CN109097439A

CN109097439A - A method of detecting a small amount of sample complete genome DNA methylation

Info

Publication number: CN109097439A
Application number: CN201811024725.9A
Authority: CN
Inventors: 赵小东; 康亚妮; 邵志峰; 胡丛霞
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2018-09-04
Filing date: 2018-09-04
Publication date: 2018-12-28

Abstract

The present invention provides a kind of methods for detecting a small amount of sample complete genome DNA methylation.Specifically, the method for the present invention includes steps: (a) providing DNA fragmentation；(b) connector is added at the DNA fragmentation both ends；(c) the first mixture is formed with auxiliary nucleic acid fragment is added in the DNA of connector to the end；(d) first mixture is subjected to thermal denaturation, double-stranded DNA is made to become single stranded DNA, form the second mixture；(e) nucleic acid fragment to methylate in second mixture is captured with specific antibody；(f) captured nucleic acid fragment is expanded with specific primer, to obtain the amplified production of the nucleic acid fragment containing methylation.Method of the invention is suitable for the methylated nucleic acid sequencing analysis of minute quantity source sample, and cost is relatively low, has very high general applicability.

Description

A method of detecting a small amount of sample complete genome DNA methylation

Technical field

The invention belongs to field of biotechnology, and in particular to one kind passes through MeDIP-seq (Methylated DNA Immunoprecipitation sequencing) detect the method that a small amount of cell complete genome DNA methylates.

Background technique

Minimum amount of DNA needed for detecting the methylation of cell complete genome DNA by MeDIP-seq method at present is 50ng, If being the sample that sets out with cell, about 75000 cells are at least needed.

However, current method is still unsatisfactory, needed for minimum sample initial amount be 50ng DNA or 75000 A cell, is not suitable for the MeDIP-seq analysis of minute quantity source sample still, and needs to utilize kit and automatic sample Processing system carries out MeDIP experiment, and higher cost does not have general applicability.

Therefore, there is an urgent need in the art to develop a kind of method for being able to detect the methylation of few cells complete genome DNA.

Summary of the invention

It is an object of the invention to provide a kind of methods for detecting a small amount of cell complete genome DNA methylation.

In the first aspect of the present invention, a kind of method of detection complete genome DNA methylation is provided, comprising steps of

(a) DNA fragmentation is provided, the DNA fragmentation includes being originated from cell genomic dna；

(b) connector is added at the DNA fragmentation both ends, obtains the DNA that end has connector；

(c) the first mixture is formed with auxiliary nucleic acid fragment is added in the DNA fragmentation of connector to the end；

(d) first mixture is subjected to thermal denaturation, the double-stranded DNA in the first mixture is made to become single stranded DNA, thus Form the second mixture；

(e) DNA fragmentation to methylate in second mixture is captured with specific antibody；

(f) captured DNA fragmentation is expanded with specific primer, to obtain the DNA piece for corresponding to methylation The amplified production of section；

(g) amplified production is detected, to obtain the testing result of complete genome DNA methylation.

In another preferred example, the method is non-diagnostic and non-treatment purpose.

In another preferred example, in step (g), comprising: carry out building library to the amplified production, then be detected.

In another preferred example, the cell is selected from the group: body cell, reproduction cell, stem cell, or combinations thereof.

In another preferred example, the cell is selected from the group: mouse female reproduction stem cell (FGSC, Female Germline Stem Cells)。

In another preferred example, DNA fragmentation described in step (a) comes from 20-10000 cell, preferably, 50-2000 A cell.

In another preferred example, the auxiliary nucleic acid fragment includes the auxiliary nucleic acid fragment of methylation or non-methylation.

In another preferred example, auxiliary nucleic acid fragment described in step (c) is DNA or RNA.

In another preferred example, the auxiliary nucleic acid fragment includes phage DNA.

In another preferred example, the phage DNA is selected from the group: λ DNA.

In another preferred example, the auxiliary nucleic acid fragment is λ DNA.

In another preferred example, the length of the auxiliary nucleic acid fragment is 200-4000bp, preferably, 500-3000bp, More preferably, 1000-2500bp.

In another preferred example, the amount of the auxiliary nucleic acid fragment is 5-250ng, preferably, 15-150ng, more preferably, 25-100ng。

In another preferred example, the mass ratio of the DNA fragmentation and the auxiliary nucleic acid fragment is 1:5-1:10000, Preferably 1:20-1:5000, more preferably 1:50-1:2000.

In another preferred example, specific antibody described in step (e) is the antibody of alkali resistant ylmethyl.

In another preferred example, the base is selected from the group: A, T, C, G, or combinations thereof.

In another preferred example, the base includes C.

In another preferred example, the antibody of the alkali resistant ylmethyl includes 5^mC antibody.

In another preferred example, the content of the antibody is 0.5-15ug, preferably, 1-10ug.

In another preferred example, in entire second mixture, the antibody of the quantity is added.

In another preferred example, relative to the DNA fragmentation of about 200pg, the antibody of the quantity is added.

In another preferred example, the ratio of the antibody and the second mixture is 10-300:1-2-50:1, preferably, 30- 200:1-5-30:1, more preferably, 50-150:1-8-20:1.

In another preferred example, specific primer described in step (f) is the primer of DNA fragmentation described in specific amplification.

In another preferred example, the specific primer is selected from the group:

P5 primer: AATGATACGGCGACCACCGAG (SEQ ID No.:3)；

P7 primer: CAAGCAGAAGACGGCATACGAG (SEQ ID No.:4).

In another preferred example, the connector is selected from the group: 5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC ACAGTGATCTCGTATGC CGTCTTCTGCTT*G-3'(SEQ ID No.:5)；

5'-AAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGAC GTGTGCTCTTCCGATC-3' (SEQ ID No.:6)。

In another preferred example, the amplification PCR amplification.

In another preferred example, in step (f), it is described auxiliary nucleic acid fragment and the amplified production mass ratio≤ 2%.

In the second aspect of the present invention, a kind of purposes for assisting nucleic acid fragment is provided, building trace dna is used to prepare The reagent in sample library.

In another preferred example, the Method for Microarray Applications is 5-150pg, preferably, 10-100pg, more preferably, 25- 75pg。

In another preferred example, the Method for Microarray Applications library is used for MeDIP-seq (Methylated DNA Immunoprecipitation-sequencing it) analyzes.

In another preferred example, the Method for Microarray Applications library is used for ChIP-seq (Chromatin Immunoprecipitation-sequencing) sequencing analysis.

In another preferred example, the phage DNA is selected from the group: λ DNA.

In another preferred example, the auxiliary nucleic acid fragment is λ DNA.

It should be understood that above-mentioned each technical characteristic of the invention and having in below (eg embodiment) within the scope of the present invention It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, exist This no longer tires out one by one states.

Detailed description of the invention

Fig. 1 shows experiment flow of the invention.

Fig. 2 shows 50 2100 quality inspection results of cell MeDIP final library.

Fig. 3 shows the case where methylation is constantly reduced with cell quantity.

Specific embodiment

The present inventor after extensive and in-depth study, develop for the first time it is a kind of detect micro (such as 100pg) sample in Methylation genomic DNA method, specifically, pass through MeDIP-seq detect few cells complete genome DNA methylation. The MeDIP-seq that method of the invention is suitable for minute quantity source sample is analyzed, by the way that methyl is added in a small amount of initial sample Change λ DNA, can not only reduce loss of the sample in the operation of every step, but also the efficiency of immunoprecipitation can be improved, and do not need spy Fixed kit and experimental facilities, cost is relatively low, has higher general applicability.On this basis, the present inventor completes this Invention.

The method for detecting complete genome DNA methylation

In the present invention, a kind of method of detection complete genome DNA methylation is provided, comprising steps of

(a) DNA fragmentation is provided, the DNA fragmentation is originated from cell genomic dna；

(c) the first mixture is formed with auxiliary nucleic acid fragment is added in the DNA of connector to the end；

(e) nucleic acid fragment to methylate in second mixture is captured with specific antibody；

(f) captured nucleic acid fragment is expanded with specific primer, to obtain the nucleic acid piece containing methylation The amplified production of section.

In a preferred embodiment of the present invention, the DNA fragmentation comes from 100pg nucleic acid, the auxiliary nucleic acid piece The length of section is 2082bp, and the amount of the auxiliary nucleic acid fragment is 50ng, and the content of the antibody is 2ug, the antibody and the The ratio of two mixtures is 100:1-10:1.

The MeDIP-seq that method of the invention is suitable for minute quantity source sample is analyzed, by a small amount of initial sample Methylation λ DNA is added, can not only reduce loss of the sample in the operation of every step, but also the efficiency of immunoprecipitation can be improved, and Specific kit and experimental facilities are not needed, cost is relatively low, has higher general applicability.

Assist nucleic acid fragment and its application

Auxiliary nucleic acid fragment include methylation or non-methylation auxiliary nucleic acid fragment, auxiliary nucleic acid fragment be DNA or RNA, including phage DNA, are selected from the group: λ DNA.In the present invention, the auxiliary nucleic acid fragment is λ DNA.Assist nucleic acid piece The content of section is 25-100ng.

Auxiliary nucleic acid fragment is used to prepare the reagent in building Method for Microarray Applications library.In the present invention, nucleic acid piece is assisted Section is analyzed for MeDIP-seq (Methylated DNA immunoprecipitation-sequencing), in addition, may be used also To be used for ChIP-seq (Chromatin immunoprecipitation-sequencing) sequencing analysis.

Technical principle

To facilitate the understanding of the present invention, inventor provides following principle for reference.It should be understood that protection scope of the present invention is simultaneously It is not limited by the principle.

Technical principle of the invention: hinder a small amount of sample MeDIP-seq analysis it is critical that as sample size is reduced, Just becoming highly difficult using antibody capture methylate DNA, the reason is that, in the case of few samples, collision probability between molecule It reduces, antigen-antibody joint efficiency declines to a great extent, and makes time indefinite extension required for completing to react.The present invention passes through a small amount of Methylation λ DNA is added in initial sample, can not only reduce loss of the sample in the operation of every step, but also immunoprecipitation can be improved Efficiency, therefore MeDIP process can be using conventional manual operation.The most key is the final library that λ DNA will not be mixed In, avoid the pollution of λ DNA in sample sequencing library.

Correspondingly, the technology used in the present invention means include:

1. the λ DNA of methylation is added during MeDIP, to improve the joint efficiency of antigen-antibody.And due to the λ DNA is appeared in final sequencing library without library process is built so as to avoid λ DNA.PCR amplification, purifying are carried out again, most The MeDIP-seq analysis to a small amount of sample may be implemented eventually.

2. entire MeDIP process is not needed using conventional manual operation using kit and automatic sample processing system System.

Main advantages of the present invention include:

1) minimum sample size needed for the present invention is 100pg DNA or 50 cells, is more applicable for minute quantity source sample MeDIP-seq analysis；

2) method of the invention can both reduce sample in every step by the way that methylation λ DNA is added in a small amount of initial sample Loss in operation, and the efficiency of immunoprecipitation can be improved；

3) MeDIP of the invention experiment does not need specific kit and experimental facilities, and cost is relatively low, has higher universal Applicability.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part, such as Sambrook et al., molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the normal condition proposed by manufacturer.Unless otherwise stated, no Then percentage and number are weight percent and parts by weight.

Embodiment 1.

Prepare λ DNA

1) it is prepared by PCR amplification as follows containing λ DNA, the PCR reaction system that fragment length is 2kb:

λDNA-F:TGTGGGGTGAATATGGCAGT(SEQ ID No.:1)

λDNA-R:CGTCGATTTGGTGCCGTAAT(SEQ ID No.:2)

PCR reaction condition:

2) purifying is carried out to PCR product with GeneJET PCR Purification Kit and is quantified with NanoDrop；

3) 500ng PCR product is taken, carries out external methyl with CpG Methyltransferase (M.SssI, Thermo) Change processing, reaction system are as follows:

4) after mixing, 37 DEG C of incubations 15min, 65 DEG C of incubation 20min are to terminate reaction；

5) purifying is carried out to PCR product with GeneJET PCR Purification Kit and is quantified with NanoDrop.

Extract genomic DNA and ultrasound fracture

6) 50 FGSC cells are added in the cell pyrolysis liquid of 0.5%SDS, 65 DEG C are incubated overnight (if being with DNA Beginning sample can then omit step 6-7)；

7) DNA is purified by phenol chloroform and ethanol precipitation；

8) DNA sample is subjected to ultrasound fracture to 100-500bp；

9) ultrasound is detected by agarose gel electrophoresis (need to be by sample concentration) or Agilent Bioanalyzer 2100 Clip size.

High-throughput sequencing library (A) is constructed with KAPA Hyper Prep Kit

10) ultrasonic cleavage product is subjected to end reparation, the end 3' adds dA to connect with connector, and connection product is used Agencourt AMPure XP beads is purified, all to operate the experiment side provided according to KAPA Hyper Prep Kit Case carries out.

The DNA fragmentation (MeDIP) of immunoprecipitation methylation

This part operation can also use MethylCap (MethylCap kit, Diagenode) or MBD (Lan X et Al., PLoS One, 2011) method substitution, the following are the operating process of MeDIP method.

11) it after taking 20ul Protein A/G magnetic bead (Millipore, 16-663) to be washed twice with IP buffer, uses Magnetic bead is resuspended in 500ul IP buffer；

12) 2ug 5mC antibody (Epigentek, A-1014-010) is added in 500ul IP buffer, 4 DEG C, 40rpm is incubated for 2h；

13) it is washed magnetic bead 2 times with 1000ul IP buffer, 500ul IP buffer is added, magnetic bead is resuspended；

14) take be equivalent to 300pg pass through fragmentation genomic DNA, the connection product of 1/10 volume as Input, and Remaining sample is incubated for 10min under the conditions of 95 DEG C, sample is put to 10min on ice immediately later；

15) DNA sample of denaturation is added in the magnetic bead of resuspension, 4 DEG C, 40rpm, is incubated overnight；

16) it is enriched with magnetic bead with magnet stand, abandons supernatant, is washed magnetic bead 6 times with IP buffer；

17) with 400ul TE buffer with 0.25%SDS (K of protein containing 0.3mg/ml) resuspension magnetic bead, 55 DEG C, 800rpm is incubated for 2h；

18) it is enriched with magnetic bead with magnet stand, supernatant is transferred in new centrifuge tube, is stripped after purification with phenol chloroform, second Alcohol precipitates DNA, is finally dissolved in 10mM Tris (pH 8.0)；

It constructs high-throughput sequencing library (B)

19) Input-DNA and MeDIP-DNA are subjected to PCR amplification respectively, reaction system is as follows:

P5 primer:AATGATACGGCGACCACCGAG(SEQ ID No.:3)

P7 primer:CAAGCAGAAGACGGCATACGAG(SEQ ID No.:4)

PCR condition is as follows:

20) PCR product is purified with AMPure XP magnetic bead, method can refer to KAPA Hyper Prep Kit offer Experimental program；

21) by be tapped and recovered or AMPure XP magnetic bead (method can refer to KAPA Hyper Prep Kit offer reality Proved recipe case) screen the DNA fragmentation that clip size is 200-500bp；

22) bioaccumulation efficiency and specificity of methylate DNA are verified by qPCR；

23) library product will be built to carry out quantitative with Qubit and carry out clip size with Agilent Bioanalyzer 2100 High-flux sequence can be carried out after detection.

As a result:

Loss late is 10%-20%, and the amount of the λ DNA in sequencing library is≤2%.

Fig. 2 shows the final library the MeDIP Sanger sequencing result of 300pg FGSC genomic DNA, 6 monoclonals of picking Sanger is sent to be sequenced.Sequencing result shows, all mouse genomes of sequence, with mouse genome sequences comparison rate 97% More than.

100% compares upper Mus

AGGTACTAGATAGGGCGATTGATTTAGCGGCCGCGAATTGCCCTTCAAGCAGAAGACGGCATACGAGA TCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTATCGGGTCCCATTACAGATAGTTGTGAGCCACCGT GTGGTTGCTGGGACTTGAACTCAGGACCTCTGGAAGAGCACTCGGTGCTCTTAACCGCTGAGCCATGTCTCCAGCC CTAAATTTTTTTATTTTAAAAGTACATGGTAAAACATAAGAGCAGCTAAACAGAAGTATAGAGATGTGTTGTTTTA GTGTAGAGATGTGTTTGGTAAAATTGTTAAATCTCTATAGATTTTTTTCTGTATTTTAAAATTTTCATTAACTGCT TAGTTTTAAATTTTTAAAATACCTTGTTGCACTTGCTTAAGATCCTGTAAAACGTTTGTGTAGTATGATATCAATA TATATTCTTAAGCTTTGTTTCTAGAGTAAGAGTCTCCTTTTGTATGAGATCGGAAGAGCGTCGTGTAGGGAAAGAG TGTAGATCTCGGTGGTCGCCGTATCATTAAGGGCAATTCGTTTAAACCTGCAGGACTAGTCCCTTTAGTGAGGGTT AATTCTGAGCTTGGCGTAATCATGGTCATAGTTGGGTTTCCTGA(SEQ ID No.:7)

98% compares upper Mus

GACATCTCTATAGGGCGATTGATTTAGCGGCCGCGAATTGCCCTTCAAGCAGAAGACGGCATACGAGA TCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTAGAAAGCAACAATGACTCAGTAAGGTTCAGATT AGAAAGTTTCAAAGGGATGCAGGAGTGTACGTAACTCCACCTGGGATAAAGACGGTACATATGTTAGCAAATGACT CAGTTGTTTCCTGCCCTGGTCCTAAGAACTTGCCTGAGGCTAAGTTTAAAAGTAATGTGCTCCCTTCCAGCTCACT GCAGCACTGGGGTCCCTGGCCCTGGAAGTCTCCGGACACCCACAAGGACCCACACAGGATCCGCCACGGGATCCTA AGACCTCTGGTGAGTGGAACACAGCGCCCGATCCAATCCAATCGTGCGGGACCTGAGACTGCATTAATTAAGGAAG CAGATAACCCGGCCTGATCCAGGGCTCAAGTCACTTCCGGCCCATTGCAGCACCTGGGTCCCTGGACCGGAGAGTC TAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAGGGCAATTCGTTTAA ACCTGCAGGACTAGTCCCTTTAGTGAGGGTTAATTCTGAGCTTGGCGTAATCATGGTCAATT(SEQ ID No.:8)

100% compares upper Mus

GGGCGACTCTATAGGGCGATTGATTTAGCGGCCGCGAATTGCCCTTAATGATACGGCGACCACCGAGA TCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGCGAGCAAGACCAAAACCGCAAACTCCGAACGCCTGCTGG CCCTTCGAATACACCCGCGCTCCGCCCTCCCGGACCTCGAGGCCTCGCTGACAGTTCTCCACTCCTCAAGCGAGCC CGGAGGCTCAGCGGGAGCACCCCGTGCTCCAACCTGGTGCTCCTCCAACACCCACAGCTCTGCTTTTCTTTCTTCC CTTTCTGGAAGGCCTGGGCCTTGGGCCACGAGACCACCCTGACCACAGCCAAGTCTCCGGGGCCAGGAGCCAGGCC CTCCACTTGGACCCACACAGTTCCCCACACTCGGGACCCCACGCCCACGCGGACTGGGACTGCCCGTGTTAGCCTC GCAGGAAGAACTGCAGTGGAGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTT CTGCTTGAAGGGCAATTCGTTTAAACCTGCAGGACTAGTCCCTTTAGTGAGGGTTAATTCTGAGCTTGGCGTAATC ATGGTCATAGTGGTTTTCCTGA(SEQ ID No.:9)

100% compares upper Mus

AGGCGACTAGTATAGGGCGATTGATTTAGCGGCCGCGAATTGCCCTTCAAGCAGAAGACGGCATACGA GATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATAGTTATCTAAGATGGGAAGTCACTAGAGGG GTTTTCAAAGAACATTCTACTTTTGTTACTTTTTATGCTATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG TGTGTGAGTATGTGTGTGTGCGTGTATGTGAGTGTGTGTGTCTATGTGATTCTTGAGAGGTCAGTGAGATCGGAAG AGCGTCGTGTAGGGAAAGAGTGTATATCTCGGTGGTCGCCGTATCATTAAGGGCAATTCGTTTAAACCTGCAAGAC TAGTCCCTTTAGTGAGGGTTAATTCTGAGCTTGGCGTAATCATGGTCATAGCTGTTTCGTGA(SEQ ID No.:10)

97% compares upper Mus

GGCGACTCGATAGGGCGATTGATTTAGCGGCCGCGAATTGCCCTTAATGATACGGCGACCACCGAGAT CTACACTCTTTCCCTACACGACGCTCTTCCGATCTAAGGGTCTGGAATATGGCGAGAAAACGGAAAATCACGGAAA AGAGAAATACACACTTTAGGACGTGAAGTATGGCGAGGACAACTGAAAAAGGTGGAAAATTTAGAAATGTCCACTG TAGGACGTGGAATATGGCAAGAAAACTGAAAATCATGGAAAATGAGAAACATCCACTTGACGACTTGAAAAATGAC GAAATCACTAAAAAACGTGAAAAATGAGAAATGCACACTGAAGGACCTGGAATATGGCGAACAAACTGAAAATCAC GGAAAATGAGAAATACACACTTTAGGACGTGAAGTATGGCGAGGAAAACTGAAAAAGGTGGAAAATTTAGAAATGT CCACTATAGGAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGA AGGGCAATTCGTTTAAACCTGCAGGACTAGTCCCTTTAGTGAGGGTTAATTCTGAGCTTGGCGTAATCATGGTCAT AGTGGTTTTCCTGA(SEQ ID No.:11)

100% compares upper Mus

GGCTACTAGTATAGGGCGATTGATTTAGCGGCCGCGAATTGCCCTTAATGATACGGCGACCACCGAGA TCTACACTCTTTCCCTACACGACGCTCTTCCGATCTGAGCAGTGTATGGTGTGGGACGAGGGTGTGTATGACAGTC TTCATCTTTTAGGAACTTCTAGTGAGATCCAGGAATCACAGACAGCCACCAACAAGAAACAGGGCAACTAGGGCAC ACAGGAAGTAAAGCTAGTCTAGTGAGGCAGGGTCAGCAAAATCTCTACAAAGGGGACATTCAACCTGAGTGCTATG GGATAAGTCATGAGAGCGGAGAGGAAGTACATCCCAGTCCTGAGTGAAGTGCACTTTCATCTTAAGTGGAGCTCTG CTGTGGCCCCATAGAACAGCTATCAAGGGAGAAATTCCTCCCCTCACAGCATTAGACCAACGCTCTCCTGGTCACC TCTTCACAACAGACTCTGACCATCTTCTCAGCTGGTTTTCAGGCACACCTTACCTGCTGACGTCAACTTCTACATC TCAAGCATGGCAACACTGGAACGCCCTTCCAAGGGTTAAAACAAGATCGGAAGAGCACACGTCTGAACTCCAGTCA CACAGTGATCTCGTATGCCGTCTTCTGCTTGAAGGGCAATTCGTTTAAACCTGCAGGACTAGTCCCTTTAGTGAGG GTTAATTCTGAGCTTGGCGTAATCATGGTCATAGTTGGGTTTCCCTGA(SEQ ID No.:12)

The result shows that the present invention can in the sample of denier specificity, efficiently amplify genomic DNA (such as methyl The DNA of change), and λ DNA is practically free of in sample, not by the interference of λ DNA.

As shown in figure 3, high-flux sequence the data obtained is after processing, methylation level is shown with intuitive peak figure, each The position at peak represents the position for 5-methylcytosine occur, the degree height of the corresponding methylation of the height at peak.It can from figure Out, using method of the invention, with the continuous reduction of cell quantity, when cell is from 10⁶It is a when being reduced to 50, it still can be with Most of methylation sites are captured, gained methylation data are true and reliable, detection technique high sensitivity.

Embodiment 2.

With embodiment 1, difference is method, and the DNA of non-methylation is added.

The results show that loss late is 10% or so, amount≤2% of the λ DNA in sequencing library.

Comparative example

With embodiment 1, difference is method, is added without any auxiliary nucleic acid fragment.

The results show that sequencing library can not be successfully established.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Sequence table

<110>Shanghai Communications University

<120>a kind of method for detecting a small amount of sample complete genome DNA methylation

<130> P2018-1172

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

tgtggggtga atatggcagt 20

<210> 2

<211> 20

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

cgtcgatttg gtgccgtaat 20

<210> 3

<211> 21

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 3

aatgatacgg cgaccaccga g 21

<210> 4

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

caagcagaag acggcatacg ag 22

<210> 5

<211> 63

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

gatcggaaga gcacacgtct gaactccagt cacacagtga tctcgtatgc cgtcttctgc 60

ttg 63

<210> 6

<211> 62

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

aagcagaaga cggcatacga gatcactgtg tgactggagt tcagacgtgt gctcttccga 60

tc 62

<210> 7

<211> 644

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

aggtactaga tagggcgatt gatttagcgg ccgcgaattg cccttcaagc agaagacggc 60

atacgagatc actgtgtgac tggagttcag acgtgtgctc ttccgatcta tcgggtccca 120

ttacagatag ttgtgagcca ccgtgtggtt gctgggactt gaactcagga cctctggaag 180

agcactcggt gctcttaacc gctgagccat gtctccagcc ctaaattttt ttattttaaa 240

agtacatggt aaaacataag agcagctaaa cagaagtata gagatgtgtt gttttagtgt 300

agagatgtgt ttggtaaaat tgttaaatct ctatagattt ttttctgtat tttaaaattt 360

tcattaactg cttagtttta aatttttaaa ataccttgtt gcacttgctt aagatcctgt 420

aaaacgtttg tgtagtatga tatcaatata tattcttaag ctttgtttct agagtaagag 480

tctccttttg tatgagatcg gaagagcgtc gtgtagggaa agagtgtaga tctcggtggt 540

cgccgtatca ttaagggcaa ttcgtttaaa cctgcaggac tagtcccttt agtgagggtt 600

aattctgagc ttggcgtaat catggtcata gttgggtttc ctga 644

<210> 8

<211> 662

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 8

gacatctcta tagggcgatt gatttagcgg ccgcgaattg cccttcaagc agaagacggc 60

atacgagatc actgtgtgac tggagttcag acgtgtgctc ttccgatctg tagaaagcaa 120

caatgactca gtaaggttca gattagaaag tttcaaaggg atgcaggagt gtacgtaact 180

ccacctggga taaagacggt acatatgtta gcaaatgact cagttgtttc ctgccctggt 240

cctaagaact tgcctgaggc taagtttaaa agtaatgtgc tcccttccag ctcactgcag 300

cactggggtc cctggccctg gaagtctccg gacacccaca aggacccaca caggatccgc 360

cacgggatcc taagacctct ggtgagtgga acacagcgcc cgatccaatc caatcgtgcg 420

ggacctgaga ctgcattaat taaggaagca gataacccgg cctgatccag ggctcaagtc 480

acttccggcc cattgcagca cctgggtccc tggaccggag agtctagatc ggaagagcgt 540

cgtgtaggga aagagtgtag atctcggtgg tcgccgtatc attaagggca attcgtttaa 600

acctgcagga ctagtccctt tagtgagggt taattctgag cttggcgtaa tcatggtcaa 660

tt 662

<210> 9

<211> 622

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 9

gggcgactct atagggcgat tgatttagcg gccgcgaatt gcccttaatg atacggcgac 60

caccgagatc tacactcttt ccctacacga cgctcttccg atctgcgagc aagaccaaaa 120

ccgcaaactc cgaacgcctg ctggcccttc gaatacaccc gcgctccgcc ctcccggacc 180

tcgaggcctc gctgacagtt ctccactcct caagcgagcc cggaggctca gcgggagcac 240

cccgtgctcc aacctggtgc tcctccaaca cccacagctc tgcttttctt tcttcccttt 300

ctggaaggcc tgggccttgg gccacgagac caccctgacc acagccaagt ctccggggcc 360

aggagccagg ccctccactt ggacccacac agttccccac actcgggacc ccacgcccac 420

gcggactggg actgcccgtg ttagcctcgc aggaagaact gcagtggaga tcggaagagc 480

acacgtctga actccagtca cacagtgatc tcgtatgccg tcttctgctt gaagggcaat 540

tcgtttaaac ctgcaggact agtcccttta gtgagggtta attctgagct tggcgtaatc 600

atggtcatag tggttttcct ga 622

<210> 10

<211> 434

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 10

aggcgactag tatagggcga ttgatttagc ggccgcgaat tgcccttcaa gcagaagacg 60

gcatacgaga tcactgtgtg actggagttc agacgtgtgc tcttccgatc ttatagttat 120

ctaagatggg aagtcactag aggggttttc aaagaacatt ctacttttgt tactttttat 180

gctatgtgtg tgtgtgtgtg tgtgtgtgtg tgtgtgtgtg tgtgtgagta tgtgtgtgtg 240

cgtgtatgtg agtgtgtgtg tctatgtgat tcttgagagg tcagtgagat cggaagagcg 300

tcgtgtaggg aaagagtgta tatctcggtg gtcgccgtat cattaagggc aattcgttta 360

aacctgcaag actagtccct ttagtgaggg ttaattctga gcttggcgta atcatggtca 420

tagctgtttc gtga 434

<210> 11

<211> 614

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 11

ggcgactcga tagggcgatt gatttagcgg ccgcgaattg cccttaatga tacggcgacc 60

accgagatct acactctttc cctacacgac gctcttccga tctaagggtc tggaatatgg 120

cgagaaaacg gaaaatcacg gaaaagagaa atacacactt taggacgtga agtatggcga 180

ggacaactga aaaaggtgga aaatttagaa atgtccactg taggacgtgg aatatggcaa 240

gaaaactgaa aatcatggaa aatgagaaac atccacttga cgacttgaaa aatgacgaaa 300

tcactaaaaa acgtgaaaaa tgagaaatgc acactgaagg acctggaata tggcgaacaa 360

actgaaaatc acggaaaatg agaaatacac actttaggac gtgaagtatg gcgaggaaaa 420

ctgaaaaagg tggaaaattt agaaatgtcc actataggaa gatcggaaga gcacacgtct 480

gaactccagt cacacagtga tctcgtatgc cgtcttctgc ttgaagggca attcgtttaa 540

acctgcagga ctagtccctt tagtgagggt taattctgag cttggcgtaa tcatggtcat 600

agtggttttc ctga 614

<210> 12

<211> 724

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 12

ggctactagt atagggcgat tgatttagcg gccgcgaatt gcccttaatg atacggcgac 60

caccgagatc tacactcttt ccctacacga cgctcttccg atctgagcag tgtatggtgt 120

gggacgaggg tgtgtatgac agtcttcatc ttttaggaac ttctagtgag atccaggaat 180

cacagacagc caccaacaag aaacagggca actagggcac acaggaagta aagctagtct 240

agtgaggcag ggtcagcaaa atctctacaa aggggacatt caacctgagt gctatgggat 300

aagtcatgag agcggagagg aagtacatcc cagtcctgag tgaagtgcac tttcatctta 360

agtggagctc tgctgtggcc ccatagaaca gctatcaagg gagaaattcc tcccctcaca 420

gcattagacc aacgctctcc tggtcacctc ttcacaacag actctgacca tcttctcagc 480

tggttttcag gcacacctta cctgctgacg tcaacttcta catctcaagc atggcaacac 540

tggaacgccc ttccaagggt taaaacaaga tcggaagagc acacgtctga actccagtca 600

cacagtgatc tcgtatgccg tcttctgctt gaagggcaat tcgtttaaac ctgcaggact 660

agtcccttta gtgagggtta attctgagct tggcgtaatc atggtcatag ttgggtttcc 720

ctga 724

Claims

1. a kind of method of detection complete genome DNA methylation, which is characterized in that comprising steps of

(d) first mixture is subjected to thermal denaturation, so that the double-stranded DNA in the first mixture is become single stranded DNA, to be formed Second mixture；

(f) captured DNA fragmentation is expanded with specific primer, to obtain the DNA fragmentation for corresponding to methylation Amplified production；

2. the method as described in claim 1, which is characterized in that in step (g), comprising: built to the amplified production Then library is detected.

3. the method as described in claim 1, which is characterized in that DNA fragmentation described in step (a) is thin from 20-10000 Born of the same parents, preferably, 50-2000 cell.

4. the method as described in claim 1, which is characterized in that the auxiliary nucleic acid fragment includes methylation or non-methylation Assist nucleic acid fragment.

5. the method as described in claim 1, which is characterized in that the length of the auxiliary nucleic acid fragment is 200-4000bp, compared with Goodly, 500-3000bp, more preferably, 1000-2500bp.

6. the method as described in claim 1, which is characterized in that the amount of the auxiliary nucleic acid fragment is 5-250ng, preferably, 15-150ng, more preferably, 25-100ng.

7. the method as described in claim 1, which is characterized in that the quality of the DNA fragmentation and the auxiliary nucleic acid fragment Than for 1:5-1:10000, preferably 1:20-1:5000, more preferably 1:50-1:2000.

8. the method as described in claim 1, which is characterized in that the content of the antibody is 0.5-15ug, preferably, 1- 10ug。

9. the method as described in claim 1, which is characterized in that the ratio of the antibody and the second mixture is 10-300:1- 2-50:1, preferably, 30-200:1-5-30:1, more preferably, 50-150:1-8-20:1.

10. a kind of purposes for assisting nucleic acid fragment, which is characterized in that be used to prepare the reagent in building Method for Microarray Applications library.