently mixed by inversion 6 times, is centrifuged 5min, reject supernatant with the revolving speed of 3600rpm；
(2) it as pouring into 1mL CL cell pyrolysis liquid in centrifuge tube again, is gently mixed by inversion 6 times, with turning for 3600rpm
Speed centrifugation 5min, reject supernatant；Under the premise of ensuring that precipitating is retained in pipe, centrifuge tube is upside down on clean blotting paper
Stand 2min；
(3) mixed liquor of Proteinase K and buffer FG is configured；
(4) mixed liquor of 500uL Proteinase K and buffer FG is added, is mixed immediately to solution without agglomerate；
(5) 65 DEG C of water-bath 30min, are during which mixed by inversion for several times；
(6) 1mL isopropanol is added, is mixed by inversion immediately to there is tufted or Filamentous genomic DNA；
(7) 8min, reject supernatant are centrifuged with the revolving speed of 3600rpm；It, will be under the premise of ensuring to precipitate and being retained in pipe
Heart pipe is upside down on clean blotting paper and stands 2min；
(8) 1mL70% ethyl alcohol is added, vibrates 5sec, is centrifuged 3min, reject supernatant with the revolving speed of 3600rpm；
(9) step (8) are repeated；
(10) under the premise of ensuring that precipitating is retained in pipe, centrifuge tube is upside down on clean blotting paper and stands 5min；
(11) it under normal temperature state, is air-dried gene group DNA and is precipitated to all liq and volatilize (at least 5min) completely
5sec is vibrated, is centrifuged 3min, reject supernatant with the revolving speed of 3600rpm；
(12) 200 μ LTB buffers are added, low speed vortex vibrates 5sec, during which 65 DEG C of heating water bath 1h flick hydrotropy number
It is secondary；
(13) extracted genomic DNA concentration and purity are identified using NanoDrop ND8000 (THERMO, USA).It is dense
> 30ng/ μ L, 1.8 < OD260/OD280 < 2.0 are spent, and the genomic DNA sample of 3 μ g of total amount > is considered as qualification, is stored in-
80 DEG C of refrigerator is spare；
Two, full sequencing of extron group and Sanger sequencing analysis
1, full sequencing of extron group:
Genomic DNA is sent to plain code scientific & technical corporation and carries out full exon sequencing, using Agilent SureSelect
Human All Exon V5 kit, Illumina TruSeq Rapid PE Cluster and SBS kit carry out complete outer
Aobvious subregion capture, and surveyed by Illumina HiSeq2000/2500 platform (Illumina, San Diego, CA)
Sequence.
2, data secondary analysis process:
(1) it reads sentence and passes through BWA software (Version:0.7.5a-r405) and UCSChg19 (UCSC human genome
Reference assembly 19) it is compared with reference to genome；
(2) comparison result is merged into a ban file, and using Picard (Version:1.55) software removal PCR weight
Complex sequences then carries out downstream data analysis；
(3) variation reading is carried out using GATK software (Version:v2.3-9)；
(4) it variation annotation and screening process: is infused using the process of plain code scientific & technical corporation (WuXi NextCODE) exploitation
Release variation.In addition, obtaining the sequencing depth of each base from all gene order-checkings.Using VEP software (Variant
Effect Predictor, Ensembl 73) variation is annotated.Wherein, the change of functional code area and splice site
Different to enter analysis in next step, mainly missing/insertion including non-frameshit, missense mutation and afunction form variation (obtain eventually
The only mutation, frameshift mutation of codon and crucial splice site mutation).Use ClinVar, OMIN and HGMD etc. three main receipts
The database of known or doubtful pathogenic mutation is recorded, to screen known pathogenic mutation；Take multiple types of tools prediction missense prominent simultaneously
The function of change and the annotation of non-coding regulatory sequences；It is cooperated using thousand human genomes sequencing plan, exon sequencing data set
Large scale sequencing database of five, group, sequencing of extron group plan, Holland and the Tokyo etc. based on crowd, to exclude in normal person
With the variation of upper frequency in group.
Sequencing result is interpreted: the clinical sequences analysis each sequencing of software evaluation developed and verified using plain code scientific & technical corporation
As a result the variation in, and " sequence variations interpret standard and guide " according to United States Medicine science of heredity and the publication of genomics association
Classify to each variation.Sequencing variation uses HGVS nomenclature.
3, pathogenic assessment:
(1) the new hair variation (De Novo varients) of assessment is pathogenic: the code area and montage position of screening function
The variation of point, mainly missing/insertion including non-frameshit, missense mutation and afunction form variation (obtain terminator codon
Mutation, frameshift mutation and crucial splice site mutation) etc.；In ExAC, there cannot be frequency in 1000G and ESP6500 database
Rate or mutational site number (allele count) are less than 4；The authenticity for newly sending out mutation is tentatively judged by IGV or pileup；
The pathogenic of mutational site is assessed in SIFT, Mutation Taster and Polyphen2 software, three softwares are high cause
The variation of characteristic of disease is considered as disease cause mutation site；Use conservative of the Alamut software evaluation mutational site in different plant species.
(2) the homozygous variation (homozygous variants) of assessment and compound heterozygous variance (compound
Heterozygous variants) it is pathogenic.
Compound heterozygous variance is judged whether there is by IGV or pileup.
Less than 0.3% and homozygous mutation site is not present in frequency in 1000G, ExAC and ESP6500 database.
Pathogenic, three softwares of variant sites are assessed in Mutation Taster, Polyphen2 and SIFT software
It is that highly pathogenic variation is considered as disease cause mutation site；
Use conservative of the Alamut software evaluation mutational site in different plant species.
Text is carried out to all highly pathogenic mutation filtered out in GeneCards, PubMed and OMIN public database
Offer review and function retrieval, clearly make a variation whether complex inheritance model.
4, Sanger PCR sequencing PCR verifies full sequencing of extron group result.
(1) design of primers
1) base sequence of FLNB gene is imported into Primer5 software, is set within the scope of the upstream and downstream 50bp in verifying site
Count primer；
2) best primer is selected to carry out subsequent PCR verifying；
(2) PCR amplification
PCR reaction system:
According to above-mentioned PCR reaction system, the mixed system prepared is dispensed into 96 orifice plates, liquid relief carefully covers sealing plate
Film prevents from evaporating during PCR；According to following table, PCR response procedures are set.
PCR response procedures:
After reaction, 1% Ago-Gel is configured, 2uL buffer+1uLPCR product is drawn, in voltage 110V, electric current
Electrophoresis 40 minutes under conditions of 75mA.PCR amplification result is then observed in the UV lamp.As band is clear, and clip size with
It is expected that being consistent, being considered as qualification and carrying out Sanger sequencing.
(3) Sanger is sequenced
PCR product send Beijing Huada gene company to carry out purifying and Sanger sequencing.
(4) sequencing peak figure is interpreted
Sanger sequencing sequence is interpreted using CodonCode Aligner8.0.1 software.
Three, clinical phenotypes compare
It is included in 8 years old boy of the LS case of this research, physical examination shows it, and (eye distance is broadening with typical facial deformity
And nasal bridge), left side torticollis, thumb is He Hallux toe distal end finger joint is broadening, bilateral elbow joint Varus deformity.Its family history shows father
Parent, uncle, grandfather and great grandfather appear similar to the above-mentioned characteristic facial deformity of patient, thumb He Hallux toe distal end finger joint
Broadening, bilateral elbow joint Varus deformity.Hand and wrist joint X piece display the carpal bone ossification centre of patient increases and bilateral thumb distal end
Finger joint is broadening.Full backbone anterioposterior and lateral film shows that there are 60 ° of kyphosis deformities for cervical vertebra from the 2nd to the 6th, and there are serious scoliosis
Deformity, upper curved 85 ° of the angle Cobb of chest, main curved 125 ° of the angle Cobb of chest.We carry out patient, father patient, mother and its elder sister complete
Sequencing of extron group detects a FLNB gene missense mutation site (NM_ in patient and its father's DNA sample
001457.3, c.4756G > A (p.Gly1586Arg)) and isolated with the phenotype of Larsen syndrome in dominant, further
Sanger PCR sequencing PCR demonstrates this mutational site.Applicant has used three mutation harmfulness forecasting tools, analyzes the mutation
Harmfulness, obtain a result are as follows: SIFT show that this sports " tolerated " (SIFT scoring 0.46), Mutation Taster
Show that this sports " disease causing " (p value 0.9999)；PolyPhen-2 show that this sports " probably
Damaging " (scoring is 1.000).1586 amino acids of FLNB have very strong conservative between species.In conjunction with clinical and
The performance of gene level, we specify the diagnosis of the Larsen syndrome of patient.In addition to this research report LS case it
Outside, there is another forefathers report the LS case of identical mutation site to be also included into comparative study (being shown in Table 5).
In table 5, case 1 is the propositus in the LS family of this research report, and same mutational site is reported in forefathers
Detection is determining in the case 2 in road (case 2 is shown in Krakow D, Robertson SP, King LM, Morgan T, Sebald ET,
Bertolotto C,Wachsmann-Hogiu S,Acuna D,Shapiro SS,Takafuta T,Aftimos S,Kim
CA,Firth H,Steiner CE,Cormier-Daire V, Superti-Furga A,Bonafe L,Graham JM,
Jr.,Grix A,Bacino CA,Allanson J, Bialer MG,Lachman RS,Rimoin DL and Cohn
DH.Mutations in the gene encoding filamin B disrupt vertebral segmentation,
joint formation and skeletogenesis.Nat Genet 2004；36:405-410.).Case 3 is before one
The BD case of people's report is that (case 3 is shown in Bicknell LS, Morgan T, Bonafe for male's prematurity of fetus an of dead
L,Wessels MW,Bialer MG,Willems PJ,Cohn DH,Krakow D and Robertson SP.
Mutations in FLNB cause boomerang dysplasia.J Med Genet2005；42:e43.).
In the present embodiment ,+, it is positive；, negative.
The disease phenotype of 5 case 1-3 of table counts
1 it can be seen that the FLNB mutain of different loci in conjunction with the embodiments and cause in LS disease to the result of embodiment 6
Ossification centre increase the Molecular Biology Mechanism that the phenotype that both are completely contradicted is reduced with ossification centre in BD disease, may
The mutual system between mescenchymal stem cell apoptosis, migration and the expression variation of Runx2 albumen of phase is originated by entochondrostosis
Weighing apparatus is realized.Runx2, once referred to as core-binding factor (CBF), played a significant role during bon e formation.?
In LS, Runx2's increases the aggregation that may promote mescenchymal stem cell, and the decline of cell migration ability gathers with the cell increased
Collection can lead to increasing for ossification centre together.In BD, although the expression of Runx2 is also increased, significantly more cell
Apoptosis rate inhibits Runx2 to the facilitation of cell aggregation, therefore the reduction for resulting in ossification centre even lacks.
According to existing research, for normal cell, Smad3 can be combined with FLNB albumen, and then FLNB albumen hinders
The only phosphorylation of Smad3 albumen.However, free property Smad3 albumen can be phosphorylated, more phosphorylation Smad3 albumen can
Protein complexes are formed into nucleus and HDAC4 albumen and Runx2.In this case, the activity of Runx2 is by HDAC4 egg
It is white to be inhibited.In the research of applicant, the expression quantity of phosphorylation Smad3 is significantly raised, and Smad3 Tot Prot remains normal
It is horizontal.Although this shows that the expression quantity of Runx2 increases, the phosphorylation Smad3 albumen that activity may still be increased inhibits,
And then entochondrostosis process is caused to be suppressed.
On the other hand, in entire accumulation process until soft when ATDC5 cell aggregation is at cartilage tubercle in existing research
The terminal section of osteocyte maturation, the expression quantity of Runx2 maintain higher level always；And work as dominant (dominant
Negative Runx2) is imported into the cell, the aggregation and a series of secondary Proliferation, Differentiation processes of undifferentiated ATDC5 cell
All it is inhibited.Existing research is it has also been found that BMP-4 albumen it is existing can to remedy this inhibition by the expression quantity of raising Runx2
As.It can be seen that Runx2 plays a significant role in chondrogenetic adjusting.
Further, apoptosis rate may generate reciprocation with the signaling pathway molecule in other downstreams, and then cause
Increasingly complex clinical phenotypes in LS and BD patient.The expression quantity of Runx2 is in expression FLNB in the applicationL171RAnd FLNBG1586RIt is prominent
Up-regulation trend is shown as in the white ATDC5 cell of a kink of preserved egg, this Runx2 reported with forefathers can enhance the conclusion of entochondrostosis
It is conflicting.It shows according to another report, is reduced in endochylema with the FLNB protein quantity of Smad3 combination, can increase free Smad3's
Phosphorylation, and then the Smad3 of phosphorylation passes through the inhibition site of competition Runx2, so as to cause the activity of Runx2 in nucleus
Increase.In this application, the expression quantity of Runx2 and phosphorylation Smad3 increase prompt FLNB in ATDC5 cellL171RWith
FLNBG1586RIt potentially reduces and the combination of Smad3.Runx2 expression quantity, which is reduced, to inhibit ATDC5 thin by PI3K-Akt approach
The aggregation of born of the same parents, sees in turn, in expression FLNBL171RAnd FLNBG1586RIn the ATDC5 cell of mutain, the expression quantity of Runx2
Increase, the aggtegation of ATDC5 may be increased.Consider from this point, expresses FLNBG1586RWrist in the LS patient of mutain
Bone, shank ossification centre increase, may be by embryonic development period, and the aggregation enhancing of mescenchymal stem cell is led during entochondrostosis
It causes.On the other hand it sees, expresses FLNBL171RThere are the missings of long bone ossification centre in the BD patient of mutain, with expression
FLNBG1586RThe phenomenon that carpal bone, shank ossification centre increase in the LS patient of mutain is on the contrary, probably due to significant cell
Apoptosis counteracts the facilitation that Runx2 assembles mescenchymal stem cell.
Existing research shows that the expression of Runx2 albumen increases, and can also be advanced by leaps and bounds by PI3K-Akt and promote ATDC5 cell
Transfer ability.The expression FLNB observed in this conclusion and the applicationG1586RThe ATDC5 cell migration ability of albumen declines
The phenomenon that disagree.Applicant thinks in FLNB mutain to the downward effect of ATDC5 cell migration ability and Runx2 pairs
There are a balances between the up-regulation effect of ATDC5 cell migration ability.Actin cytoskeleton plays in cell migration
Key effect.In expression FLNBG1586RIn the ATDC5 cell of mutain, by mutain FLNBG1586RThe flesh of influence moves egg
It is white to be likely to compromise cell migration ability in a way, and such degree can exceed that Runx2 to cell migration ability
Up-regulation effect because FLNB albumen more directly acts on actin cytoskeleton.Although FLNBL171RMutain can also drop
The transfer ability of low ATDC5 cell, this inhibiting effect may be offset by promotion effect of the Runx2 to cell migration ability,
Because Laser Scanning Confocal Microscope shows most of FLNBL171RAlbumen and actin combine extremely and assemble in endochylema, cause
FLNBL171RDecrease is directly affected to cell migration ability.In addition, there are carpal bone, shank ossification centres to increase in LS patient
The clinical phenotypes mutually violated between ossification centre's Underdevelopment of bony segment, this phenomenon have prompted cell migration ability
Reciprocation between decline and the aggregation increase of entochondrostosis initial phase mescenchymal stem cell results in increasingly complex face
Bed phenotype.
To sum up, the starting of the entochondrostosis process of two kinds of diseases of BD and LS can be simulated by the cell model of the application
Stage, and the specific variations of the bone tissue different from common HEK293 cell have been shown, change applicant by these
The profound cause and mechanism that the missense mutation of FLNB gene impacts bone development can be weighed in conjunction with existing research,
It provides the foundation further to study the prevention and treatment of associated bone malformation disorders and related disease.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Sequence table
<110>Chinese Academy of Medical Sciences Beijing Union Medical College Hospital
<120>cell model, construction method and the application of the FLNB gene of missense mutation are expressed
<130> P18019
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
acaagactag gcgctatatg attggagtca cc 32
<210> 2
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atagcgccta gtcttgtcgg ggatgtaggt ga 32
<210> 3
<211> 36
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
aagacggcaa agcccgggga gccctggtag acagct 36
<210> 4
<211> 32
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ccgggctttg ccgtcttgcc agttctggtt aa 32
<210> 5
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
gctggggaca ctattcctaa ga 22
<210> 6
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ccctgttttc cagcccattg ag 22
Claims (10)
1. a kind of cell model of the FLNB gene of expression mutation, which is characterized in that used in the FLNB gene of the expression mutation
Cell be ATDC5 cell.
2. cell model as described in claim 1, which is characterized in that the FLNB gene of the mutation includes containing mutational site
C.4756G > A FLNB gene, containing mutational site c.512T > the FLNB gene of G, lead to osteodysplasty mutated gene,
The mutated gene for the skeleton deformity disease for causing ossification centre to be merged in advance or the mutated gene for leading to congenital scoliosis.
3. cell model as claimed in claim 1 or 2, which is characterized in that the mutation of the FLNB gene different loci passes through
Mutual containing between the effects of it is to cellular morphology, apoptosis, migration and the signal transduction pathway in downstream, can lead to described
ATDC5 cell generates the phenotype of different skeletal system deformities.
4. the construction method of cell model any one of claims 1 to 3, which comprises the steps of:
(1) it is expanded after 5 ' end assembling marker gene of FLNB full-length cDNA gene；
(2) by the gene obtained in step (1) carry out site c.4756G > A or site c.512T > rite-directed mutagenesis of G；
(3) mutated gene obtained in step (2) is connected construction of expression vector with carrier；
(4) expression vector for obtaining step (3) imports ATDC5 cell by transfection, obtains stablizing expression by screening and identification
The cell model of the FLNB gene of missense mutation.
5. construction method as claimed in claim 4, which is characterized in that marker gene described in step (1) is that enhancing green is glimmering
Aequorin.
6. construction method as claimed in claim 4, which is characterized in that rite-directed mutagenesis described in step (2) is fixed using PCR induction
Point mutation.
7. construction method as claimed in claim 4, which is characterized in that PCR induction the used primer of rite-directed mutagenesis is as follows:
FLNB-G4756A-F:ACAAGACTaGGCGCTATATGATTGGAGTCACC
FLNB-G4756A-R:ATAGCGCCtAGTCTTGTCGGGGATGTAGGTGA
FLNB-T512G-F:AAGACGGCAAAGCCCgGGGAGCCCTGGTAGACAGCT
FLNB-T512G-R:CCGGGCTTTGCCGTCTTGCCAGTTCTGGTTAA。
8. construction method as claimed in claim 4, which is characterized in that carrier described in step (3) is pCR3.1 (-) carrier.
9. construction method as claimed in claim 4, which is characterized in that transfection described in step (4) is transfected using jet PRIME
Reagent.
10. following any application of cell model described in claim 1:
(1) as the application on Larsen syndrome cell model；
(2) as the application on boomerang sample Atelosteogenesis cell model.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810955114.XA CN109182273A (en) | 2018-08-21 | 2018-08-21 | Express cell model, construction method and the application of the FLNB gene of missense mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810955114.XA CN109182273A (en) | 2018-08-21 | 2018-08-21 | Express cell model, construction method and the application of the FLNB gene of missense mutation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109182273A true CN109182273A (en) | 2019-01-11 |
Family
ID=64919231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810955114.XA Pending CN109182273A (en) | 2018-08-21 | 2018-08-21 | Express cell model, construction method and the application of the FLNB gene of missense mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109182273A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114181944A (en) * | 2020-09-14 | 2022-03-15 | 中国科学院动物研究所 | Mutant gene and use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105586389A (en) * | 2014-10-21 | 2016-05-18 | 天津华大基因科技有限公司 | Kit and application thereof in detection on hereditary bone disease genes |
| RU2016103670A (en) * | 2016-02-04 | 2017-08-09 | Федеральное государственное бюджетное учреждение "Научный центр здоровья детей" Министерства здравоохранения Российской Федерации (ФГБУ "НЦЗД" Минздрава России) | A method for the diagnosis of hereditary connective tissue diseases using a new generation sequencing technology |
| WO2018085441A1 (en) * | 2016-11-01 | 2018-05-11 | Berg Llc | Filamin b binding proteins and uses thereof |
-
2018
- 2018-08-21 CN CN201810955114.XA patent/CN109182273A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105586389A (en) * | 2014-10-21 | 2016-05-18 | 天津华大基因科技有限公司 | Kit and application thereof in detection on hereditary bone disease genes |
| RU2016103670A (en) * | 2016-02-04 | 2017-08-09 | Федеральное государственное бюджетное учреждение "Научный центр здоровья детей" Министерства здравоохранения Российской Федерации (ФГБУ "НЦЗД" Минздрава России) | A method for the diagnosis of hereditary connective tissue diseases using a new generation sequencing technology |
| WO2018085441A1 (en) * | 2016-11-01 | 2018-05-11 | Berg Llc | Filamin b binding proteins and uses thereof |
Non-Patent Citations (3)
| Title |
|---|
| UPADHYAY ET AL.: "Biallelic mutations in FLNB cause a skeletal dysplasia with 46,XY gonadal dysgenesis by activating β‐catenin", 《CLINICAL GENETICS》 * |
| XU ET AL.: "Comparative analysis of the two extremes of FLNB-mutated autosomal dominant disease spectrum: from clinical phenotypes to cellular and molecular findings", 《AMERICAN JOURNAL OF TRANSLATIONAL RESEARCH》 * |
| XUA ET AL.: "Filamin B:The next hotspot in skeletal research?", 《JOURNAL OF GENETICS AND GENOMICS》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114181944A (en) * | 2020-09-14 | 2022-03-15 | 中国科学院动物研究所 | Mutant gene and use thereof |
| CN114181944B (en) * | 2020-09-14 | 2023-10-03 | 中国科学院动物研究所 | Mutant gene, method for constructing miniature pig model of short-limb dwarfism and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Korrapati et al. | Single cell and single nucleus RNA-Seq reveal cellular heterogeneity and homeostatic regulatory networks in adult mouse stria vascularis | |
| Mensah et al. | Aberrant phase separation and nucleolar dysfunction in rare genetic diseases | |
| Riazuddin et al. | Tricellulin is a tight-junction protein necessary for hearing | |
| Niederkofler et al. | Repulsive guidance molecule (RGM) gene function is required for neural tube closure but not retinal topography in the mouse visual system | |
| Chaouch et al. | Mutations in the mitochondrial citrate carrier SLC25A1 are associated with impaired neuromuscular transmission | |
| Prokudin et al. | Exome sequencing in developmental eye disease leads to identification of causal variants in GJA8, CRYGC, PAX6 and CYP1B1 | |
| Pan et al. | The genome of the largest bony fish, ocean sunfish (Mola mola), provides insights into its fast growth rate | |
| Bakall et al. | Expression and localization of bestrophin during normal mouse development | |
| Wang et al. | UNC13B variants associated with partial epilepsy with favourable outcome | |
| CN107384922A (en) | CRISPR/Cas9 targeting knock outs people CNE9 genes and its specific gRNA | |
| Daya et al. | Zebrafish models of sarcopenia | |
| Greenlees et al. | Mutations in SIPA1L3 cause eye defects through disruption of cell polarity and cytoskeleton organization | |
| Gordon et al. | Mutations in the endothelin receptor type A cause mandibulofacial dysostosis with alopecia | |
| Boneva et al. | In-depth molecular characterization of neovascular membranes suggests a role for hyalocyte-to-myofibroblast transdifferentiation in proliferative diabetic retinopathy | |
| Arafah et al. | Defect in the nuclear pore membrane glycoprotein 210-like gene is associated with extreme uncondensed sperm nuclear chromatin and male infertility: a case report | |
| Das et al. | Genome-wide association study and whole-genome sequencing identify a deletion in LRIT3 associated with canine congenital stationary night blindness | |
| Shentu et al. | Identification and functional analysis of a novel MIP gene mutation associated with congenital cataract in a Chinese family | |
| Jinda et al. | A novel start codon mutation of the MERTK gene in a patient with retinitis pigmentosa | |
| Wu et al. | Elavl2 regulates retinal function via modulating the differentiation of amacrine cells subtype | |
| Mahmood et al. | Identification of hearing loss‐associated variants of PTPRQ, MYO15A, and SERPINB6 in Pakistani families | |
| Morrison et al. | Single-cell reconstruction with spatial context of migrating neural crest cells and their microenvironments during vertebrate head and neck formation | |
| CN109182273A (en) | Express cell model, construction method and the application of the FLNB gene of missense mutation | |
| Chen et al. | Modulation of inner junction proteins contributes to axoneme differentiation | |
| Jarayseh et al. | A tapt1 knock-out zebrafish line with aberrant lens development and impaired vision models human early-onset cataract | |
| Trummer et al. | Branchio-oculo-facial syndrome and branchio-otic/branchio-oto-renal syndromes are distinct entities |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190111 |
|
| RJ01 | Rejection of invention patent application after publication |