CN109112221A - The primer sets and kit of ring mediated isothermal amplification method detection ureaplasma urealyticum - Google Patents
The primer sets and kit of ring mediated isothermal amplification method detection ureaplasma urealyticum Download PDFInfo
- Publication number
- CN109112221A CN109112221A CN201710481631.3A CN201710481631A CN109112221A CN 109112221 A CN109112221 A CN 109112221A CN 201710481631 A CN201710481631 A CN 201710481631A CN 109112221 A CN109112221 A CN 109112221A
- Authority
- CN
- China
- Prior art keywords
- primer
- kit
- ureaplasma urealyticum
- reaction
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the primer sets and kit of a kind of ring mediated isothermal amplification method (LAMP) detection ureaplasma urealyticum.This primer sets design for 6 different zones in ureaplasma urealyticum 16S ribosomal rna gene sequence, including a pair of specific inner primer and a pair of of specificity outer primer and a ring primer.This kit include 10 include the reaction tube of 23 μ L reaction solutions, 1 positive control pipe for including 25 μ L Uu DNA and 1 include the negative control pipes of the 100 sterile ultrapure waters of μ L.The present invention can detect ureaplasma urealyticum rapidly and sensitively, and specificity is high, easily operated, quick diagnosis and screening suitable for situation of all-level hospitals.
Description
Technical field
The present invention relates to technical field of microbial detection, and in particular to a kind of ring mediated isothermal amplification method detection ureaplasma is former
The primer sets and kit of body.
Background technique
Ureaplasma urealyticum (Ureaplasma urealyticum, Uu) belongs to Mycoplasmataceae Ureaplasma, is a kind of parasitism
In the conditioned pathogen of human urogenital, is propagated when can be contacted, be given a birth with passability through approach such as birth canals, be non-gonococcal
One of the main pathogenic fungi of urethritis.In recent years, numerous studies confirm: Uu and urinary calculus, vesical calculus, prostatitis, testis
A variety of diseases such as inflammation, newborn's under-weight, pneumonia of newborn are related, and Ureaplasma Urealyticum Infection has become be concerned public and defends
One of raw problem.Early diagnosis has far reaching significance to the treatment of Ureaplasma Urealyticum Infection, therefore, the detection to ureaplasma urealyticum
It is particularly important.
Currently, clinical detection Uu mostly uses liquid culture method and PCR method, wherein liquid culture method is easy to operate, to experiment
Condition is of less demanding, but the method takes a long time, and cannot go out as a result, bringing very big inconvenience to out-patient on the same day；PCR detects skill
Art sensibility with higher and high specific, but this method is more demanding to experiment condition and Examined effect, in basic hospital
It is difficult to carry out.Therefore, quick, accurate, the practical Uu detection method of one kind is found to have practical significance.
Summary of the invention
For the above-mentioned prior art, the object of the present invention is to provide a kind of ring mediated isothermal amplification methods to detect ureaplasma urealyticum
Primer sets and kit.
To achieve the above object, the present invention adopts the following technical scheme:
The first aspect of the present invention provides a kind of primer sets of ring mediated isothermal amplification method detection ureaplasma urealyticum, comprising:
Specific outer primer F3, nucleotide sequence is as shown in SEQ ID NO.1；Specific outer primer B3, nucleotide sequence such as SEQ
Shown in ID NO.2；Specific inner primer FIP, nucleotide sequence is as shown in SEQ ID NO.3；Specific inner primer BIP,
Nucleotide sequence is as shown in SEQ ID NO.4；Ring primer LB, nucleotide sequence is as shown in SEQ ID NO:5.
The second aspect of the present invention provides above-mentioned primer sets in the kit or chip of preparation detection ureaplasma urealyticum
Purposes.
The third aspect of the present invention provides a kind of kit for detecting ureaplasma urealyticum, includes above-mentioned in the kit
Primer sets.
Preferably, in the kit, the content of specific outer primer F3 is 5pmol, the content of specific outer primer B3
For 5pmol, the content of specific inner primer FIP is 40pmol, and the content of specific inner primer BIP is 40pmol, ring primer L B
Content be 20pmol.
Further, in kit of the invention further include: reaction buffer, Bst archaeal dna polymerase, developing solution, sterile
Ultrapure water.
Preferably, contain in the reaction buffer: 400mM Tris-HCl (pH 8.8), 20mM KCl, 16mM Mg
SO4、20mM(HN4)2SO4, 0.2%Tween20,1.6M glycine betaine and 2.8mM dNTPs.
Preferably, the active quantities of the Bst archaeal dna polymerase are 160 units.
Preferably, the developing solution is manganese ion huge legendary turtle and type calcein.
The fourth aspect of the present invention provides a kind of method of the detection ureaplasma urealyticum of non-diagnostic purpose, and steps are as follows:
DNA to be checked is added into reaction solution, mixes, while setting negative control and positive control, nothing is added in negative control
Uu DNA is added in positive control, reaction tube is set in water-bath and is expanded for bacterium ultrapure water, amplification condition are as follows: 60-65 DEG C of water
Bath, isothermal reaction 30-40min observe color change；If reaction solution becomes green, for positive findings；Reaction solution is non-discolouring still
It is then negative findings for pale orange.
The reaction solution contains: specific outer primer F3, specific outer primer B3, specific inner primer FIP, in specificity
Primer BIP, ring primer LB, reaction buffer, Bst archaeal dna polymerase, developing solution and sterile ultrapure water.
Beneficial effects of the present invention:
(1) present invention is for 6 in 16S ribosomal rna gene highly conserved, special in ureaplasma urealyticum
Segment design and filter out include 5 primers primer sets, have it is very high specificity and sensitivity, improve ureaplasma original
The clinical recall rate of body.
(2) present invention obtains optimal primer sets by screening, is expanded using loop-mediated isothermal amplification technique (LAMP)
Increase and detect, amplification efficiency is high, and the reaction time is short, and reaction can be completed in 30-40min, highly shortened ureaplasma urealyticum
The clinical detection time.
(3) clinical sample received only need to be extracted DNA using the method for boiling water bath 10min, centrifugation by the present invention, use examination
With the naked eye determine to simplify the behaviour of ureaplasma urealyticum clinical detection as a result, without complicated equipment by color after the amplification of agent box
Make process, reduces testing cost.
(4) present invention does not need to open reaction tube again after reaction, avoids dirty because forming the DNA that aerosol generates
Dye, effective protection reaction environment and is avoided that the false positive in subsequent detection.
Detailed description of the invention
The accompanying drawings constituting a part of this application is used to provide further understanding of the present application, and the application's shows
Meaning property embodiment and its explanation are not constituted an undue limitation on the present application for explaining the application.
Fig. 1 determines Uu as a result, in figure for LAMP naked eyes, and respectively No. 1 pipe, No. 2 pipes and No. 3 are managed from left to right, wherein 1
Number pipe be negative control, No. 2 pipe be positive control, No. 3 pipe be detection pipe.
Fig. 2 is LAMP specific detection as a result, in figure, from left to right respectively No. 1 pipe, No. 2 pipes, No. 3 pipes, No. 4 pipes and 5
Number pipe, wherein No. 1-4 pipe be respectively escherichia coli, enterococcus faecalis, staphylococcus aureus, Candida albicans LAMP knot
Fruit is all feminine gender, and No. 5 are the LAMP of ureaplasma urealyticum clinical strains as a result, being positive.
Specific embodiment
It is noted that following detailed description is all illustrative, it is intended to provide further instruction to the application.Unless another
It indicates, all technical and scientific terms used herein has usual with the application person of an ordinary skill in the technical field
The identical meanings of understanding.
It should be noted that term used herein above is merely to describe specific embodiment, and be not intended to restricted root
According to the illustrative embodiments of the application.As used herein, unless the context clearly indicates otherwise, otherwise singular
Also it is intended to include plural form, additionally, it should be understood that, when in the present specification using term "comprising" and/or " packet
Include " when, indicate existing characteristics, step, operation, device, component and/or their combination.
As background technique is introduced, there are still deficiencies for the method for clinical detection Uu in the prior art.Based on this, this hair
It is bright to propose the primer sets and kit of a kind of ring mediated isothermal amplification method detection ureaplasma urealyticum.
In a kind of embodiment of the application, a kind of drawing for ring mediated isothermal amplification method detection ureaplasma urealyticum is provided
Object group, comprising: specific outer primer F3, nucleotide sequence is as shown in SEQ ID NO.1；Specific outer primer B3, nucleosides
Acid sequence is as shown in SEQ ID NO.2；Specific inner primer FIP, nucleotide sequence is as shown in SEQ ID NO.3；Specificity
Inner primer BIP, nucleotide sequence is as shown in SEQ ID NO.4；Ring primer LB, nucleotide sequence such as SEQ ID NO:5 institute
Show.It is specific as follows:
F3:CTAGATGCTTAACGTCTAGCT；(SEQ ID NO.1)
B3:AGGGTATCTAATCCTATTTGCT；(SEQ ID NO.2)
FIP:GCATTTTACCGCTCCACATGGATCAAAAACTGTAAACCTAGAGTG；(SEQ ID NO.3)
BIP:TATGGAAGAACACCGGTGGCCCACACTTTCGAGCCTAAG；(SEQ ID NO.4)
LB:GAAGGCGCCAACTTGGACTATCAC.(SEQ ID NO.5)
For ureaplasma urealyticum, can as the conservative gene of target sequence type there are many, but with different
The primer of conservative gene region design is different, different to the effect of diagnosis with the detection of ureaplasma urealyticum.The application is to for setting
Screening is optimized in the target sequence for counting the ureaplasma urealyticum of primer, as a result, it has been found that, with highly conserved, special in ureaplasma urealyticum
6 segment design primers in different 16S ribosomal rna gene, can be improved the specificity of detection and analysis.
In addition, being found in the design process of primer, even if same gene order, same design software, are designed
Primer quantity, sequence difference it is huge, even if same primer, different people carries out the result of selection, and also difference is huge.And it seems
The all very outstanding primer of various parameters, also difference is huge for the result in experimental verification.It to carry out during the experiment a large amount of
Screening.So selection specificity is good, a large amount of experimental verification of willing primer needs, this has had exceeded conventional selection
Scope.
Although having the design software of primer and the basic guideline of design of primers in the prior art, specific or needs
It is carried out according to the knowledge accumulation of designer oneself and actual needs, and the nuance of parameter can generate primer result
Very big influence.In addition, the setting of parameter belongs to element task, generally will not all it be embodied in disclosed document, therefore, for drawing
For the design of object, it is actually the absence of the basis that can carry out reference.
The application during the test, devises the different primer combination of multiple groups, and investigate its specificity and amplification respectively
Efficiency, to screen the optimal primer combination that can be used for ureaplasma urealyticum clinical detection.As a result, it has been found that being combined with above-mentioned primer
Specificity, sensitivity and the reaction speed that (SEQ ID NO.1-SEQ ID NO.5) detects ureaplasma urealyticum are optimal.
In the another embodiment of the application, a kind of kit for detecting ureaplasma urealyticum, the kit are provided
In contain: 1 be equipped with 25 μ L Uu DNA positive control pipe, 1 be equipped with the 100 sterile ultrapure waters of μ L negative control pipe；30
It is adapted to the Tip head of 1-10 μ L pipettor, the reaction tube equipped with 23 μ L reaction solutions.
23 μ L reaction solutions contain: outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, ring primer LB, reaction are slow
Fliud flushing, Bst archaeal dna polymerase, developing solution and sterile ultrapure water.
In order to enable those skilled in the art can clearly understand the technical solution of the application, below with reference to tool
The technical solution of the application is described in detail in the embodiment of body.
Test material used in the embodiment of the present invention is the test material of this field routine, can pass through commercial channel
It is commercially available.
Embodiment 1: the design and screening of primer
According to 16S ribosomal rna gene sequence (its nucleotide sequence such as SEQ ID NO:6 institute of ureaplasma urealyticum
Show) design primer group.Then, it has synthesized 5 groups of custom primers (being shown in Table 1) according to LAMP reaction principle to be screened, every group of primer
Including two outer primers (F3 and B3) and two inner primers (FIP and BIP).Through a large number of experiments, reaction process and knot are monitored
Fruit filters out optimal primer sets 4 and primer sets 5.In order to accelerate LAMP reaction speed, distinguish for primer sets 4 and primer sets 5
Corresponding ring primer (being shown in Table 2) is devised further to screen.Finishing screen select specific high, swift best primer sets (see
Table 3) it include two outer primers (F3 and B3), two inner primers (FIP and BIP) and a ring primer (LB).
Table 1 screens primer sets sequence
2 ring primer sequence of table
2. the selection result of primer
The best primer sets filtered out are shown in Table 3.
The best primer sets sequence of table 3
Embodiment 2: the kit of ureaplasma urealyticum is detected
1. the composition of kit: embodiment 1 screen primer and probe combination, reaction buffer, Bst archaeal dna polymerase,
Developing solution, sterile ultrapure water；Wherein, reaction buffer ingredient and content are shown in Table 4.
4 reaction buffer ingredient of table and content
The active quantities of Bst archaeal dna polymerase are as follows: 160 units.
Developing solution is manganese ion huge legendary turtle and type calcein: 0.001 μm of ol.
Sterile ultrapure water: 3.5 μ L.
The content of each primer is shown in Table 5.
Content of each primer of table 5 in 25 μ L reaction systems
2. the configuration of kit
Kit contains 10 reaction tubes that 23 μ L reaction solutions are housed；1 positive control pipe equipped with 25 μ L Uu DNA, 1
A negative control pipe that the 100 sterile ultrapure waters of μ L are housed；The Tip head of 30 adaptation 1-10 μ L pipettors.
3.LAMP detection architecture
LAMP detection architecture is 25 μ L, and 23 μ L reaction solutions are added in when detection, adds 2 μ L DNA to be detected.The positive is set simultaneously
Control and negative control.Negative control are as follows: add 2 μ L ultrapure waters in reaction solution when detection, positive control are as follows: to add 2 μ L when detection
Uu DNA is in reaction solution.
4. detection method and reaction condition
(1) DNA is extracted:
1) extraction of the Uu DNA of Liquid Culture: Liquid Culture sample 1ml is taken to be placed in 1.5ml EP pipe, 14 000r/
Min is centrifuged 10min, abandons supernatant.0.2ml aseptic double-distilled water is added, 100 DEG C of boiling water baths 10min, 10000rpm are centrifuged 5min.It will
Supernatant is transferred in new EP pipe, as sample DNA, is reacted for LAMP.
2) extraction of clinical fluid sample DNA: liquid sample 14000rpm is centrifuged 10min, abandons supernatant, stays precipitating, is added
0.2ml aseptic double-distilled water, 100 DEG C of boiling water baths 10min, 10000rpm are centrifuged 5min.Supernatant is transferred in new EP pipe, as
Sample DNA is reacted for LAMP.
3) DNA of vaginal swab equal samples is extracted: swab being placed in 1ml distilled water, is fullyd shake, swab is discarded, is pressed
DNA is extracted according to liquid sample method.
(2) it detects:
2 μ L DNA to be checked are added into reaction tube, mixes, while setting negative control and positive control, is added in negative control
2 μ L sterile ultrapure waters are added 2 μ L Uu DNA in positive control, reaction tube are set in water-bath and is expanded, amplification condition are as follows:
60-65 DEG C of water-bath, isothermal reaction 30-40min observe color change.
5. result judgement
After reaction, experimental result is directly determined according to reaction solution color naked eyes, it is the positive that reaction solution, which becomes green,
As a result；It is still pale orange is negative findings that reaction solution is non-discolouring, as shown in Figure 1, No. 1 pipe is negative control pipe, the liquid in pipe
Body still keeps pale orange, and for feminine gender, No. 2 pipes are positive control, and No. 3 pipes are detection pipe, and the liquid in 2, No. 3 pipes becomes green,
For the positive.If the reaction time extends to 40min or more, it is possible that false positive, extends with the reaction time, there is false positive
Probability increases, thus result judgement be subject to 30-40min when.
6. sensitivity assessment
Boiling bath method is carried out to 50 plants of ureaplasma urealyticum clinical separation strains that laboratory cultures obtain and extracts DNA, is adopted respectively
It is expanded and is detected with LAMP (kit of the present embodiment) and PCR.LAMP detects 50 plants, sensitivity 100%；PCR inspection
47 plants of sensitivity are 94% out, as shown in table 6.Meanwhile LAMP and PCR being taken to detect all as positive ureaplasma urealyticum DNA, with double
It steams water and carries out 10 times of gradient dilutions to it, after diluting 100 times, PCR cannot be detected, and after DNA is diluted 1000 times
LAMP cannot be detected, and illustrate that the Monitoring lower-cut ratio PCR of LAMP is 10 times low, have very high sensitivity.
6 LAMP and PCR testing result of table
8. specific detection
Clinical isolation escherichia coli, enterococcus faecalis, staphylococcus aureus, Candida albicans are selected, according to upper
It states the method mentioned and extracts DNA, carry out LAMP amplification, and using ureaplasma urealyticum reference culture as positive control.As a result 45 minutes
When, as shown in Fig. 2, only No. 5 ureaplasma urealyticum clinical strains are positive, the time extends to 1h, other bacterial strains are still negative, table
Bright kit of the invention has very high specificity.
Embodiment 3: clinical sample application detection
The clinical samples DNA for extracting 30 parts of doubtful Ureaplasma Urealyticum Infections, the LAMP detection kit established with the present invention
It is compared with clinically being identified at present using most liquid culture methods.This kit identifies 5 parts of positive sample, with culture
The match rate of qualification result is 100%.It is detected using this kit, only needs 1h to result out from clinical sample is received, and it is traditional
Culture identification needs that result could be gone out after 48 hours.In contrast, kit of the invention is more quick, easy, and
There is identical accuracy with liquid culture method.
This experiment devises 5 for 6 different zones in ureaplasma urealyticum 16S ribosomal rna gene sequence
Primer pair clinical samples are detected, and ensure that the specificity and sensibility of LAMP reaction.In conclusion the base that this experiment is established
Ureaplasma urealyticum, and specificity and sensibility can be efficiently and rapidly detected in the LAMP primer group and kit of color judgement
High, easily operated, suitable for situation of all-level hospitals quick diagnosis and screening.
The foregoing is merely preferred embodiment of the present application, are not intended to limit this application, for the skill of this field
For art personnel, various changes and changes are possible in this application.Within the spirit and principles of this application, made any to repair
Change, equivalent replacement, improvement etc., should be included within the scope of protection of this application.
Claims (10)
1. a kind of primer sets of ring mediated isothermal amplification method detection ureaplasma urealyticum characterized by comprising specific outer primer
F3, nucleotide sequence is as shown in SEQ ID NO.1；Specific outer primer B3, nucleotide sequence such as SEQ ID NO.2 institute
Show；Specific inner primer FIP, nucleotide sequence is as shown in SEQ ID NO.3；Specific inner primer BIP, nucleotide sequence
As shown in SEQ ID NO.4；Ring primer LB, nucleotide sequence is as shown in SEQ ID NO:5.
2. purposes of the primer sets described in claim 1 in the kit or chip of preparation detection ureaplasma urealyticum.
3. a kind of kit for detecting ureaplasma urealyticum, which is characterized in that include primer described in claim 1 in the kit
Group.
4. kit as claimed in claim 3, which is characterized in that in the kit, the content of specific outer primer F3 is
The content of 5pmol, specific outer primer B3 are 5pmol, and the content of specific inner primer FIP is 40pmol, specific inner primer
The content of BIP is 40pmol, and the content of ring primer LB is 20pmol.
5. kit as claimed in claim 3, which is characterized in that in the kit further include: reaction buffer, Bst
Archaeal dna polymerase, developing solution, sterile ultrapure water.
6. kit as claimed in claim 5, which is characterized in that contain in the reaction buffer: 400mM Tris-HCl
(pH 8.8)、20mM KCl、16mM MgSO4、20mM(HN4)2SO4, 0.2%Tween20,1.6M glycine betaine and 2.8mM
dNTPs。
7. kit as claimed in claim 5, which is characterized in that the active quantities of the Bst archaeal dna polymerase are 160 single
Position.
8. kit as claimed in claim 5, which is characterized in that the developing solution is manganese ion huge legendary turtle and type calcein.
9. a kind of method of the detection ureaplasma urealyticum of non-diagnostic purpose, which is characterized in that steps are as follows:
DNA to be checked is added into reaction solution, mixes, while setting negative control and positive control, is added in negative control sterile super
Uu DNA is added in positive control, reaction tube is set in water-bath and is expanded for pure water, amplification condition are as follows: 60-65 DEG C of water-bath,
Isothermal reaction 30-40min observes color change；If reaction solution becomes green, for positive findings；Reaction solution is non-discolouring to be still
Pale orange is then negative findings；
Contain primer sets described in claim 1 in the reaction solution.
10. method as claimed in claim 9, it is characterised in that: the reaction solution also contains: reaction buffer, Bst DNA are poly-
Synthase, developing solution and sterile ultrapure water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710481631.3A CN109112221A (en) | 2017-06-22 | 2017-06-22 | The primer sets and kit of ring mediated isothermal amplification method detection ureaplasma urealyticum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710481631.3A CN109112221A (en) | 2017-06-22 | 2017-06-22 | The primer sets and kit of ring mediated isothermal amplification method detection ureaplasma urealyticum |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109112221A true CN109112221A (en) | 2019-01-01 |
Family
ID=64732797
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710481631.3A Pending CN109112221A (en) | 2017-06-22 | 2017-06-22 | The primer sets and kit of ring mediated isothermal amplification method detection ureaplasma urealyticum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109112221A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113025735A (en) * | 2021-04-07 | 2021-06-25 | 深圳易致生物科技有限公司 | Primer, probe and kit for detecting ureaplasma urealyticum, and use method and application thereof |
| CN116355989A (en) * | 2023-03-31 | 2023-06-30 | 深圳会众生物技术有限公司 | Nucleotide composition, kit containing same and application of kit |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102191321A (en) * | 2011-03-23 | 2011-09-21 | 上海仁度生物科技有限公司 | Detection kit for ureaplasma urealyticum (UU) nucleic acid by utilizing RNA constant-temperature amplification |
| CN104328212A (en) * | 2014-11-24 | 2015-02-04 | 济南市中心医院 | Primer set and kit for detecting group B streptococcus by loop-mediated isothermal amplification method |
-
2017
- 2017-06-22 CN CN201710481631.3A patent/CN109112221A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102191321A (en) * | 2011-03-23 | 2011-09-21 | 上海仁度生物科技有限公司 | Detection kit for ureaplasma urealyticum (UU) nucleic acid by utilizing RNA constant-temperature amplification |
| CN104328212A (en) * | 2014-11-24 | 2015-02-04 | 济南市中心医院 | Primer set and kit for detecting group B streptococcus by loop-mediated isothermal amplification method |
Non-Patent Citations (3)
| Title |
|---|
| THOMAS EDWARDS等: "Loop-mediated isothermal amplification (LAMP) for the rapid detection of Mycoplasma genitalium", 《DIAGNOSTIC MICROBIOLOGY AND INFECTIOUS DISEASE》 * |
| 王荷英等: "6 种支原体的检测在一般人群和非淋菌性尿道炎患者中的调查研究", 《中国艾滋病性病》 * |
| 黄火清等: "环介导等温扩增技术的研究进展", 《生物技术》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113025735A (en) * | 2021-04-07 | 2021-06-25 | 深圳易致生物科技有限公司 | Primer, probe and kit for detecting ureaplasma urealyticum, and use method and application thereof |
| CN116355989A (en) * | 2023-03-31 | 2023-06-30 | 深圳会众生物技术有限公司 | Nucleotide composition, kit containing same and application of kit |
| CN116355989B (en) * | 2023-03-31 | 2024-03-08 | 深圳会众生物技术有限公司 | Nucleotide composition, kit containing same and application of kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102643925B (en) | Loop-mediated isothermal amplification (LAMP) primer composition for detecting phytophthora rot and application thereof | |
| Munir et al. | Comparison of Ziehl Neelsen microscopy with GeneXpert for detection of Mycobacterium tuberculosis | |
| Lowe et al. | PCR-based Methodologies Used to Detect and Differentiate the Burkholderia pseudomallei complex: B. pseudomallei, B. mallei, and B. thailandensis | |
| CN103045761B (en) | For detecting test kit and the detection method of infectious eye disease pathogenic microorganism | |
| JP2019507606A (en) | Method of detecting pathogen of sexually transmitted disease | |
| Magnet et al. | Vectorial role of Acanthamoeba in Legionella propagation in water for human use | |
| CN102676511B (en) | Detection target sequence A3apro of phytophthora sojae, and specific LAMP (loop-mediated isothermal amplification) primer composition and application thereof | |
| CN102533959A (en) | Multiplex polymerase chain reaction (PCR) kit for identifying mycobacterium tuberculosis | |
| Kao et al. | Isolation and identification of Acanthamoeba species from thermal spring environments in southern Taiwan | |
| CN104372104B (en) | A kind of LAMP detection primer composition of camphor tree phytophthora and LAMP detection kit thereof and LAMP detection method | |
| CN104328212B (en) | The primer sets of ring mediated isothermal amplification method detection B group streptococcus and test kit | |
| CN107686863A (en) | The method that loop-mediated isothermal amplification technique detects three kinds of Urogenital Mycoplasmas | |
| CN104372099B (en) | A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method | |
| CN109112221A (en) | The primer sets and kit of ring mediated isothermal amplification method detection ureaplasma urealyticum | |
| Lu et al. | Reverse line blot hybridisation screening of Pseudallescheria/Scedosporium species in patients with cystic fibrosis | |
| Sawczyn-Domańska | Detection of Legionella spp. and occurrence of virulence genes: lvh, rtxA and enhC in water samples from artificial water systems | |
| CN104745689A (en) | Primers, probe and kit used for detecting bordetella pertussis | |
| KR20170085995A (en) | Method for Gut Microbiota Analysis Using Real-time PCR | |
| CN105349661A (en) | Chlamydia trachomatis and gonococcus nucleic acid detection kit | |
| CN101805795A (en) | Detection reagent kit and detection method of soybean phytophthora | |
| CN105274193A (en) | Mycobacterium tuberculosis constant temperature rapid detection kit through LAMP method and detection method | |
| CN104388558B (en) | The molecular beacon probe of a kind of quick detection streptococcus agalactiae and detection method | |
| WO2017092483A1 (en) | Kit for diagnosing tuberculosis through detecting free nucleic acid and use thereof | |
| CN108504756A (en) | Aeromonas veronii detection primer, kit, detection method and its development approach based on specific sequence | |
| CN107460249A (en) | A kind of primer, probe and kit for being used to detect methicillin-resistant staphylococcus aureus drug resistant gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190101 |