CN109136339A - A kind of primer, probe and kit and method detecting transgenic paddy rice TT51-1 - Google Patents
A kind of primer, probe and kit and method detecting transgenic paddy rice TT51-1 Download PDFInfo
- Publication number
- CN109136339A CN109136339A CN201811222905.8A CN201811222905A CN109136339A CN 109136339 A CN109136339 A CN 109136339A CN 201811222905 A CN201811222905 A CN 201811222905A CN 109136339 A CN109136339 A CN 109136339A
- Authority
- CN
- China
- Prior art keywords
- primer
- probe
- paddy rice
- detection
- transgenic paddy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Abstract
The invention discloses the RPA detection primers of transgenic paddy rice TT51-1 a kind of and probe combinations, kit and detection method.Primer sets are made of 2 specific primers, and nucleotide sequence is as shown in No:1~2 SEQ ID, and probe sequence is as shown in SEQ ID No.3.Detection kit includes detection primer and probe solution, Buffer A, Buffer B and positive control.Detection method is to use specific primer and probe under the action of recombinase, single-stranded DNA binding protein (SSB), strand displacement archaeal dna polymerase and exonuclease, sample DNA templates are expanded at 37~42 DEG C, by the method to fluorescence probe signal collection, whether judgement sample contains transgenic paddy rice TT51-1 ingredient.The present invention does not need specific apparatus, have the characteristics that rapidly and efficiently, easy to operate, high sensitivity, high specificity, be suitble to on-site test.
Description
Technical field
The invention belongs to technical field of molecular biology, are related to the detection method of genetically modified plants and products thereof, specifically relate to
And a kind of utilization recombinase polymeric enzymatic amplification technology (Recombinase PolymeraseAmplification, RPA) is quickly examined
Survey the primer and probe combinations, kit and detection method of transgenic paddy rice TT51-1.
Background technique
Transgenic pest-resistant rice TT51-1 kind is researched and developed by Hua Zhong Agriculture University, and the kind obtains the Ministry of Agriculture of China and issues at present
The safety certificate of hair, while also obtaining the edible license in the U.S..Carry out fast accurate for transgenic paddy rice TT51-1
Detection method research is technical support and guarantee that GMO bio-safety management relevant laws and regulations are smoothly implemented.
Detection of GMOs technology is broadly divided into two major classes: one kind is using exogenous DNA as test object, such as PCR, gene core
Piece etc., it is another kind of using the protein of exogenous gene expression as test object, such as ELISA, immunity test strip.In the above method
In, round pcr is most widely used at present, but the transgenic detection method of based on PCR needs PCR instrument, gel imaging system etc.
Special instrument equipment, and expand longer (about 3~4h) with the product detection time, it is difficult to reach field quick detection purpose, therefore,
A kind of detection GMOs new technology that is more convenient, accurate and being suitable for execute-in-place is needed in actual operation.
RPA technology is a kind of novel gene amplification technology, depends on three kinds of enzymes: can combine single-chain nucleic acid (few core
Thuja acid primer) recombinase, single-stranded DNA binding protein (SSB) and strand displacement archaeal dna polymerase.The mixture of these three enzymes is normal
Also active under temperature, optimal reaction temperature is at 37 DEG C or so.The Protein-DNA mixtures that recombinase is formed in conjunction with primer, can be
Homologous sequence is found in double-stranded DNA.Once primer located homologous sequence, Exchange reaction of chain will occur and in strand displacement DNA
It polymerize starting DNA synthesis under enzyme effect, exponential amplification is carried out to the target area in template, the DNA chain being replaced and SSB are tied
It closes, prevents from further replacing.In this system, a compound event is originated by two opposite primers.Whole process carries out
Must be very fast, can generally obtain within ten minutes can detect horizontal amplified production.The basic characteristics of the technology are: 1. constant temperature
Amplification: entire amplified reaction is carried out at (37~42 DEG C) of constant temperature, does not need special instruments and equipment；2. rapidly and efficiently: entire
Amplification and product detection can be completed in 30 minutes；3. high specific: recombinase and primer form complex, special searching target
Sequence is marked, along with the specific recognition and signal collection of probe, specific amplification is high；4. highly sensitive: detectable limit can be down to
10 copies or lower；5. identification is easy: by the presence or absence of amplification fluorescent curve, easily being detected to amplified production.
RPA method have the characteristics that rapidly and efficiently, easy to operate, high specificity, high sensitivity, do not need specific apparatus,
It is suitble to field quick detection, has broad application prospects in transgenic plant detection field.There has been no utilize RPA method at present
Detect the detection method and kit of transgenic paddy rice TT51-1.
Summary of the invention
The purpose of the present invention is intended to provide the primer and probe of RPA detection transgenic paddy rice TT51-1 a kind of, and a kind of
The method and kit of detection transgenic paddy rice TT51-1 that can be quick, easy, special.
The present invention is realized especially by following technical scheme:
According to the nucleotide sequence of the specificity of transformant of transgenic paddy rice TT51-1, design transgenic paddy rice TT51-1's
RPA detection primer, the primer include forward primer F and reverse primer R, and nucleotide sequence is specific as follows shown:
Forward primer F:CCACATAGCAGAACTTTAACCCCCGAACAT (SEQ ID NO:1)；
Reverse primer R:ACAAAGGACAAATTTGTAATTTTGGAACAT (SEQ ID NO:2)；
Application of the above-mentioned primer in RPA detection transgenic paddy rice TT51-1 germ plasm resource.
The application on the other hand provide RPA detection transgenic paddy rice TT51-1 germ plasm resource probe, the probe with it is upper
It states primer to be used cooperatively, the probe nucleotide sequence are as follows:
P:
GCAGGTCGACTCTAGAGGATCCCGGACGAG[FAM-dT][THF]C[BHQ1-dT]GGGGCAGATAAGC-
C3-Spacer (SEQ ID NO:3).
A kind of RPA detection kit of transgenic paddy rice TT51-1, including above-mentioned forward primer F, reverse primer R and probe
P。
The RPA detection kit specifically includes following components:
1) detection primer and probe solution: forward primer F (10 μm of ol/L), reverse primer R (10 μm of ol/L), probe P (10
μmol/L)；
2) Buffer A: include 50mmol/L Tris-HCl, 8.4 pH, 80mmol/L KAc, 2mmol/L DTT,
3mmol/L ATP, 200 μm of ol/L dNTPs, 20mmol/L C4H10N3O5P, 100ng/ μ L creatine kinase, 5%
20mol/L PEG, 600ng/ μ L SSB, 125ng/ μ L uvsX, 25ng/ μ L uvxY, 30ng/ μ L Bsu and 96ng/ μ L Exo
Ⅲ；
3) BufferB:10mmol/L MgAc；
4) positive control, transgenic paddy rice TT51-1 powder (content 0.1%).
On the basis of mentioned reagent box, another aspect of the present invention discloses the RPA inspection of transgenic paddy rice TT51-1 a kind of
Survey method, specifically includes the following steps:
1) genomic DNA of sample to be tested is extracted；
2) RPA for preparing sample to be tested detects reaction system: 2 μ L of template DNA, inspection being added in 200 μ L PCR reaction tubes
Survey each 1 μ L of positive and negative primer solution, 0.5 μ L of probe solution, 23.5 μ L of BufferA solution, 2 μ L of BufferB solution, total volume 30
μL；
3) operation RPA amplification judges with result: PCR reaction tube being placed in fluorescence detector, 37~42 DEG C of incubations
20min analyzes amplification according to the presence or absence of fluorescence curve amplification in real time.
Beneficial effects of the present invention:
The present invention is based on recombinase polymeric enzymatic amplification technologies to detect transgenic paddy rice TT51-1 germ plasm resource, is demonstrate,proved by experiment
Bright, the RPA detection primer and probe combinations, kit and detection method of transgenic paddy rice TT51-1 provided by the invention has fast
The advantages that speed efficient, easy to operate, high specificity.
Detailed description of the invention
Fig. 1 is the result figure that specificity and sensitivity technique are carried out in the embodiment of the present invention 4.
Specific embodiment
Below in conjunction with specific embodiment of the present invention, technical solution of the present invention is clearly and completely described, is shown
So, described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Based on the reality in the present invention
Example is applied, every other embodiment obtained by those of ordinary skill in the art without making creative efforts all belongs to
In the scope of protection of the invention.
The design and screening of embodiment 1 transgenic paddy rice TT51-1RPA detection primer and probe
The target area that TT51-1RPA is detected in the present invention is the specificity of transformant sequence of TT51-1, i.e. external source is inserted into
The connection region sequence of segment and rice genome, forward and reverse primer therein is located at the two sides of tie point, and probe then covers
Join domain is covered.
(1) design of primers
5 primers, primer length 30-32bp are respectively designed in the two sides of tie point respectively, the present invention screens primer sequence
It is as follows:
F1:CCACATAGCAGAACTTTAACCCCCGAACAT；
F2:CGCCTCGCTCCAGTCAATGACCGCTGTTAT；
F3:GCGGCCATTGATTTGTAGAGAGAGACTGGT；
F4:CCCCGAACATCGCCTCGCTCCAGTCAATGA；
F5:ATTTGTAGAGAGAGACTGGTGATTTCAGCG；
R1:TGGATTTCTTACATGAAAATTGCAACAAAT；
R2:ACAAAGGACAAATTTGTAATTTTGGAACAT；
R3:ATGAGTGGTAGCGTCCAGAAGGAAAAGGAA；
R4:GGAAAAGGAATATGTTCGTAGCCCCACCAC；
R5:AATTTGTAATTTTGGAACATATGAGTGGTA。
(2) probe designs
Design principle: probe sequence covers join domain, and the length of probe is 46-52bp, in interphase away from 1-5 base
Thymidine (T) on respectively mark fluorescent group, 5 ' end T on mark fluorophor (such as FAM), 3 ' end T on mark it is sudden
Go out group (such as BHQ1), designs abasic site analog in the middle position of two fluorophors, such as tetrahydrofuran (THF),
It is marked in 3 ' ends of probe with C3, it is prevented to extend amplification.As probe and target area pairing, exonuclease (exo
III it) identifies the site THF and cuts probe, separate fluorophor and quencher, to generate fluorescence.
TT51-1-P:GCAGGTCGACTCTAGAGGATCCCGGACGAG[FAM-dT][THF]C[BHQ1-dT]
GGGGCAGATAAGC-C3-Spacer。
(3) screening strategy of primer and probe
It selects a forward primer and all reverse primers to match, carries out RPA amplification respectively in connection with probe, select expansion
The optimal reverse primer of synergy fruit is now expanded using optimal reverse primer and other forward primer pairings, to select
Optimal forward primer is selected out, best primer pair is F1/R2 in the present invention.
The optimization of 2 RPA reaction system of embodiment
(1) determination of temperature is expanded
Under the other amplification condition unanimous circumstances of RPA, RPA amplification is carried out in 30-45 DEG C of temperature range, according to not
The power of synthermal lower fluorescence signal intensity determines the best amplification temperature of RPA, final to determine that best amplification temperature is 39 DEG C.
(2) concentration of primer and probe determines
Primer is 10 μm of ol/L as the compound concentration of probe, and the other amplification conditions of RPA are consistent, most at 39 DEG C
It expands, various concentration primer is expanded with probe combinations respectively, according to fluorescence signal under various combination at a temperature of good amplification
The power of intensity determines the best primer and concentration and probe concentration of RPA, final to determine that optium concentration is, in the RPA that total volume is 30 μ L
In amplification system, each 1 μ L of positive and negative primer solution, 0.5 μ L of probe solution are detected.
The foundation of 3 kit of embodiment and its detection method
The RPA detection kit of transgenic paddy rice TT51-1 is prepared according to the following formula, the specification of each kit is 50 times
Reaction:
(1) detection primer and probe solution: synthesis forward primer F, reverse primer R and probe P, by primer and probe dry powder
It is made into the mother liquor that concentration is 10 μm of ol/L respectively with sterile deionized water or ultrapure water, wherein primer sequence is respectively as follows:
Forward primer F:CCACATAGCAGAACTTTAACCCCCGAACAT (SEQ ID NO:1)；
Reverse primer R:ACAAAGGACAAATTTGTAATTTTGGAACAT (SEQ ID NO:2)；
Probe P:
GCAGGTCGACTCTAGAGGATCCCGGACGAG[FAM-dT][THF]C[BHQ1-dT]GGGGCAGATAAGC-
C3-Spacer (SEQ ID NO:3).
(2) BufferA (1.5mL): including 50mmol/L Tris-HCl, 8.4 pH, 80mmol/L KAc, 2mmol/L
DTT, 3mmol/L ATP, 200 μm of ol/L dNTPs, 20mmol/L C4H10N3O5P, 100ng/ μ L creatine kinase,
5%20mol/L PEG, 600ng/ μ L SSB, 125ng/ μ L uvsX, 25ng/ μ L uvxY, 30ng/ μ L Bsu and 96ng/ μ L
ExoⅢ。
(3) Buffer B (120 μ L): 10mmol/L MgAc.
It further include positive control in kit: transgenic paddy rice TT51-1 powder (content 0.1%).
Sample to be tested is detected by the following method with mentioned reagent box:
(1) extract the genomic DNA of sample to be tested: traditional DNA extraction method is other with effect commercial kit, extracts
The genomic DNA of sample to be tested is diluted to 25ng/ μ L；
(2) RPA for preparing sample to be tested detects reaction system: using the reaction system of 30 μ L, in 200 μ L PCR reaction tubes
2 μ L of template DNA, each 1 μ L of the positive and negative primer solution of detection, 0.5 μ L of probe solution, 23.5 μ L of Buffer solution A, Buffer is added
2 μ L of B solution
(3) operation RPA amplification judges with result: PCR reaction tube being placed in fluorescence detector, 37~42 DEG C of incubations
20min analyzes amplification according to the presence or absence of fluorescence curve amplification in real time, is if having typical fluorescent amplification curve to occur
The positive is negative if without amplification curve.
The specificity and sensitivity of 4 kit of embodiment and detection method
The specificity of kit described in embodiment 3 and its detection method is tested, test sample both includes turning base
Because of rice sample, also includes some common genetically engineered soybeans, corn, cotton, rape sample, be respectively as follows:
(1) S1: transgenic paddy rice TT51-1 (content 1%)；
(2) S2: transgenic paddy rice TT51-1 (content 0.1%)；
(3) S3: transgenic paddy rice TT51-1 (content 0.05%)；
(4) S4: transgenic paddy rice mixing sample (contains M12, KF-8, KF-2, G6H1, KF-6, KMD-1, every kind of transgenosis
1%) content of ingredient is；
(5) S5: genetically engineered soybean mixing sample (containing GST40-3-2, A5547-127, A2704-12, CV127,
1%) MON87701, MON87708, MON87769,356043, the content of every kind of transgene component are；
(6) S6: transgenic corns mixing sample (containing Bt11, Bt176, MON863, NK603, GA21, MIR604, T25,
1%) content of every kind of transgene component is；
(7) S7: transgene cotton mixing sample (containing MON1445, MON531, MON15985, MON88913, GHB614,
1%) content of every kind of transgene component is；
(8) S8: transgene rape mixing sample (containing MS1, MS8, RF1, RF2, RF3, T45, every kind of transgene component
1%) content is；
(9) S9: non-transgenic rice control；
(10) S10: non-transgenic crop compares (containing Non-transgenic soybean, corn, cotton, rape)；
(11) S11: ultrapure water blank control.
As a result as shown in Figure 1, only there is curve amplification bent in the present embodiment in the sample containing transgenic paddy rice TT51-1
Line shows that kit of the present invention and detection method have specificity well to transgenic paddy rice TT51-1, meanwhile,
Be respectively containing transgenic paddy rice TT51-1 content 1%, 0.1% and 0.05% sample in have good amplification curve, show
Kit of the present invention and detection method have good sensitivity to transgenic paddy rice TT51-1, at least up to
0.05%.
It although an embodiment of the present invention has been shown and described, for the ordinary skill in the art, can be with
Understand without departing from the principles and spirit of the present invention can to these examples carry out it is a variety of variation, modification, replacement and
Modification, the scope of the present invention is defined by the appended.
Sequence table
<110>Zhejiang Academy of Agricultural Science
<120>a kind of primer, probe and kit and method for detecting transgenic paddy rice TT51-1
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
ccacatagca gaactttaac ccccgaaca 29
<210> 2
<211> 30
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
acaaaggaca aatttgtaat tttggaacat 30
<210> 3
<211> 45
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gcaggtcgac tctagaggat cccggacgag cggggcagat aagcc 45
Claims (9)
1. a kind of RPA detection primer of transgenic paddy rice TT51-1, which is characterized in that the primer include forward primer F and
The nucleotide sequence of reverse primer R, the forward primer F are as shown in SEQ ID NO.1, the nucleosides of the reverse primer R
Acid sequence is as shown in SEQ ID NO.2.
2. application of the RPA detection primer described in claim 1 in detection transgenic paddy rice TT51-1 germ plasm resource.
3. a kind of probe of RPA detection transgenic paddy rice TT51-1 germ plasm resource, which is characterized in that the probe is wanted with right
Primer described in asking 1 is used cooperatively, and the probe nucleotide sequence is as shown in SEQ ID NO.3.
4. a kind of RPA detection kit of transgenic paddy rice TT51-1, which is characterized in that including forward direction described in claim 1
Primers F and reverse primer R.
5. the RPA detection kit of transgenic paddy rice TT51-1 according to claim 4 a kind of, which is characterized in that including
Probe as claimed in claim 3.
6. a kind of RPA detection method of transgenic paddy rice TT51-1, which comprises the following steps:
1) genomic DNA of sample to be tested is extracted；
2) RPA for preparing sample to be tested detects reaction system: 2 μ L of template DNA, detection being added in 200 μ L PCR reaction tubes just
Each 1 μ L of anti-primer solution, 0.5 μ L of probe solution, 23.5 μ L of Buffer solution A, 2 μ L of Buffer B solution, total volume are 30 μ
L；
3) operation RPA amplification judges with result: PCR reaction tube being placed in fluorescence detector, 37~42 DEG C of incubation 20min, root
According to the presence or absence of fluorescence curve amplification, amplification is analyzed in real time.
7. detection method according to claim 6, which is characterized in that the concentration of the positive and negative primer and probe solution is
10μmol/L。
8. detection method according to claim 6, which is characterized in that the Buffer A includes: 50mmol/L
Tris-HCl, pH 8.4,80mmol/L KAc, 2mmol/L DTT, 3mmol/L ATP, 200 μm of ol/L dNTPs, 20mmol/L
C4H10N3O5P, 100ng/ μ L creatine kinase, 5%20mol/L PEG, 600ng/ μ L SSB, 125ng/ μ L uvsX,
25ng/ μ L uvxY, 30ng/ μ L Bsu and 96ng/ μ L Exo III.
9. detection method according to claim 6, which is characterized in that the Buffer B is 10mmol/L MgAc.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811222905.8A CN109136339A (en) | 2018-10-19 | 2018-10-19 | A kind of primer, probe and kit and method detecting transgenic paddy rice TT51-1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811222905.8A CN109136339A (en) | 2018-10-19 | 2018-10-19 | A kind of primer, probe and kit and method detecting transgenic paddy rice TT51-1 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109136339A true CN109136339A (en) | 2019-01-04 |
Family
ID=64809024
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811222905.8A Pending CN109136339A (en) | 2018-10-19 | 2018-10-19 | A kind of primer, probe and kit and method detecting transgenic paddy rice TT51-1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109136339A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101302520B (en) * | 2008-07-01 | 2012-04-25 | 中国农业科学院油料作物研究所 | Transgenic rice TT51-1 transformation event foreign vector integration site complete sequence and use thereof |
| CN103361409A (en) * | 2012-04-10 | 2013-10-23 | 中国计量科学研究院 | Nucleic acid quantitative detection kit for transgenic rice TT51-1 |
| CN103451292A (en) * | 2013-09-02 | 2013-12-18 | 中国农业科学院生物技术研究所 | Identification of specificity of transgenic rice Huahui 1 by applying recombinase polymerase amplification (RPA) technology |
| CN103773836A (en) * | 2012-10-24 | 2014-05-07 | 天津市农业质量标准与检测技术研究所 | Method for rapid detection of transgenic rice line TT51-1 |
-
2018
- 2018-10-19 CN CN201811222905.8A patent/CN109136339A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101302520B (en) * | 2008-07-01 | 2012-04-25 | 中国农业科学院油料作物研究所 | Transgenic rice TT51-1 transformation event foreign vector integration site complete sequence and use thereof |
| CN103361409A (en) * | 2012-04-10 | 2013-10-23 | 中国计量科学研究院 | Nucleic acid quantitative detection kit for transgenic rice TT51-1 |
| CN103773836A (en) * | 2012-10-24 | 2014-05-07 | 天津市农业质量标准与检测技术研究所 | Method for rapid detection of transgenic rice line TT51-1 |
| CN103451292A (en) * | 2013-09-02 | 2013-12-18 | 中国农业科学院生物技术研究所 | Identification of specificity of transgenic rice Huahui 1 by applying recombinase polymerase amplification (RPA) technology |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109337959A (en) | A kind of RPA detection primer of transgenic corns MON810 and probe combinations, kit and detection method | |
| CN106434993B (en) | For detecting LAMP primer composition object and its application of cucumber fusarium axysporum | |
| CN106399490B (en) | LAMP primer group for detecting phytoplasma and kit and application thereof | |
| CN105087825A (en) | Method, reagent, primer and probe for quickly detecting Ebola viruses under constant-temperature and isothermal conditions | |
| US20160298182A1 (en) | Nucleic acid detection and quantification | |
| CN109136338A (en) | A kind of primer, probe and kit and method detecting genetically engineered soybean MON89788 | |
| CN109136341A (en) | A kind of primer, probe and kit and method detecting genetically engineered soybean A2704-12 | |
| CN110396543A (en) | A kind of tumour associated gene mutation site screening method | |
| CN109136340A (en) | A kind of primer, probe and kit and method detecting transgene rape Oxy-235 | |
| CN109055501A (en) | A kind of primer, probe and kit and method detecting genetically engineered soybean GST40-3-2 | |
| CN109182585A (en) | A kind of primer, probe and kit and method detecting transgenic corns TC1507 | |
| CN107815490A (en) | A kind of tobacco root-knot pathogeny detecting reagent box and its application method based on loop-mediated isothermal amplification technique | |
| CN109161585A (en) | A kind of primer, probe and kit and method detecting transgenic corns MIR604 | |
| CN107828912A (en) | A kind of dosporium cucumerinumand LAMP detection primer and detection method | |
| CN109136339A (en) | A kind of primer, probe and kit and method detecting transgenic paddy rice TT51-1 | |
| CN116516059A (en) | Method and kit for visually detecting phoma sojae atricolor | |
| CN109234432B (en) | Primer, probe and kit for detecting soybean damping-off based on recombinase polymerase amplification method | |
| CN109234434A (en) | A kind of primer, probe and kit and method detecting transgenic paddy rice G6H1 | |
| CN105063207B (en) | Genetically engineered soybean MON87705 LAMP detection primer group, kit and detection method | |
| Cao et al. | Characterization of reference gene expression in tung tree (Vernicia fordii) | |
| CN109280717A (en) | A kind of RPA detection primer of transgene rape T45 and probe combinations, kit and detection method | |
| CN109055592A (en) | A kind of anti-ring spot virus papaya YK16-0-1 of transgenosis and its efficient qualitative, quantitative identification method of spin-off | |
| CN108315391A (en) | It is a kind of to be used for the Primer composition and its application that pomegranate dry rot germ LAMP is quickly detected | |
| CN110564822B (en) | LAMP technology-based transgenic corn Bt 176-related gene detection method and kit | |
| JP2006075167A (en) | Real time pcr accompanying addition of pyrophosphatase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190104 |
|
| RJ01 | Rejection of invention patent application after publication |