CN109164082B - Fluorescence-enhancing agent and the preparation method and application thereof - Google Patents
Fluorescence-enhancing agent and the preparation method and application thereof Download PDFInfo
- Publication number
- CN109164082B CN109164082B CN201811313000.1A CN201811313000A CN109164082B CN 109164082 B CN109164082 B CN 109164082B CN 201811313000 A CN201811313000 A CN 201811313000A CN 109164082 B CN109164082 B CN 109164082B
- Authority
- CN
- China
- Prior art keywords
- fluorescent dye
- fluorescence
- reinforcing agent
- prodigiosin
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K11/00—Luminescent, e.g. electroluminescent, chemiluminescent materials
- C09K11/06—Luminescent, e.g. electroluminescent, chemiluminescent materials containing organic luminescent materials
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/16—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing two or more hetero rings
- C12P17/165—Heterorings having nitrogen atoms as the only ring heteroatoms
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
- C09K2211/10—Non-macromolecular compounds
- C09K2211/1018—Heterocyclic compounds
- C09K2211/1025—Heterocyclic compounds characterised by ligands
- C09K2211/1029—Heterocyclic compounds characterised by ligands containing one nitrogen atom as the heteroatom
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
- G01N2021/6432—Quenching
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Pathology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Materials Engineering (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- General Physics & Mathematics (AREA)
- Optics & Photonics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of prodigiosin and is preparing the application in fluorescent dye reinforcing agent, and provides the fluorescent dye reinforcing agent that a kind of component includes prodigiosin and buffer.Prodigiosin of the present invention has the ability of rapid fluorescence enhancing, there is significant reinforcing effect to the dyeing effect of conventional near infrared fluorescent dye, the fluorescence-enhancing agent being prepared by prodigiosin, molecular weight is small, with good cell-penetrating power, it can directly be observed after to cell dyeing without cleaning, simplify staining procedure, it is lower to the toxicity of cell simultaneously, it will not influence the activity of cell in dyeing course, there is good safety, preparation process is simple, yield is high, is easy to industrialization.
Description
Technical field
The invention belongs to technical field of molecular biology, in particular to a kind of fluorescence-enhancing agent and preparation method thereof with answer
With.
Background technique
Bioluminescence imaging technology can on three dimension scale to biomolecule, cell and tissue, organ carry out in real time, can
Depending on the detection changed, there are non-intruding, high-resolution, safety and the advantages such as quick, have been widely used for diagnosing tumor, biomolecule
The numerous areas such as detection, drug distribution and metabolism.Since organism itself lacks reliable and effective signal, it usually needs by outer
The marker material come analyzes biological sample.
Fluorescent dye generally refers to certain chemical substance, they can be absorbed, and to emit another wavelength after the light of a certain wavelength high
In or lower than absorbing wavelength fluorescence.Ideal bioluminescence imaging should have the suction of near-infrared to transmit/receive with fluorescent dye
She Feng, big Stokes shift, stable optical property (resistance to photobleaching), good water-soluble, low bio-toxicity, and have
Certain reactive functional groups are convenient for further high-performance and multi-functional modification.It can be divided into inorganic and organic fluorescence materials two
Major class, inorganic fluorescent material such as noble metal nano druse common at present, semiconductor-quantum-point, rare earth mixing with nano particle, carbon
Point etc..Organic fluorescence materials have wide in variety relative to inorganic fluorescent material, and structure is easily adjusted, and fluorescence quantum yield is high, biofacies
The features such as capacitive is good.From the point of view of inherently, structure generally comprise the parent nucleus that can emit fluorescence and can change wavelength of fluorescence and
Enhance the auxochrome group of fluorescence.Currently, organic fluorescent dye has been widely used in fluorescence probe, and fluorescent marker, cell dyeing,
The fields such as pharmaceutical indications.
Fluorescent probe technique to excite fluorescent reporter group to fluoresce for means, using molecular recognition group and determinand it
Between specific binding effect, realize to the qualitative and quantitative analysis of determinand.In recent years, fluorescent probe technique is glimmering as biology
The important component of light imaging technique, with it with high sensitivity, feature identity is good, easy to operate, nontoxic to organism
The advantages that radiationless, has been widely used in detecting the substances such as amino acid, nucleic acid, the metal ion in cell biological body, and has obtained
To rapid development.The advantages of fluorescent probe technique, becomes indispensable important skill in biology and medicine and other fields research
Art, and its application range also will be more and more extensive and deep.But mature have been tended to the research and development of fluorescent dye at this stage,
It is higher to develop new fluorescent dye difficulty, thus rationally changes thinking, developing effective fluorescent dye reinforcing agent in due course will become
May, under the action of fluorescent dye reinforcing agent, effectively improve the fluorescence quantum yield of fluorescent dye, to light tolerance and tissue
Penetrating power and other effects.
It is poor for the stability of near infrared fluorescent dye, the problems such as regulatory site is insufficient, it is necessary to provide it is a kind of it is safer,
Efficiently, sensitive fluorescence-enhancing agent, to improve and improve the optical physics and photochemical properties of fluorescent dye, so that fluorescent dye is resistance to
Photobleaching, water solubility, cell targeted and stability are more preferable.
Many pigments are found not only have basic colouring function in microorganism natural pigment, also have certain physiology
Activity is to be considered functional pigmented.Prodigiosin is the general name of a kind of natural red colouring matter, and framework characteristic is containing there are three
It is conjugated pyrrole ring, is the secondary metabolite generated by microorganism.As a kind of functional pigmented, with going deep into for research, it
Many biological activities found successively.
Summary of the invention
Based on this, the purpose of the present invention is to provide a kind of safer, efficient, sensitive fluorescence-enhancing agent, to improve and
The optical physics and photochemical properties for improving fluorescent dye, so that fluorescent dye is fast light Bleachability, water-soluble, cell targeted and steady
It is qualitative more preferable.
To achieve the above object, the present invention provides the following technical scheme that
Application of the prodigiosin in preparation bioluminescence imaging auxiliary reagent or bioluminescence imaging kit.
The present invention also provides a kind of fluorescence detection reagent kits, include prodigiosin.
The present invention also provides a kind of fluorescent dye reinforcing agents, including prodigiosin and buffer.
Based on the above-mentioned technical proposal, the present invention has the effect that
The present invention show that prodigiosin has the ability of rapid fluorescence enhancing through inventor's numerous studies, to the close of routine
The dyeing effect of IR fluorescent dyes has significant enhancing advantage.Fluorescence-enhancing agent of the present invention, molecular weight is small, has
Good cell-penetrating power, can directly observe without cleaning after to cell dyeing, simplify staining procedure, while right
The toxicity of cell is lower, will not influence the activity of cell in dyeing course, has good safety, preparation process letter
Single, yield is high, is easy to industrialization.
Moreover, fluorescence-enhancing agent of the present invention, the biochemistry, thin of marker DNA, RNA, protein and enzyme can be used as
Born of the same parents' biology, the nonradioactive labeling of immunochemistry and molecular biology and detection kit component；It is alternatively arranged as stablizing anti-
It answers reagent, the auxiliary reagent for improving reactivity applied to fluorescent microscopic imaging, fluorescence detection, sensing etc., can also be used as
Matched reagent is used in automation Biochemical Analyzer, is widely used in liquid biopsy field, is not only increased sensitivity, also increase
Detection flux and convenience are added, have compensated for the deficiency of existing detection method, has had a good application prospect and economic value.
Detailed description of the invention
Fig. 1 is fluorescent dye reinforcing agent in embodiment 3 to HEK293 cell activity impact analysis statistical chart；
Fig. 2 is the yin and yang attribute cell signal pattern diagram of AML1-ETO fusion detection kit in embodiment 5；
Fig. 3 is the counting of the danger signal quantity and green quantity of the detection of AML1-ETO fusion in embodiment 5
Mode with reference to figure；
It is the optimum quantum of utilization for inquiring into fluorescent dye reinforcing agent and the FISH detection figure using the time that Fig. 4, which is in embodiment 5,；
Fig. 5 is the sample fluorescence in situ hybridization testing result comparison diagram that fluorescent dye reinforcing agent is used in embodiment 5；
Fig. 6 is to statistically analyze figure using the sample light Detection of Stability result of fluorescent dye reinforcing agent in embodiment 6；
Fig. 7 is sample fluorescence quantitative PCR comparative result figure of the embodiment 7 using fluorescent dye reinforcing agent；
Fig. 8 is the Immunofluorescence test result figure that circulating tumor cell is analyzed under × 20 amplification factors in embodiment 8；
Fig. 9 is comparative result figure of the fluorescent dye reinforcing agent in detection use during excretion physical examination is surveyed.
Specific embodiment
To facilitate the understanding of the present invention, it below with reference to embodiment to invention is more fully described, is given below
Presently preferred embodiments of the present invention.But the invention can be realized in many different forms, however it is not limited to described herein
Embodiment.Purpose of providing these embodiments is makes the disclosure of the present invention more thorough and comprehensive.It should be understood that
In the following examples, the experimental methods for specific conditions are not specified, usually according to normal condition, for example (,) Sambrook et al., molecule gram
It is grand: condition described in laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989),
Or according to the normal condition proposed by manufacturer.Used various common agents, are commercial product in embodiment.
Unless otherwise defined, all technical and scientific terms used herein and the skill for belonging to technical field of the invention
The normally understood meaning of art personnel is identical.Used term is intended merely to describe specifically to implement in the description of the invention
The purpose of example is not used in the limitation present invention.Term as used herein "and/or" includes one or more relevant listed items
Any and all combinations.
The present invention provides prodigiosin answering in preparation bioluminescence imaging auxiliary reagent or fluorescence detection reagent kit
With.Specifically, fluorescence imaging auxiliary reagent can be with are as follows: (1) for marker DNA, RNA, protein or enzyme nonradioactive labeling
Component in kit or detection kit；Or (2) are tried for stablizing reaction in fluorescent microscopic imaging, fluorescence detection, sensing
Agent or the auxiliary reagent for improving reactivity；Or the matched reagent in (3) Biochemical Analyzer；Or the fluorescence in (4) liquid biopsy
Auxiliary reagent is imaged.Prodigiosin has the ability of quickly enhancing fluorescence, has in bioluminescence imaging technology and widely answers
With value.
In the application of prodigiosin, the prodigiosin is obtained by extracting in serratia marcescens；Preferably, described viscous
Matter Serratieae is serratia marcescens ATCC8100, can be prepared by following methods: serratia marcescens fermentation training
After supporting, it is centrifuged after ultrasonication；Supernatant after taking centrifugation, vacuum distillation, concentration；By enriched product, it is extracted with ethyl acetate
Afterwards, atmospheric evaporation be concentrated, natural air drying to get.
The present invention also provides prodigiosins to prepare the application in fluorescent dye reinforcing agent.
The present invention also provides a kind of fluorescent dye reinforcing agent, which includes prodigiosin and buffer,
In some of embodiments, buffer can be composed of the following components: 1~5g/100ml of stevioside；Physiological saline (0.9% chlorine
Change sodium solution) 30~50ml/100ml；2~7g/100ml of sodium hydroxy methyl glycinate；EDTA5~12mol/100ml；Catechin 1
~5g/100ml；1~5g/100ml of sophorolipid.Preferably, buffer can be composed of the following components: 1~2g/ of stevioside
100ml；35~45g/100ml of physiological saline；2~5g/100ml of sodium hydroxy methyl glycinate；EDTA5~10mol/100ml；Catechu
1~3g/100ml of element；1~3g/100ml of sophorolipid.It optionally, can also basis in fluorescent dye reinforcing agent of the present invention
Actual needs is adjusted to other components and each component content.
In some embodiments of fluorescent dye reinforcing agent of the present invention, prodigiosin in serratia marcescens by mentioning
It obtains；Preferably, the serratia marcescens is serratia marcescens ATCC8100, can be prepared by following methods
It arrives: after serratia marcescens fermented and cultured, being centrifuged after ultrasonication；Supernatant after taking centrifugation, vacuum distillation, concentration；It will be dense
Contracting product, after being extracted with ethyl acetate, atmospheric evaporation concentration, natural air drying to get.
Optionally, concentration of the prodigiosin in fluorescent dye reinforcing agent is 1.5 × 10-3Mol/L~2.5 × 10-3mol/
L.Preferably, concentration of the prodigiosin in fluorescent dye reinforcing agent is 2 × 10-3mol/L。
Above-mentioned prodigiosin or fluorescent dye reinforcing agent can be in the applications in fluorescent microscopic imaging, fluorescence detection, wherein
The fluorescence detection specifically includes: fluorescence in situ hybridization detection, fluorescence quantitative PCR detection, circulating tumor cell detection, excretion body
Detection, fluoroimmunoassay etc..
The preparation of 1 prodigiosin of embodiment
(1) strain fermentation
Beef extract-peptone agar medium: beef extract 3.0g, peptone 10.0g, NaCl 5.0g, agar 20g, water
1000ml, pH 7.4-7.6.
Seed culture medium (%): yeast extract 0.5g, peptone 1.0g, NaCl 1.0g, water 100ml, 115 DEG C of sterilizings
20min。
(1) bacterial strain (serratia marcescens ATCC8100) that will be preserved in glycerol cryopreservation tube (- 80 DEG C of preservations) takes out, Yu Pei
Flat lining out recovery is supported, is taken on a red color on beef-protein medium, as the extension color of incubation time gradually adds
It is deep.Rapidly, 28 DEG C, bacterium colony is round, surface elevation, smooth sticky, easy picking after 12h culture for growth.
(2) from one ring single colonie of picking on the plate of fresh cultured, (50mL shaking flask dress liquid is transferred in seed culture medium
10mL), 28 DEG C, shaken cultivation is used as first order seed overnight on 160r/min shaking table.
(3) again by first order seed by 28 DEG C of 10% inoculum concentration switching seed culture medium (250mL shaking flask fill liquid 50mL),
Shaken cultivation is to logarithmic phase as secondary seed on 160r/min shaking table.
(4) secondary seed solution equivalent is taken to be added in sterile beef extract-peptone agar plate, to consolidating for bacterium solution has been added
Sterile glass beads number is added in body agar plate.
(5) plate lid is covered, the horizontal each quick shaking plate about 10sec in front and rear, left and right makes bacterium solution even spread culture plate.
(6) when agar surface bacterium solution is dry, bead is poured out, plate lid is covered, is inverted in bacteriological incubator, 28 DEG C of trainings
Support 16-72h.
(2) prodigiosin extracts
(1) culture dish for taking out culture serratia marcescens is covered on agar plate under aseptic condition using scraper
Mycelium all scraping into clean centrifuge tube and is weighed.
(2) chloroform formic acid solution is added in the centrifuge tube equipped with thallus, is carried out using ultrasonic cell disruption instrument abundant
It is broken, it is then centrifuged for (4000r/min, 15min), Aspirate supernatant.This step repeatable 1-5 time, up to supernatant substantially without
Color.
(3) centrifuged supernatant being collected into is merged, through 50~60 DEG C of vacuum distillations to the 1~2% of total volume.
(4) sample (about 5mL) being concentrated is dissolved with 150mL ethyl acetate, sealing, 30 DEG C, 200r/min oscillation 2-3h.
(5) by acetic acid ethyl acetate extract, 50mL centrifuge tube is dispensed, room temperature 10000r/min is centrifuged 10min, collects supernatant.
(6) ethyl acetate is removed in atmospheric evaporation concentration, and concentrate is transferred to and is washed in advance with ethyl acetate by a small amount of ethyl alcohol equal solvent
In the culture dish crossed, it is put into baking oven drying or natural air drying.
(7) kermesinus prodigiosin drying sample is harvested, then weighing uses reinforcing agent buffer at 2 with alcohol hydrotropy
×10-3The solution of mol/L is hidden in brown bottle as stock solution, and dark place is sealed.
Fluorescent dye reinforcing agent of the embodiment 2 containing prodigiosin
A kind of fluorescent dye reinforcing agent containing prodigiosin is present embodiments provided, mainly includes prodigiosin and enhancing
Agent buffer solution, concentration of the prodigiosin in reinforcing agent buffer are 2 × 10-3Mol/L, dark place are sealed.Wherein, enhance
The proportion of agent buffer is specific as follows:
In said components, steviol glycoside property is stablized, strong to the stability of acid, alkali, heat, light；It advantageously reduces sticky
Degree inhibits bacterial growth, extends shelf life of products.Not decomposing in acid-base class medium can prevent from fermenting, and change colour and precipitate.
Sodium hydroxy methyl glycinate, the aseptic applications are in extensive range, has a broad antifungal spectrum, can press down to bacterium, mould, saccharomycete
System, germicidal efficiency are high；
There is catechin apparent phenols characteristic can make heavy metal and protein precipitation, simultaneously under the concentration proportioning
Free radical can be removed, there is certain anti-oxidant and bacteriostasis, enhance buffer solution system stability.
Sophorolipid is a kind of environmental-friendly, nontoxic, free of contamination biosurfactant, has good surface-active,
It is high temperature resistant, with high salt, it is nontoxic, non-stimulated to skin；There is inhibiting effect to part common bacteria.
In some other embodiment, the above-mentioned fluorescent dye reinforcing agent containing prodigiosin, reinforcing agent buffer solution can also
Its component and each component content are adjusted according to actual needs.
Influence of the embodiment 3 containing fluorescent dye reinforcing agent to cell activity
Since fluorescent dye is mainly used for the fluorescence imaging of biological sample, low bio-toxicity is to measure detection fluorescence dye
Expect one of the important indicator of practicability.
HEK293 cell (human embryonic kidney cells are purchased from Nanjing KaiJi Biology Science Development Co., Ltd) is inoculated in culture bottle
Afterwards, using the DMEM culture medium for containing 10% fetal calf serum, 37 DEG C, 5%CO212-72h is cultivated in environment.Logarithmic growth phase
Cell, with every hole 6 × 103A cell inoculation is used instead and is increased containing fluorescent dye as described in example 2 in 96 orifice plates, overnight incubation
Strong agent culture solution (prodigiosin wherein contained in culture solution be respectively 0nM, 1nM, 5nM, 10nM, 15nM, 20nM, 25nM,
30nM, 35nM), it after continuing culture for 24 hours, inhales and abandons supernatant, every hole is added the culture medium of the reagent containing 10%CCK-8, continues to cultivate
4h is then 490nm condition in excitation wavelength with microplate reader (the full-automatic microplate reader of ELX800, Bao Te Instrument Ltd., the U.S.)
Under, measure each hole absorbance value, using culture solution containing cell and CCK-8 as control group, with only plus equivalent culture solution and
CCK-8 is blank well.Cell survival rate is calculated according to the following equation: cell survival rate (%)=(experimental port absorbance value-blank
Hole absorbance value)/(control wells absorbance value-blank well absorbance value) × 100%.6 parallel holes, experiment is arranged in each concentration
It is repeated 3 times.As a result statistics is as shown in Figure 1.The fluorescent dye reinforcing agent containing prodigiosin is using concentration model as the result is shown
Cytotoxicity in enclosing is low, and cell survival rate is all larger than 85%.
Application of the 4 fluorescent dye reinforcing agent of embodiment in FISH probe label
Present embodiments provide application of the fluorescent dye reinforcing agent in FISH probe label.Wherein, the side of probe label
Method includes the following steps:
(1) buffer is marked with preparing boric acid, sodium tetraborate decahydrate 1.9g is taken to be dissolved in 50mL ddH2O, pH value are adjusted to 8.5,
The filtering of 0.45 μm of filter, is stored in -25 DEG C to -18 DEG C, spare.It takes NF water and balances with preparing boric acid label buffer to room temperature,
Sufficient vortex oscillation mixes.
(2) after the clone for obtaining target gene, large quantity extracting plasmid DNA, then using nick-translation, random priming etc.
The dUTP that fluorescein(e) dye marks or dCTP are connected on DNA by fluorescence labeling method inside, to the target DNA marked into
Row combination precipitating.
(3) DNA probe that the amino labeled is dissolved with nanofiltration water sequentially adds boric acid label buffer, fluorescence dye
Material and fluorescent dye reinforcing agent, be protected from light at room temperature to get.After being protected from light packing, stored in -20 DEG C.
Dye labeling schemes see the table below 1:
Table 1FISH probe tagging scheme
| Reagent | Theoretical amount |
| The DNA of amino labeled | 100μg |
| NF water | 11μL |
| Boric acid marks buffer | 75μL |
| Fluorescent dye | 14μL |
| Fluorescent dye reinforcing agent | 5~15 μ L |
Influence of the 5 fluorescent dye reinforcing agent of embodiment to sample fluorescence in situ hybridization testing result
(1) prepared by probe
By taking ETO-AML1 fusion detection probe as an example, probe sequence is earlier application patent document
Sequence SEQ ID NO.1-80 in CN201610087705.0, probe label and its solution preparation method are ginseng with embodiment 4
It examines, specifically to inquire into optimal use dosage and action time of the fluorescent dye reinforcing agent in fluorescence probe labeling process, with table 2
Shown setting experimental group, and the preparation of probe face liquid is carried out according to the above method.
Table 2
(2) fluorescent in situ hybridization detecting method is used, the other probe face liquid of the difference group of preparation is used to detect same
Criticize droplet of blood piece sample, the specific steps are as follows:
1, sample preprocessing
Take droplet of blood piece sample.Drop piece is immersed in 2 × SSC at room temperature, rinses 2min.Successively be immersed in 70%,
85%, natural air drying after each 2min dehydrated alcohol is handled is dehydrated in 100% ethyl alcohol.
2, FISH is detected
2.1 preparations: probe is balanced to room temperature, and being vortexed to mix to be placed in microcentrifuge is centrifuged 2-3s；It opens simultaneously
Hybridization instrument is preheated, wet bar is immersed into spare (at least immersion 2h) in distilled water, when hybridization is put into hybridization instrument；It is being cut using glass cutter
Piece reverse side irises out sample hybridising region.
2.2 hybridization (being protected from light operation): molten in the AML1-ETO double-color probe that 10 μ L are added in droplet of blood piece sample hybridising region
Liquid, covered cover coverslip surrounding position using mounting glue, form the sealing ring of closure.Drop piece is put into preheating simultaneously
It has installed in the hybridization instrument of wet bar, hybridization reaction program: 75 DEG C of (+/- 1 DEG C) denaturation 2min, 37 DEG C of hybridized overnight (14h is set
~18h).
2.3 post-hybridization washings (are protected from light operation): opening water-bath (72 ± 1 DEG C), it is pre- that washing buffer I is placed in water-bath
Heat.Slice after hybridization is taken out from hybridization instrument, mounting glue is removed, is placed in 2min in 72 ± 1 DEG C of washing buffer I, then
It is placed in 30s in the washing buffer II of room temperature；It is primary to be finally placed in 3-5s rinsing in pure water, uprightly air-dries slice after washing.
2.4DAPI is redyed and (is protected from light operation): 10 μ L are added in sample hybridising region and redye liquid, covered, room temperature is kept away
It can microscopically observation fluorescence signal after light 5-10min.Slice after DAPI is redyed can also be placed in -25 DEG C to -18 DEG C and be protected from light
(holding time is no more than 72h) is saved, is observed after putting slice to room temperature when needing to detect.
3, cell positive and negative criterion:
Field of microscope is moved up and down, lookup is all to be present in endonuclear signal.
A, following signals mode can determine that as AML1-ETO fusion positive cell (being detailed in Fig. 2 B): occur in interphase nucleus
Be 1 red, 1 green and 2 red green hybridization signals (1R1G2F)；
B, following signals mode can determine that as AML1-ETO fusion negative cells (being detailed in Fig. 2A): occur in interphase nucleus
Be the green random dispersions of 2 red and 24 hybridization signals (2R2G).
Note: black represents red point in attached drawing, and white represents green point.
Fig. 3 is the counting mode reference of the danger signal quantity and green quantity of AML1-ETO fusion detection
Figure, specific as follows:
A: nuclear fractions overlapping, but signal can be counted not in overlapping region, in figure in visible two nucleus
There are two red two green fluorescences signals；
B: cell stacks, and has signal distributions at overlapping region, without counting；
C: individually separated red, green signal is considered as single signal, visible two danger signals and two greens in figure；
D: with being denoted as one when chrominance signal is closely in divided form or signal separates but spacing is less than or equal to twice of signal length
A signal；Visible two danger signals and two greens in figure；
E: with being denoted as one when chrominance signal is closely in divided form or signal separates but spacing is less than or equal to twice of signal length
A signal；A visible danger signal and two greens in figure；
F: signal boundary is fuzzy to be denoted as a signal in diffusion type, visible two danger signals and two green letters in figure
Number.
Fig. 4 is the experiment for analysis of fluorescence dye enhancer optimum quantum of utilization and use time in fluorescence probe configuration
Group FISH detection figure (schemes lower label 1-12 and corresponds to detection group 1-12) in figure, pass through experimental result graph discovery, fluorescent dye
Dose dependent is not presented in the usage amount and using effect of reinforcing agent, in minimum 5 μ L of dosage, still has glimmering well
Light reinforcing effect, while can be found by analysis using time comparison group, after fluorescent dye reinforcing agent is added, it can be substantially reduced glimmering
Light probe setup time is in particular in and only acts on 1 hour fluorescence probe when preparing probe, acts on 4-8 hours with conventional
Fluorescence probe is compared, the basic indifference of final detection result, sufficiently show fluorescent dye reinforcing agent of the present invention effectively enhance it is glimmering
While the fluorescent effect of light probe, it is also substantially shorter the fluorescence probe label time, there is applications well value.
It is the probe in detecting result figure marked using fluorescent dye reinforcing agent of the present invention, figure subscript that lower label 1-3 is schemed in Fig. 5
Note 4-6 is the probe in detecting result figure that fluorescent dye reinforcing agent label is not used, and the label time of probe label is equal are as follows: 4 hours.
By contrast, it can obviously find, it is obvious intuitive using the detection group experimental result fluorescent staining comparison of fluorescent dye reinforcing agent, it is easy to
Judgement, and control group result figure is compared compared with experimental group, fluorescence signal is weak, and carrying out correct interpretation of result to tester has certain do
Immunity is unfavorable for the correct interpretation of final detection result.
The photobleaching of the Probe labelling kit of 6 fluorescent dye reinforcing agent of embodiment is tested
By taking ETO-AML1 fusion detection probe as an example, probe sequence is earlier application patent document
Sequence SEQ ID NO.1-80 in CN201610087705.0, probe label and its solution preparation method are ginseng with embodiment 4
It examines, and is added without dye enhancer in its preparation process.The probe face liquid prepared difference equivalent is taken out into 150 μ L in EP
Guan Zhong is respectively labeled as A, B, and 5 μ L fluorescent dye reinforcing agents are wherein added in the probe face liquid of experimental group A；The spy of experimental group B
5 μ L distilled waters are added in needle working solution.Photobleaching is carried out to according to the facts to identical sample using above-mentioned two groups of probe face liquid respectively
It tests.Two groups of probes carry out FISH detections to 2 groups of droplet of blood piece samples respectively, experimental group referring to embodiment 4 detection method.
1 cell distribution of selection is uniform from the sample after fluorescent staining, and the strong visual field of fluorescence signal is placed in fluorescence microscopy
It is constantly irradiated under mirror, is collected every 5min CCD (Charge Coupled Device, charge-coupled device) video camera
Image, analytical calculation collect figure fluorescence signal later each time and collect the ratio of figure fluorescence signal for the first time.
Testing result is schemed as shown in fig. 6, being collected by the fluorescence signal that analysis each time point collects figure with first time
The ratio of shape fluorescence signal, the discovery present invention help to promote the photostability of fluorescent dye, and anti-quenching ability is strong.
Influence of the use of 7 fluorescent dye reinforcing agent of embodiment to sample fluorescence quantitative PCR detection result
By taking the detection of septin9 gene methylation as an example, the Taqman probe face liquid (experiment that dye enhancer is added is used
1) group carries out control experiment with the Taqman probe face liquid (experimental group 2) for being added without fluorescent dye reinforcing agent, wherein clever bacterium is red
Concentration of the element in reinforcing agent buffer is 2 × 10-3Mol/L, the usage amount of fluorescent dye reinforcing agent are every 100 μ L probe face
1 μ L is added in liquid.Two groups of probes carry out real-time fluorescence quantitative PCR to sample of nucleic acid respectively and detect septin9 gene methylation, institute
5 ' the ends of the primer and probe sequence such as the following table 3 used, probe are marked with fluorescent reporter group (VIC or FAM), and 3 ' ends are marked with
Quenching group (BHQ-1).
Table 3
| Primer/probe title | Specific primer sequence (5 ' -3 ') | SEQ.ID NO. |
| β-actin-F | GTAGATGTTTGAGGAGGTGGGA | 1 |
| β-actin-R | ATACAAATACCAACCAACCCCA | 2 |
| β-actin-P | TTTGGGGGTGTTTGGTTTAGGTGTTATGTT | 3 |
| septin9-F | GAGTTAGGGGGTTTAGGGGTTTT | 4 |
| septin9-R | TAATAACTAATAAACAACGAAT | 5 |
| septin9-P | CGCGGGCGCGGCGTTTTAGTTAGCGC | 6 |
Fluorescence quantitative PCR detection specific steps are as follows:
A) following reagent is mixed in PCR pipe:
B) following procedure is executed in ABI7500 fluorescence quantitative PCR instrument:
C) testing result is determined by following principle:
Experimental result is as shown in fig. 7, known to analysis: 3 samples (A-C) respectively with the reagent of experimental group 1 and experimental group 2 into
The row above method detects, and in testing result it is evident that identical pattern detection, uses the experimental group 1 of fluorescent dye reinforcing agent
Testing result compared with experimental group 2 becomes apparent from compared to fluorescence intensity, and Dependence Results are more intuitive, and testing result is easier interpretation.
Application of the 8 fluorescent dye reinforcing agent of embodiment in circulating tumor cell detection
The present embodiment provides application of the fluorescent dye reinforcing agent in circulating tumor cell detection, points of circulating tumor cell
It is specific as follows to analyse identification method:
1, solution reagent
1) reaction buffer: contain 0.1%BSA, the PBS of 2mM EDTA, pH 7.4.For the antibody and cell on immunomagnetic beads
Surface antigen occurs immune association reaction and provides suitable solution condition.
2) fixer: 13% neutral formalin.
3) confining liquid: the PBS containing 10% fetal calf serum, pH7.4.The upper non-specific antibody combining site of closing cell.
4) cell marking liquid
Formula: FITC containing 0.1mg/mL mark CD45 antibody, 0.1mg/mL PE label CK antibody, 15 μ g/mL DAPI and
2×10-3The fluorescent dye reinforcing agent containing prodigiosin of mol/L (equivalent PBS buffer solution is added in control group).
Function: to the fluorescein of leucocyte and tumour cell label different colours, for carrying out cell differentiation.CK8-PE:
Red fluorescence；CD45-FITC: green fluorescence；DAPI: blue-fluorescence.
Microscope is shown in Table 4 using channel:
The excitation wavelength and launch wavelength of 4 fluorophor of table
| Fluorophor | Excitation wavelength (Excitation filter) | Launch wavelength (Emission filter) |
| DAPI | 330-385nm | 420nm |
| Alexa Fluor 488 | 460-495nm | 510-550nm |
| Cy3 | 545-580nm | 610nm |
| Cy5 | 616-649nm | 667-751nm |
2, method is analyzed and identified
1) cell marking
Fixer is added into cell suspension, reacts 10min.600g is centrifuged 5min, removes supernatant.Confining liquid is added to be resuspended
Cell reacts 10min.600g is centrifuged 5min, removes supernatant.Cell marking liquid is added, cell is resuspended, reacts 30min.600g from
Heart 5min removes supernatant.Fixer is added, cell is resuspended, reacts 10min.
2) enriched tumor cell
The cell suspension of label processing is added on filter membrane (5~8 μm of filter sizes), carries out suction filtration processing, suction filtration terminates
Afterwards, filter membrane is taken out, is kept in dark place.
3) cellular identification and counting
Filter membrane piece is placed under fluorescence microscope and is observed, CTCs parting standard is as shown in table 5:
5 positive CTC parting standard of table
For a variety of CTCs specific proteins, dyed using multi-fluorescence antibody.It, can by different colours fluorescence signal
Parting further is carried out to CTCs.Wherein I type (epitheliated type) CTCs carries Cy3 fluorophor (shown in red fluorescence signal),
III type (interstitial type) CTCs carry 488 fluorophor of Alexa Fluor (shown in green fluorescence signal), while express I type and
The CTCs of III type specificity protein is II type (epithelial-mesenchymal mixed type, while being displayed in red fluorescence and green florescent signal).
By experimental result (Fig. 8) as it can be seen that compared to control group (A2, B2, C2), the experiment after fluorescent dye reinforcing agent of the invention is added
Group (A1, B1, C1) fluorescent marker becomes apparent from, easy to identify.Illustrate that kit of the present invention can be effectively applied to circulating tumor cell and exempt from
The analysis of epidemic disease fluorescent technique.
Application of the 9 fluorescent dye reinforcing agent of embodiment in excretion physical examination survey
It is specific as follows the present embodiment provides application of the fluorescent dye reinforcing agent in excretion physical examination survey:
(1) the excretion body in separating and purifying serum；Separate excretion body using multistep differential centrifugation: 4 DEG C, 300g is centrifuged 10
Minute removal cell；4 DEG C, 2000g is centrifuged 20 minutes and 4 DEG C, and 10000g is centrifuged 30 minutes removal cell fragments；Finally, 4 DEG C,
Precipitating obtained is excretion body within 100000g ultracentrifugation 60 minutes.
(2) sample total serum IgE is extracted；
(3) miRNA is extracted in the serum excretion body total serum IgE that step (2) obtain；
(4) the miRNA reverse transcription for obtaining step (3) becomes cDNA；
(5) miRNA and reference gene are subjected to augmentation detection on fluorescence real-time quantitative PCR instrument；Using Beijing day bounties
Gene Tech. Company Limited's miRNA Realtime qRT-PCR kit, reaction system (20 μ l) are as follows:
Serum excretion body sample is using miR-16 as internal reference.By 95 DEG C of initial denaturation, 10min；95 DEG C of denaturation, 15s；Annealing
And extend 60 DEG C, 1min, melting curve analysis is carried out after fluorescence quantitative PCR instrument expands 40 circulations.
Interpretation of result:
As shown in Fig. 9, three sample to be examined are respectively adopted and fluorescent dye reinforcing agent reaction system (experimental group A) is added
The reaction system (experimental group B) that fluorescent dye reinforcing agent is not added carries out above method detection, can obviously see in testing result
It is become apparent from out compared with the testing result of experimental group B compared to fluorescence intensity using the experimental group A of fluorescent dye reinforcing agent, Dependence Results are more
Intuitively.
Each technical characteristic of embodiment described above can be combined arbitrarily, for simplicity of description, not to the above reality
It applies all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited
In contradiction, all should be considered as described in this specification.
The embodiments described above only express several embodiments of the present invention, and the description thereof is more specific and detailed, but simultaneously
Limitations on the scope of the patent of the present invention therefore cannot be interpreted as.It should be pointed out that for those of ordinary skill in the art
For, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to guarantor of the invention
Protect range.Therefore, the scope of protection of the patent of the invention shall be subject to the appended claims.
Sequence table
<110>Surexam Biotechnology Co., Ltd.
<120>fluorescence-enhancing agent and the preparation method and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gtagatgttt gaggaggtgg ga 22
<210> 2
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atacaaatac caaccaaccc ca 22
<210> 3
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
tttgggggtg tttggtttag gtgttatgtt 30
<210> 4
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gagttagggg gtttaggggt ttt 23
<210> 5
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
taataactaa taaacaacga at 22
<210> 6
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
cgcgggcgcg gcgttttagt tagcgc 26
Claims (10)
1. a kind of fluorescent dye reinforcing agent, which is characterized in that including prodigiosin and buffer, the buffer, by every 100ml
Meter, contains following components:
2. fluorescent dye reinforcing agent according to claim 1, which is characterized in that the buffer contains based on every 100ml
There is following components:
3. fluorescent dye reinforcing agent according to claim 2, which is characterized in that the buffer contains following component:
4. fluorescent dye reinforcing agent according to claim 1-3, which is characterized in that the prodigiosin is in fluorescence
Concentration in dye enhancer is 1.5 × 10-3Mol/L~2.5 × 10-3mol/L。
5. fluorescent dye reinforcing agent according to claim 1-3, which is characterized in that the prodigiosin is by cement
It extracts and obtains in Serratieae.
6. fluorescent dye reinforcing agent according to claim 5, which is characterized in that the serratia marcescens is cement sand thunder
Salmonella ATCC8100.
7. fluorescent dye reinforcing agent according to claim 1-3, which is characterized in that the preparation of the prodigiosin
Method the following steps are included:
After serratia marcescens fermented and cultured, it is centrifuged after ultrasonication；
Supernatant after taking centrifugation, vacuum distillation, concentration；
By enriched product, after being extracted with ethyl acetate, atmospheric evaporation concentration, natural air drying to get.
8. fluorescent dye reinforcing agent as claimed in any one of claims 1 to 6 is in preparation bioluminescence imaging auxiliary reagent or fluorescence
Application in detection kit.
9. application according to claim 8, which is characterized in that the bioluminescence imaging auxiliary reagent includes:
(1) nonradiactive labeling kits for marker DNA, RNA, protein or enzyme or the component in detection kit；
Or
(2) strong for stablizing reaction reagent in fluorescent microscopic imaging, fluorescence detection, sensing, improving reactivity or enhancing fluorescence
The auxiliary reagent of degree；Or
(3) matched reagent in Biochemical Analyzer；Or
(4) the fluorescence imaging auxiliary reagent in liquid biopsy.
10. a kind of fluorescence detection reagent kit, which is characterized in that include fluorescent dye as claimed in any one of claims 1 to 6
Reinforcing agent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811313000.1A CN109164082B (en) | 2018-11-06 | 2018-11-06 | Fluorescence-enhancing agent and the preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811313000.1A CN109164082B (en) | 2018-11-06 | 2018-11-06 | Fluorescence-enhancing agent and the preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109164082A CN109164082A (en) | 2019-01-08 |
| CN109164082B true CN109164082B (en) | 2019-09-24 |
Family
ID=64876705
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811313000.1A Active CN109164082B (en) | 2018-11-06 | 2018-11-06 | Fluorescence-enhancing agent and the preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109164082B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109880879A (en) * | 2019-02-28 | 2019-06-14 | 张家港高品诚医械科技有限公司 | A kind of Bacteria Culture detection method |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003901361A0 (en) * | 2003-03-25 | 2003-04-10 | Fluorotechnics Pty Limited | Method of enhancing fluorescence |
| CN102002469B (en) * | 2010-09-28 | 2013-05-01 | 嘉兴学院 | Bacterial strain for producing prodigiosin and method thereof |
| CN102311981B (en) * | 2011-07-19 | 2013-10-09 | 东南大学 | Method for preparing and purifying prodigiosin |
| CN102277323B (en) * | 2011-08-08 | 2013-02-06 | 浙江师范大学 | High-prodigiosin-yield serratia marcescens strain Sm-128 and use thereof |
| CN104198449B (en) * | 2014-08-08 | 2016-08-17 | 贵州大学 | A kind of fluorescent probe method for living cells imaging |
| CN105907660A (en) * | 2016-04-09 | 2016-08-31 | 漯河医学高等专科学校 | Synthetic method and application of pyrryl BODIPY compound |
-
2018
- 2018-11-06 CN CN201811313000.1A patent/CN109164082B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN109164082A (en) | 2019-01-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Haley et al. | Laboratory methods in medical mycology | |
| CN108801988A (en) | Bisphenol-A and estradiol detection kit and application based on up-conversion fluorescence aptamer sensor and detection method | |
| CN106238112A (en) | A kind of micro-fluidic chip and the application in the qualification and drug sensitive experiment of pathogen thereof | |
| CN107326074A (en) | The method and its dedicated kit of a kind of Penaeus Vannmei liver sausage born of the same parents worm LAMP detections | |
| CN105385757A (en) | Methods and kits for room temperature in situ detection of target nucleic acid in biological sample | |
| CN109164082B (en) | Fluorescence-enhancing agent and the preparation method and application thereof | |
| CN104017889A (en) | Molecular beacon probe for rapid detection of Mycobacterium tuberculosis and method for detecting Mycobacterium tuberculosis | |
| Betts et al. | Rapid enumeration of viable micro‐organisms by staining and direct microscopy | |
| CN112239455B (en) | RNA fluorescent probe for rapidly distinguishing cancer tissues from normal tissues by using morphological change of nucleolus | |
| CN101624634B (en) | Field fast high-sensitive detecting kit of monodon baculovirus and detecting method | |
| CN101921873B (en) | On-site rapid high-sensitivity detection kit of prawn infectivity muscle necrosis virus and detection method thereof | |
| CN109187970B (en) | It is a kind of quickly to detect aquatic products disease gold mark nucleic acid test strip and preparation method thereof | |
| CN105420397A (en) | PML gene and RARA gene detection probe, preparation method thereof and reagent kit | |
| CN105695384B (en) | Express the recombinant salmonella and its construction method of red fluorescent protein | |
| CN107383927B (en) | A kind of nitrine indoles dimethime Molecule of Cyanine Dyes and application | |
| CN102533955B (en) | Peptide nucleic acid probe, composition containing peptide nucleic acid probe, and application of peptide nucleic acid probe | |
| CN104561357A (en) | EGFR gene amplification detection probe, kit and method | |
| CN102453747A (en) | Tracing analysis method in cell of deoxyribonucleic acid (DNA) | |
| CN104313174A (en) | Molecular beacon probe for rapidly detecting streptococcus pneumoniae and detection method | |
| CN102643894A (en) | Exogenous gene tracing system and application thereof | |
| CN106636132B (en) | A kind of ultraviolet stress-related genes of highland barley and its application | |
| CN110117571A (en) | The noninvasive kit and its method for obtaining fetus rare cell | |
| WO2003104210A1 (en) | Selective chromophores | |
| CN109096384A (en) | Green fluorescent protein base nanoparticle, preparation method and its application in terms of cell imaging and nucleus kernel dyeing | |
| CN101838707B (en) | Field fast high-sensitivity detection kit and detection method for prawn hepatopancreatic parvovirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |