CN109134541B - Long-chain biotin marker and preparation method and application thereof - Google Patents
Long-chain biotin marker and preparation method and application thereof Download PDFInfo
- Publication number
- CN109134541B CN109134541B CN201811051423.0A CN201811051423A CN109134541B CN 109134541 B CN109134541 B CN 109134541B CN 201811051423 A CN201811051423 A CN 201811051423A CN 109134541 B CN109134541 B CN 109134541B
- Authority
- CN
- China
- Prior art keywords
- long
- biotin
- chain
- intermediate product
- molecule
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
- C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic System
- C07F9/02—Phosphorus compounds
- C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
- C07F9/6561—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing systems of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring or ring system, with or without other non-condensed hetero rings
- C07F9/65618—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing systems of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring or ring system, with or without other non-condensed hetero rings containing the ring system, e.g. flavins or analogues
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Abstract
The invention discloses a long-chain biotin marker and a preparation method and application thereof. The long-chain biotin label of the invention comprises a biotin molecule, a spacer arm and a reactive group. The biotin molecule comprises a cyclic structure and a valeric acid side chain, the spacer arm has a structure shown in a formula (I), the reaction group has a structure shown in a formula (II), the valeric acid side chain in the biotin molecule is connected with NH at the first end of the spacer arm, and oxygen at the second end of the spacer arm is combined with phosphorus of the reaction group to form an O-P bond, so that the spacer arm is connected with the reaction group. The long-chain biomarker can be used for capture sequencing of genes. -NH (CH)2)mO‑(‑C＝O‑NH‑(CH2‑CH2O‑)4)nFormula (I)
Description
Technical Field
The invention relates to a biomarker for gene sequencing, in particular to a long-chain biotin marker for gene sequencing, especially second-generation sequencing, and a preparation method and application thereof.
Background
Second generation sequencing plays an increasingly important role in molecular biology and clinical medicine. The target region capture sequencing is a means with very high neutral cost ratio in the second-generation sequencing application, and has wide application space in the fields of genetic diseases and tumor scientific research and clinical diagnosis. The principle is to design a specific complementary probe for the genomic region of interest, hybridize it with genomic DNA, enrich the DNA fragments of the target genomic region, and then perform high throughput sequencing.
The key steps of capture enrichment are that biotin modified single-stranded DNA is used as a capture reagent to capture a target region of interest in a genome, and then the target region is separated in a magnetic field by utilizing the natural specific binding capacity of Streptavidin (SA) and biotin and binding with SA modified magnetic beads.
The region trapping can be classified into a solid phase hybridization method and a liquid phase hybridization method according to the state of hybridization. The probes used in the solid phase hybridization method are usually immobilized on a solid support such as a gene chip. After hybridization, the DNA fragments that are not hybridized are eluted, and then the DNA that is hybridized with the probe is eluted. Liquid phase hybridization is now more prevalent. The biggest difference in hybridization with solid phase is that solution phase hybridization directly hybridizes the target DNA fragment and the biotin-labeled probe in solution. The companies currently using this technology include mainly foreign biotechnology companies. Such as agilent, roche, seemer fly, etc.
The existing biotin modification can be randomly doped on a DNA chain by adding biotin-modified dUTP (Deoxyuridine Triphosphate) for replication. The biotin and avidin are bound to each other with high affinity and high specificity. The biotin molecule has two cyclic structures, where the imidazolone ring is the main site for avidin binding; a further thiophene ring with a mono-pentanoic acid side chain at C2 may provide some space, but this side chain is not long enough. Therefore, biotin and DNA are generally linked by an organic long chain molecule, thereby adjusting the distance therebetween. Hexane chains, triethylene glycol (TEG) chains or chains of other lengths are generally used, for example, Biotin-16-dUTP (CASSnumber 136632-31-0) incorporated during DNA replication uses organic molecular chains of 16 atoms in length. However, these long organic chains do not fully satisfy the current needs, particularly in the context of second-generation sequencing.
Disclosure of Invention
In order to solve at least part of technical problems in the prior art, the invention researches the influence of an organic long-chain structure between a biotin molecule and an oligonucleotide on probe capture in secondary sequencing, finds that the long-chain biotin molecule with a specific structure is particularly suitable for secondary sequencing, and the capture efficiency is gradually improved within a specific chain length range. The present invention has been accomplished, at least in part, based on the above. Specifically, the present invention includes the following.
In a first aspect of the present invention, there is provided a long-chain biotin label comprising a biotin molecule, a spacer and a reactive group, wherein the biotin molecule comprises a cyclic structure and a pentanoic acid side chain, the spacer has a structure represented by formula (I), the reactive group has a structure represented by formula (II), the pentanoic acid side chain in the biotin molecule is linked to NH at a first end of the spacer, and oxygen at a second end of the spacer is bound to phosphorus of the reactive group to form an O — P bond, thereby linking the spacer to the reactive group,
-NH(CH2)mO-(-C＝O-NH-CH2-CH2O)n-formula (I)
In the formula (I), m and n independently represent an integer of 1-10,
in certain embodiments, the biotin molecule in the long-chain biotin labels of the invention is protected by a DMT group.
In certain embodiments, m in formula (I) of the long-chain biotin marker of the present invention is an integer of 4 to 6, and n is an integer of 1 to 3.
In a second aspect of the present invention, there is provided a method for preparing a long-chain biotin marker according to the first aspect of the present invention, comprising:
(1) reacting biotin with DMT-Cl in pyridine solution to obtain an intermediate product A;
(2) reacting intermediate product A with aminohexanol in anhydrous dimethylformamide to obtain intermediate product B;
(3) activating intermediate product B with p-nitrophenol chloroformate in anhydrous acetonitrile, then reacting with amino-PEG 3-alcohol to obtain intermediate product C1, and repeating the step n-1 times by using the intermediate product C1 instead of the intermediate product B to obtain intermediate product Cn, wherein n is an integer of 1-10;
(4) in anhydrous acetonitrile, the intermediate product Cn reacts with a phosphorus reagent under the action of tetrazole to obtain the long-chain biotin marker.
In certain embodiments, disuccinimidyl carbonate is used as a catalyst in step (2) of the process of the present invention.
In certain embodiments, the phosphorus reagent in step (4) of the process of the present invention is 2-cyanoethyl-N, N' -tetraisopropylphosphorodiamidite.
In a third aspect of the invention, there is provided a use of the long-chain biotin marker of the first aspect of the invention in the preparation of a gene sequencing/detection probe.
In a fourth aspect of the invention, there is provided an oligonucleotide comprising a long-chain biotin label as defined in the first aspect of the invention and an oligonucleotide sequence, wherein the long-chain biotin label is bound to a hydroxyl group at the 5' end of the oligonucleotide sequence.
In a fifth aspect of the present invention, there is provided a method for preparing an oligonucleotide, comprising:
(1') a step of synthesizing an oligonucleotide sequence from a plurality of nucleotides; and (2 ') a step of combining the long-chain biotin label, which comprises mixing and activating the long-chain biotin label by using tetrazole, and then reacting the long-chain biotin label with the hydroxyl of the last base at the 5' end of the oligonucleotide sequence obtained in the step (1); then oxidation and DMT deprotection are performed.
In a sixth aspect of the invention there is provided the use of a long-chain biotin label according to the first aspect of the invention or an oligonucleotide according to the fourth aspect of the invention in secondary sequencing.
The long-chain biotin marker disclosed by the invention can be used for capture sequencing of specific genes. Through sequencing verification, the capture efficiency can reach more than 80%, and the method can be effectively used for sequencing the gene of the customized target region.
Drawings
FIG. 1 shows the molecular structure of Biotin-16-dUTP (CAS number 136632-31-0).
FIG. 2 is a peak diagram of the products of molecules 1 to 3 obtained by the present invention. The retention time of the elution was plotted as the absorbance at 260nm of the UV absorption after HPLC purification.
FIG. 3 is a peak plot of the control, which is the absorbance at 260nm of the UV absorbance, plotted against the retention time of the elution after HPLC purification.
FIG. 4 is a graph obtained by combining the product obtained by the present invention and a control.
FIG. 5 is a mass spectrometric identification of the products of the long-chain biotin modification.
FIG. 6 comparison of capture efficiency of different biotin-modified probes by hybridization. The three columns are grouped together in the figure. The left bar in each set of bars represents the proportion of the target region that is captured. The middle bar indicates the base ratio aligned to the target region. The right bars represent the ratio of reads to target area.
Detailed Description
Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that the upper and lower limits of the range, and each intervening value therebetween, is specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control. Unless otherwise indicated, "%" is percent by weight.
[ Long-chain Biotin marker ]
In a first aspect of the invention, a long-chain biotin marker is provided. It is a biotin molecule having a long side chain (sometimes referred to herein as a long-chain biotin molecule), and is referred to herein as a long-chain biotin marker because it can be used as a molecular marker in the fields of gene sequencing and the like. Compared with the general biotin marker, the long-chain biotin marker has at least longer side chain and higher activity. Preferably, the side chains in the long-chain biotin labels of the present invention do not include branched structures, particularly carbon branched structures, nor any cyclic structures, such as benzene rings or cycloalkyl structures. In addition, the side chain of the long-chain biotin label of the present invention does not include a carbon-carbon double bond. The present inventors have found that although the side chain can be made longer by a branched structure, a cyclic structure, a carbon-carbon double bond, and the like, these structures affect the flexibility of the side chain and, when bound to an oligonucleotide, affect the binding of the oligonucleotide to its complementary sequence, and therefore, the above-mentioned groups are preferably not contained in the spacer group.
The long-chain biomarkers of the invention include a biotin molecule, a spacer arm, and a reactive group. Wherein the biotin molecule comprises a cyclic structure and a pentanoic acid side chain, the spacer has a structure shown in formula (I), and the reactive group has a structure shown in formula (II). As shown in formula (I), the spacer arm has a first extension and a second extension, and one end (i.e., a first end) of the first extension has an NH group. The second extension is a repeating segment. One end (i.e., the second end) thereof is oxygen. The pentanoic acid side chain in the biotin molecule is linked to the NH at the first end of the spacer arm. The oxygen at the second end of the spacer arm combines with the phosphorus of the reactive group to form an O-P bond, thereby linking the spacer arm to the reactive group. The linkage of pentanoic acid to the first end of the spacer is obtained by reaction of a carboxyl group with an amine group. Thus, the attachment of the pentanoic acid side chain of the biotin molecule to the NH at the first end of the spacer arm is via- (C ═ O) -NH-.
-NH(CH2)mO-(-C＝O-NH-CH2-CH2O)n-formula (I)
In the formula (I) of the present invention, m and n each independently represent an integer of 1 to 10. In order to improve the capture efficiency, m is preferably an integer of 3 to 10, more preferably an integer of 4 to 8. For example, m may be 5, 6 or 7. In addition, n is preferably an integer of 1 to 5, more preferably an integer of 1 to 4. For example, n can be 1, 2, 3, or 4, and the like. If m or n is greater than the above range, on the one hand, the difficulty of synthesis increases, and on the other hand, as the chain length further increases, the capture effect of the oligonucleotide after binding to the oligonucleotide does not increase significantly. Therefore, m and n of the present invention are preferably within the above-mentioned ranges.
In formula (II) of the present invention, the reactive group includes cyanoethyl and two isopropyl groups. The reactive group with the structure is particularly favorable for nucleophilic reaction with hydroxyl in nucleic acid, and the phosphorus atom in the formula (II) is attacked by the hydroxyl in the nucleic acid, so that the long-chain biotin marker is ensured to have higher reactivity.
In certain embodiments, the biotin molecule of the long-chain biotin labels of the invention is protected by a DMT group. Preferably, the DMT group is bound to the N in the imidazolone ring of biotin. Preferably, the DMT group is used to protect the more reactive of the two NH groups of the biotin molecule.
[ method for preparing Long-chain Biotin marker ]
In a second aspect of the present invention, there is provided a method for preparing a long-chain biotin label, which comprises at least the following four steps.
Step (1)
Step (1) of the present invention is a step of DMT protection of a biotin molecule before carrying out a synthesis reaction. Specifically, comprises reacting biotin and DMT-Cl in pyridine solution to obtain intermediate product A. More specifically, the starting biotin and DMT-Cl materials are dissolved in a pyridine solution in a molar amount of 1:2 to 1:5, and heated in a water bath at 50 to 90 deg.C (e.g., 80 deg.C) for 1 to 8 hours, preferably 2 to 6 hours, e.g., 4 hours, to obtain a crude product. Then adding water and dichloromethane into the crude product, shaking up, separating a dichloromethane layer, adding anhydrous sodium sulfate and drying. After rotary evaporation of the dichloromethane layer, the mixture was separated on a silica gel column to give intermediate a.
Step (2)
Step (2) of the present invention is a step of obtaining the first extension. Namely, a step of adding aminohexanol to the end of the valeric acid side chain. The present invention can be carried out using known methods. Preferably, step (2) of the present invention comprises reacting intermediate a with aminohexanol in anhydrous dimethylformamide to give intermediate B. More preferably, step (2) comprises dissolving intermediate A in anhydrous DMF (dimethylformamide), and reacting with 1:1 molar amount of aminohexanol under the action of a catalyst such as disuccinimidyl carbonate DSC (disuccinimidyl carbonate) for 1 hour to condense to obtain a crude product. Adding water and dichloromethane, shaking, separating dichloromethane layer, adding anhydrous sodium sulfate, and drying. After rotary evaporation of the dichloromethane layer, the mixture was separated on a silica gel column to give intermediate B.
Step (3)
Step (3) of the present invention is a step of obtaining a second extension. That is, the side chain is added with-C ═ O-NH- (CH)2-CH2O)4-a step of repeating the structural unit. In the side chain, -C ═ O-NH- (CH)2-CH2O)4The number of repetitions n of the repeating structural unit is not limited. The meaning of n is explained for formula (I).
Step (3) of the present invention may comprise activating intermediate B with p-nitrophenol chloroformate in anhydrous acetonitrile followed by reaction with amino-PEG 3-alcohol to give intermediate C1. This step was repeated n-1 times again with this intermediate C1 replacing intermediate B to give intermediate Cn, wherein n has the same meaning as n in formula (I).
In certain embodiments, where n in step (3) is 1, then step (3) comprises activating intermediate B with p-nitrophenol chloroformate in anhydrous acetonitrile only, followed by reaction with amino-PEG 3-ol to give intermediate C1 without the need for subsequent repetition. In this case, the intermediate product C1 contains only one-C ═ O-NH- (CH)2-CH2O)4-a structural unit.
In certain embodiments, where n in step (3) is 2, then step (3) comprises activating intermediate B with p-nitrophenol chloroformate in anhydrous acetonitrile followed by reaction with amino-PEG 3-alcohol to give intermediate C1. Thereafter, this step was repeated again 1 time with intermediate C1 instead of intermediate B to give intermediate C2. Intermediate C2 includes two-C ═ O-NH- (CH)2-CH2O)4-a structural unit.
In certain embodiments, where n in step (3) is 3, then step (3) comprises activating intermediate B with p-nitrophenol chloroformate in anhydrous acetonitrile followed by reaction with amino-PEG 3-alcohol to give intermediate C1. Thereafter, this step was repeated 1 time with intermediate C1 instead of intermediate B to give intermediate C2. This step was then repeated 1 time with intermediate C2 replacing intermediate C1 to give intermediate C3. Intermediate C3 includes three-C ═ O-NH- (CH)2-CH2O)4-a structural unit. By analogy, those skilled in the art can readily understand that n-C ═ O-NH- (CH)2-CH2O)4-side chains of the building blocks.
Step (4)
Step (4) of the present invention is a step of adding a reactive group to the side chain terminal of the final intermediate product Cn. The method comprises the step of reacting an intermediate product Cn with a phosphorus reagent under the action of tetrazole in anhydrous acetonitrile to obtain the long-chain biotin marker. Specifically, the method comprises the steps of dissolving the intermediate product Cn in anhydrous acetonitrile, and reacting with a phosphorus reagent with the molar weight of 1:1 for 10 minutes under the catalysis of tetrazole to obtain a crude product. Water and dichloromethane were added, shaking was carried out, the dichloromethane layer was separated, and dried by adding anhydrous sodium sulfate. After rotary evaporation of the dichloromethane layer, the mixture was separated on a silica gel column to give the long-chain biotin molecule of the invention. The phosphorus reagent in step (4) is preferably 2-cyanoethyl-N, N, N 'N' -tetraisopropylphosphorodiamidite.
[ first use ]
A third aspect of the invention is the use of the long-chain biotin marker of the first aspect of the invention in the preparation of a gene sequencing/detection probe. Referred to herein simply as the first use. The long-chain biotin labels of the invention can be combined with oligonucleotide sequences to give oligonucleotides as described herein, which can be used as molecular labels. Preferably, the molecular marker is a probe for gene sequencing or detection. More preferably, the long-chain biotin markers of the invention are used for capture sequencing of specific genes, in particular for sequencing of target region genes efficiently for customization.
[ oligonucleotide ]
In a fourth aspect of the invention, oligonucleotides are provided. The oligonucleotides of the invention include long-chain biotin labels and oligonucleotide sequences as described in the first aspect of the invention. Wherein the long-chain biotin label is bound to the hydroxyl group at the 5' end of the oligonucleotide sequence. When the long-chain biotin marker is combined with the hydroxyl at the 5' end of the oligonucleotide sequence, the hydroxyl at the 5' end attacks the P atom in the reaction group of the long-chain biotin marker, so that the reaction group is separated from the long-chain biotin marker, and simultaneously, the oxygen atom combined with the P atom is reacted with the hydroxyl at the 5' end to form the oligonucleotide of the invention.
The sequence length of the oligonucleotide sequences of the invention is generally 50-150bp, preferably 55-100bp, more preferably 60-80 bp. The long-chain biotin markers of the invention are particularly suitable for use with oligonucleotide sequences of the above-described length ranges. If the length of the oligonucleotide sequence is too short, although the biotin label has a sufficient separation distance from the oligonucleotide molecule, the proximity of the biotin label molecule to the target gene sequence, and thus the specific binding to the target gene sequence, is affected due to the proximity of the size of the biotin label molecule to the size of the oligonucleotide sequence molecule. On the other hand, if the oligonucleotide is too long, the detection sensitivity decreases.
[ Process for producing oligonucleotides ]
In a fifth aspect of the present invention, there is provided a method for preparing an oligonucleotide, comprising at least the following steps.
Step (1')
Step (1') of the present invention is a step of synthesizing an oligonucleotide sequence from a plurality of nucleotides. The step of synthesizing the oligonucleotide may be performed using methods known in the art. Specific methods include solid phase synthesis methods and the like. In an exemplary synthesis method, it comprises:
in the first step, trichloroacetic acid (TCA) is reacted with a first nucleotide (preferably, its active group is in a protected state) previously attached to a solid support (preferably, controlled-pore glass, CPG for short), and the protecting group DMT of the 5 '-hydroxyl group of the nucleotide is removed to obtain a free 5' -hydroxyl group;
secondly, tetrazole mixed activation base Phosphoramidite monomer (nucleotide Phosphoramidite) reacts with 5' -hydroxyl on CPG;
thirdly, a capping reaction, wherein a very small amount of 5' -hydroxyl groups may not participate in the condensation reaction (less than 2 percent), and the reaction is continued after the termination with acetic anhydride and 1-methylimidazole;
a fourth step of oxidizing the phosphorous acid to a stable phosphoric acid triester with an iodine-pyridine oxidizing agent;
the above steps are repeated until the desired oligonucleotide sequence (DNA sequence) is synthesized. The color determination synthesis efficiency of the TCA treatment stage can be observed in the synthesis process.
Step (2')
Step (2 ') of the present invention is a long-chain biotin label-binding step, which comprises mixing and activating a long-chain biotin label with tetrazole, and then reacting the long-chain biotin label with a hydroxyl group of a 5' base of the oligonucleotide sequence obtained in step (1); then oxidation and DMT deprotection are performed.
[ second use ]
In a sixth aspect of the invention there is provided the use of a long-chain biotin label according to the first aspect of the invention or an oligonucleotide according to the fourth aspect of the invention in secondary sequencing. Referred to herein simply as the second use. A second use of the invention includes use as a probe in gene sequencing or detection. Preferably, the long-chain biotin markers of the invention are used for capture sequencing of specific genes, in particular for sequencing of target region genes that are efficiently customized.
The first and second uses of the invention may be the same, except that the materials themselves are different.
Example 1
Synthesis of biotin molecules:
1. synthesis of molecule 1
The synthetic route for molecule 1 is shown below:
the first step is as follows: dissolving biotin and DMT-Cl serving as raw materials in a pyridine solution according to a molar ratio of 1:3, and heating in a water bath at 80 ℃ for 4 hours to obtain a crude product. Adding water and dichloromethane into the obtained crude product, shaking up, separating a dichloromethane layer, adding anhydrous sodium sulfate and drying. After rotary evaporation of the dichloromethane layer, the mixture was separated on a silica gel column to give intermediate a.
The second step is that: the intermediate product A is dissolved in anhydrous dimethylformamide and reacts with 1:1 molar amount of amino hexanol for 1 hour under the catalysis of DSC, and the crude product is obtained by condensation. Adding water and dichloromethane into the crude product, shaking uniformly, separating a dichloromethane layer, adding anhydrous sodium sulfate and drying. After rotary evaporation of the dichloromethane layer, the mixture was separated on a silica gel column to give intermediate B.
The third step: and dissolving the intermediate product B in anhydrous acetonitrile, and reacting with a phosphorus reagent with the molar weight of 1:1 for 10 minutes under the catalysis of tetrazole to obtain a crude product. Adding water and dichloromethane into the crude product, shaking uniformly, separating a dichloromethane layer, adding anhydrous sodium sulfate and drying. After rotary evaporation of the dichloromethane layer, the mixture was separated on a silica gel column to give molecule 1. In the present invention, the molecule 1 is used as a comparative example.
2. Molecule 2 Synthesis
The synthetic route for molecule 2 is shown below:
the first step is as follows: dissolving intermediate B in anhydrous acetonitrile, activating with p-nitrophenol chloroformate, and reacting with 1:1 molar amino-PEG 3-alcohol for 10 minutes to give the crude product. Adding water and dichloromethane, shaking, separating dichloromethane layer, adding anhydrous sodium sulfate, and drying. After rotary evaporation of the dichloromethane layer, the mixture was separated on a silica gel column to give intermediate C1.
The second step is that: and dissolving the intermediate product C1 in anhydrous acetonitrile, and reacting with a phosphorus reagent with the molar weight of 1:1 for 10 minutes under the catalysis of tetrazole to obtain a crude product. Adding water and dichloromethane, shaking, separating dichloromethane layer, adding anhydrous sodium sulfate, and drying. After rotary evaporation of the dichloromethane layer, the mixture was separated on a silica gel column to give molecule 2.
3. Synthesis of molecule 3
The synthetic route for molecule 3 is shown below:
the first step is as follows: intermediate C1 was dissolved in anhydrous acetonitrile, activated with p-nitrophenol chloroformate, and reacted with 1:1 molar amino-PEG 3-ol for 10 minutes to give the crude product. Adding water and dichloromethane, shaking, separating dichloromethane layer, adding anhydrous sodium sulfate, and drying. After the dichloromethane layer is subjected to rotary evaporation, the mixture is separated on a silica gel column to obtain an intermediate product C2;
the second step is that: and dissolving the intermediate product C2 in anhydrous acetonitrile, and reacting with a phosphorus reagent with the molar weight of 1:1 for 10 minutes under the catalysis of tetrazole to obtain a crude product. Water and dichloromethane were added, shaking was carried out, the dichloromethane layer was separated, and dried by adding anhydrous sodium sulfate. After rotary evaporation of the dichloromethane layer, the mixture was separated on a silica gel column to give molecule 3.
Example 2
Firstly, DNA synthesis of long-chain biotin molecules:
a first step of reacting trichloroacetic acid (TCA) with a first nucleotide previously attached to Controlled Pore Glass (CPG) in which the reactive group is in a protected state, and removing the protecting group DMT from the 5 '-hydroxyl group of the nucleotide to obtain a free 5' -hydroxyl group;
secondly, mixing tetrazole with activated base phosphoramidite monomer, and reacting with 5' -hydroxyl on CPG;
thirdly, carrying out a cap reaction, wherein few 5' -hydroxyl groups possibly do not participate in the reaction (less than 2%) in the condensation reaction, stopping the reaction by using acetic anhydride and 1-methylimidazole, and then continuing the reaction;
a fourth step of oxidizing the phosphorous acid to a stable phosphoric acid triester with an iodine-pyridine oxidizing agent;
the above-described procedure was repeated until an oligonucleotide sequence (Oligo DNA) of a desired length was synthesized. The color determination synthesis efficiency of the TCA treatment stage can be observed in the synthesis process. Finally, mixing tetrazole and activating biotin phosphoramidite monomer, and reacting with 5' -hydroxyl of the last base of DNA on CPG; oxidation and DMT deprotection steps are then performed.
Secondly, separating, purifying and identifying the DNA of the long-chain biotin molecule:
after completion of the synthesis, Oligo DNA molecules were cleaved from CPG with ammonia water and subjected to HPLC purification. And purifying the obtained product by HPLC, and performing mass spectrum identification to judge whether the long-chain biotin is successfully grafted on the 5' end of the DNA.
Example 3
Long-chain biotin molecule modified DNA used for capture experiment
Experiment design: designing and synthesizing a capture probe of a human target region (BoKe tumor gene Panel) by using biotin modified probes with different lengths; a human standard genomic DNA library was constructed, matched with 9 different library tags, see table 1. Capture assays were performed using probes modified with molecules 1, 2, and 3, respectively.
TABLE 1 labels used in this experiment
| Label (R) | Sequence of |
| Library tag 1 | CGATGT |
| Library tag 2 | TGACCA |
| Library tag 3 | ACAGTG |
| Library tag 4 | GCCAAT |
| Library tag 5 | CAGATC |
| Library tag 6 | CTTGTA |
| Library tag 7 | |
| Library tag | |
| 8 | TTAGGC |
| Library tag 9 | ACTTGA |
(1) BoKe tumor gene Panel probe synthesis
The probe design is carried out aiming at the BoKe tumor gene Panel, the total length of a Panel target region is 1190775bp, the total number of probes is 17448, and the probes modified by the molecule 1, the molecule 2 and the molecule 3 are respectively synthesized.
(2) Library construction
The human standard genomic DNA was subjected to library construction using the NEXTflex Rapid DNA-Seq Kit of Bio Scientific Co according to standard procedures, and the library was sorted to about 350 bp.
(3) Target area capture
Hybrid capture was performed according to the Boke hybrid capture protocol, and 3 replicates of each of the molecule 1, molecule 2 and molecule 3 modified probes were performed, as shown in table 2.
TABLE 2 hybrid Capture assay probes
| Library numbering | Probe type |
| Boke_lib001_S01 | Molecule 1 modified probe |
| Boke_lib001_S02 | Molecule 1 modified probe |
| Boke_lib001_S03 | Molecule 1 modified probe |
| Boke_lib001_S04 | Molecule 2 modified probes |
| Boke_lib001_S05 | Molecule 2 modified probes |
| Boke_lib001_S06 | Molecule 2 modified probes |
| Boke_lib001_S07 | Molecule 3 modified probes |
| Boke_lib001_S08 | Molecule 3 modified probes |
| Boke_lib001_S09 | Molecule 3 modified probes |
(4) Sequencing on machine
The captured library was quality controlled (library fragment <500bp, concentration 3-5nM) and then sequenced using HiSeq X Ten, PE150 format, with 2G bases predicted for sequencing data per sample.
(5) Data of
The peak pattern of the product after HPLC purification is shown in fig. 2. The retention time of the product elution is plotted as the absorbance of the UV absorption at 260 nm. The maximum absorbance peak at 37 minutes was collected to yield a long-chain biotin-modified single-stranded DNA product of 60 bases in length.
The peak pattern of the control after HPLC purification is shown in fig. 3. The retention time of control elution is plotted as the absorbance of the UV absorption at 260 nm. The maximum absorbance peak at 30-31 minutes is a single-stranded DNA product of 60 bases in length that contains no biotin modification.
After HPLC purification, the two peak profiles above for the product and control were combined to give a comparative profile as shown in fig. 4. It is evident that the product containing long-chain biotin and the control, which did not contain long-chain biotin, could be effectively separated on the column.
Second, mass spectrometric identification
After HPLC purification, the peak pattern of the long-chain biotin-modified product was collected at the maximum absorption peak at 37 minutes for mass spectrometric identification.
The oligonucleotide sequences of the products are shown below (5 'to 3'):
TCTCGGCTCCTCATGACCGCCATGTTCTTCTCCTCACTGAGCTGTGCGTAGCGCATGGCT
theoretical value of molecular weight: 19128, found: 19130 and its mass spectrum is shown in FIG. 5. The synthesis is successfully shown after mass spectrum identification through HPLC separation and purification.
Thirdly, the probe modified by different molecules is used for the sequencing result of the capture experiment
Statistical analysis of the sequencing data was performed using the BWA, Samtools, Picard and Perl script programs, and the results are shown in table 3 and fig. 6. As can be seen from FIG. 6, the probes modified with molecule 2 and molecule 3 are significantly better than the probe modified with molecule 1 in both the base ratio to the target region and/or the read ratio (reads) to the target region. The higher base ratio of the alignment to the target region and the read ratio of the alignment to the target region indicate that less sequencing data can be used to achieve effective coverage of the target region, thereby reducing the sequencing cost and shortening the data analysis time.
TABLE 3 results of sequencing data analysis of different hybrid Capture libraries
The method is used for the capture sequencing experiment of specific genes, shows that the capture efficiency is obviously improved compared with that of common short-chain biotin, can reach more than 80 percent, and can be effectively used for the sequencing of the genes of the customized target region.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.
Claims (7)
1. Use of a long-chain biotin label for the preparation of a capture probe for secondary sequencing, wherein the long-chain biotin label comprises a biotin molecule, a spacer arm and a reactive group, wherein the biotin molecule comprises a cyclic structure and a pentanoic acid side chain, the spacer arm has a structure according to formula (I), the reactive group has a structure according to formula (II), the pentanoic acid side chain of the biotin molecule is linked to NH at a first end of the spacer arm, and oxygen at a second end of the spacer arm is bound to phosphorus of the reactive group to form an O-P bond, thereby linking the spacer arm to the reactive group,
-NH(CH2)mO-(-C＝O-NH-(CH2-CH2O-)4)nformula (I)
In the formula (I), m is an integer of 4-8, and n is an integer of 2-3,
2. the use of claim 1, wherein the biotin molecule is protected with a DMT group.
3. Use according to claim 1, characterized in that the long-chain biotin marker is obtained by a preparation method comprising the following steps:
(1) reacting biotin with DMT-Cl in pyridine solution to obtain an intermediate product A;
(2) reacting intermediate product A with aminohexanol in anhydrous dimethylformamide to obtain intermediate product B;
(3) activating intermediate product B with p-nitrophenol chloroformate in anhydrous acetonitrile, then reacting with amino-PEG 3-alcohol to obtain intermediate product C1, and repeating the step n-1 times with the intermediate product C1 instead of the intermediate product B to obtain intermediate product Cn, wherein n has the same meaning as in formula (I);
(4) in anhydrous acetonitrile, the intermediate product Cn reacts with a phosphorus reagent under the action of tetrazole to obtain the long-chain biotin marker.
4. The use according to claim 3, wherein disuccinimidyl carbonate is used as catalyst in step (2).
5. The use according to claim 3, wherein the phosphorus reagent in step (4) is 2-cyanoethyl-N, N, N 'N' -tetraisopropylphosphorodiamidite.
6. The use according to any one of claims 1 to 5, wherein the long-chain biotin label is bound to the 5' hydroxyl group of the oligonucleotide sequence, thereby forming a capture probe.
7. The use according to claim 6, wherein the capture probe is obtained by the following preparation method:
(1') a step of synthesizing an oligonucleotide sequence from a plurality of nucleotides; and
(2 ') a long-chain biotin label-binding step which comprises activating a long-chain biotin label by mixing with tetrazole and then reacting the activated long-chain biotin label with a hydroxyl group on the last base at the 5' -end of the oligonucleotide sequence obtained in the step (1 '); then oxidation and DMT deprotection are performed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811051423.0A CN109134541B (en) | 2018-09-10 | 2018-09-10 | Long-chain biotin marker and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811051423.0A CN109134541B (en) | 2018-09-10 | 2018-09-10 | Long-chain biotin marker and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109134541A CN109134541A (en) | 2019-01-04 |
| CN109134541B true CN109134541B (en) | 2020-10-27 |
Family
ID=64824201
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811051423.0A Active CN109134541B (en) | 2018-09-10 | 2018-09-10 | Long-chain biotin marker and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109134541B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112698025B (en) * | 2020-12-14 | 2022-10-18 | 四川沃文特生物技术有限公司 | Method for coating magnetic particles with antigen or antibody, application and kit |
| CN113004343A (en) * | 2021-03-02 | 2021-06-22 | 通用生物系统（安徽）有限公司 | Preparation method of second-generation sequencing capture probe |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5128476A (en) * | 1991-02-20 | 1992-07-07 | The Midland Certified Reagent Company | Biotinylated oligonucleotides and reagents for preparing the same |
| CN1463291A (en) * | 2001-04-19 | 2003-12-24 | 赛弗根生物系统股份有限公司 | Biomolecule characterization using mass spectormetry and affinity tags |
| CN105829887A (en) * | 2013-12-20 | 2016-08-03 | 豪夫迈·罗氏有限公司 | Compounds comprising one or more hydrophobic domains and a hydrophilic domain comprising PEG moieties, useful for binding cells |
| CN105829886A (en) * | 2013-12-20 | 2016-08-03 | 豪夫迈·罗氏有限公司 | Method of immobilizing a cell on a support using compounds comprising a polyethylene glycol moiety |
| CN106715453A (en) * | 2014-03-24 | 2017-05-24 | 哥伦比亚大学董事会 | Chemical methods for producing tagged nucleotides |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6057185B2 (en) * | 2011-11-04 | 2017-01-11 | 国立大学法人埼玉大学 | Nucleic acid linker |
| WO2018013999A1 (en) * | 2016-07-15 | 2018-01-18 | Am Chemicals Llc | Non-nucleosidic solid supports and phosphoramidite building blocks for oligonucleotide synthesis |
-
2018
- 2018-09-10 CN CN201811051423.0A patent/CN109134541B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5128476A (en) * | 1991-02-20 | 1992-07-07 | The Midland Certified Reagent Company | Biotinylated oligonucleotides and reagents for preparing the same |
| CN1463291A (en) * | 2001-04-19 | 2003-12-24 | 赛弗根生物系统股份有限公司 | Biomolecule characterization using mass spectormetry and affinity tags |
| CN105829887A (en) * | 2013-12-20 | 2016-08-03 | 豪夫迈·罗氏有限公司 | Compounds comprising one or more hydrophobic domains and a hydrophilic domain comprising PEG moieties, useful for binding cells |
| CN105829886A (en) * | 2013-12-20 | 2016-08-03 | 豪夫迈·罗氏有限公司 | Method of immobilizing a cell on a support using compounds comprising a polyethylene glycol moiety |
| CN106715453A (en) * | 2014-03-24 | 2017-05-24 | 哥伦比亚大学董事会 | Chemical methods for producing tagged nucleotides |
Non-Patent Citations (2)
| Title |
|---|
| "AN IMPROVED METHOD FOR SYNTHESIS OF BIOTIN PHOSPHORAMIDITES FOR SOLID PHASE BIOTINYLATION OF OLIGONUCLEOTIDES";P. Kumar. Et al;《Bioorganic & Medicinal Chemistry Letters》;19941231;第4卷(第14期);第1762页 * |
| "Reversible Biotinylation Phosphoramidite for 5′-End-Labeling, Phosphorylation, and Affinity Purification of Synthetic Oligonucleotides";Fang S Y. ET AL;《Bioconjugate Chem》;20031231;第14卷;第80-85页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109134541A (en) | 2019-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DE69635744T2 (en) | Modified nucleic acid probes | |
| JP3289911B2 (en) | Tag reagents and assays | |
| US7615629B2 (en) | Methods and compositions for the tandem synthesis of two or more oligonucleotides on the same solid support | |
| JP3081882B2 (en) | Orthogonal removal of hydroxyl protecting groups by reduction and their use in the chemical synthesis of oligonucleotides | |
| US8383344B2 (en) | Methods for quantification of microRNAs and small interfering RNAs | |
| US6743905B2 (en) | Mobility-modified nucleobase polymers and methods of using same | |
| DE69632456T2 (en) | NUCLEIC ACID SYNTHESIS USING MEDIUM-SHIFTABLE PROTECTION GROUPS | |
| ES2380923T3 (en) | Small interfering microRNA and RNA quantification procedures | |
| DOlinnaya et al. | Oligonucleotide circularization by template-directed chemical ligation | |
| EP1527175B1 (en) | Methods and systems for detection and isolation of a nucleotide sequence | |
| EP1247815A2 (en) | Modified oligonucleotides and uses thereof | |
| CN105647907B (en) | It is a kind of for targeting the preparation method of the modified DNA hybridization probe of hybrid capture | |
| CN106589005A (en) | Fluorescence signal amplification probe intermediate, fluorescent probe and preparation method thereof | |
| US20100092972A1 (en) | Assay for gene expression | |
| CN109134541B (en) | Long-chain biotin marker and preparation method and application thereof | |
| CN101238213B (en) | Stable and selective formation of hoogsteen-type triplexes and duplexes using twisted intercalating nucleic acids (TINA) and process for the preparation of tina | |
| US20050277138A1 (en) | Reactive functional groups | |
| US20070049745A1 (en) | Oligonucleotide synthesis using periodate salts | |
| US20130053258A1 (en) | Combinatorial library, a method for preparation of that combinatorial library, a method for sequence identification, a method for sequencing the elements of combinatorial libraries of oligonucleotides and/or oligonucleotide analogues, the use of a linker to generate combinatorial libraries and a sequence identification set | |
| JP7203276B2 (en) | Methods and kits for constructing sequencing libraries based on target regions of methylated DNA | |
| Avino et al. | Solid-phase synthesis of oligomers carrying several chromophore units linked by phosphodiester backbones | |
| Sethi et al. | Polymer supported synthesis of aminooxyalkylated oligonucleotides, and some applications in the fabrication of microarrays | |
| Zhan et al. | Replicating DNA differently | |
| US20240124930A1 (en) | Diagnostic and/or Sequencing Method and Kit | |
| CN114040983A (en) | Oligonucleotide containing blocker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address | ||
| CP03 | Change of name, title or address |
Address after: 214105 floor 5, block D, Xidong chuangrong building, No. 78, Danshan Road, anzhen street, Xishan District, Wuxi City, Jiangsu Province Patentee after: Boke biomedical technology (Wuxi) Co.,Ltd. Address before: 102600 Daxing biomedical industry base, Zhongguancun Science and Technology Park, Daxing District, Beijing Patentee before: BOKE BIOMEDICAL TECHNOLOGY (BEIJING) CO.,LTD. |