CN109097371B - Application of SlMYB75 gene in improvement of tomato fruit aroma level - Google Patents

Abstract

The invention relates to application of a SlMYB75 gene in improvement of the fragrance level of tomato fruits, wherein the endogenous gene SlMYB75 of a tomato is overexpressed in the tomato by a gene engineering method, purple tomato fruits and plants are finally obtained, the content of aromatic volatile matters in the fruits is obviously increased, the sensory value of the tomato fruits is greatly improved, and the fragrance of the tomato fruits is also improved.

Description

Application of SlMYB75 gene in improvement of tomato fruit aroma level

Technical Field

The invention belongs to the field of genetic engineering, and relates to application of a SlMYB75 gene in improving the aroma level of tomato fruits.

Background

The fruits and vegetables have important economic value, and can provide abundant nutrient substances including vitamins, minerals, antioxidants and the like for human beings. However, in addition to yield, the quality of the fruits and vegetables, such as nutritional ingredients, sense, aroma, taste, and the like, can also have a significant impact on the economic value of the fruits and vegetables to a great extent.

Aromas are mixtures of a range of aromatic volatile substances that play a vital role in consumer enjoyment and acceptability of flowers, vegetables and fruits.

Anthocyanins are a class of water-soluble pigments widely distributed in plants, and belong to the flavonoids, which are usually associated with the formation of color in plants. Many studies have shown that anthocyanins have a strong antioxidant capacity and are effective in scavenging reactive oxygen free radicals. In addition, the anthocyanin plays an important role in delaying senescence, can effectively inhibit the growth of tumor cells and delay the life of tumor-bearing mice. However, these health benefits of anthocyanins have a significant positive correlation with daily dietary doses of anthocyanins.

Tomatoes are widely planted vegetables and fruits in the world, and the fruits of the tomatoes are always popular among the public. However, naturally cultivated tomato fruits contain little anthocyanins.

Improving the sensory and nutritional quality of fruits has always been an important issue of great concern to breeders.

In addition, the traditional breeding method has long period, high cost and unstable effect. In recent years, with the rapid development of genetic engineering and the increasing improvement of transgenic technology, the genetic engineering technology has great potential in the aspect of cultivating excellent crop varieties.

Disclosure of Invention

In view of the above, the invention aims to provide an application of a SlMYB75 gene in improving the aroma level of tomato fruits.

In order to achieve the purpose, the invention provides the following technical scheme:

the nucleotide sequence of the SlMYB75 gene is shown in SEQ ID NO. 1.

Application of SlMYB75 gene in cultivation of purple orange tomato variety.

A recombinant expression vector containing a SlMYB75 gene.

The construction method of the recombinant expression vector comprises the step of connecting a SlMYB75 gene to a Sma I site of pLp100-35S to obtain a recombinant plasmid pLp100-35S-SlMYB 75.

Preferably, the SlMYB75 gene is ligated by homologous recombination.

Preferably, the coding frame of the SlMYB75 gene obtained by amplifying the amplification primer sequences SEQ-F (the underlined part is a carrier joint sequence) and SEQ-R (the underlined part is a carrier joint sequence) shown in SEQ ID NO.2 and SEQ ID NO.3 is connected to a cloning vector pEasy-blunt-Zero, and then the coding frame of the SlMYB75 gene is connected to a pLp100-35S final vector through a homologous recombination reaction, wherein the nucleotide sequence of the pLp100-35S final vector is shown in SEQ ID NO. 8.

SEQ-F：

ATGAATACTCCTATGTGTGCATCGT, as shown in SEQ ID NO. 2;

SEQ-R：

ATTAAGTAGATTCCATAAGTCAATA, SEQ ID NO. 3.

The recombinant expression vector is applied to cultivation of purple orange tomato varieties.

A cultivation method of a purple orange tomato variety comprises the following specific steps:

(1) constructing a recombinant expression vector containing a SlMYB75 gene, converting a microbial transformant, and preparing engineering bacteria;

(2) transforming tomato explants by using the engineering bacteria prepared in the step (1), co-culturing, inducing germination and rooting to obtain the purple orange tomato variety.

Preferably, in step (1), the microorganism is transformed by Agrobacterium tumefaciens GV 3101.

Preferably, the specific method of step (1) is:

(1-1) connecting the amplified fragment obtained by adopting the amplification primer sequences SEQ-F and SEQ-R shown in SEQ ID NO.2 and SEQ ID NO.3 with pEasy-blunt-Zero vector of Beijing holotype gold biotechnology limited, converting DH5 alpha, coating the converted fragment on a plate containing 50 mu g/mL kanamycin for screening, selecting a monoclonal strain, carrying out colony PCR, sending the amplified strain of the target fragment to sequencing, and determining the strain as a positive strain after the sequencing is correct;

(1-2) extracting plasmids from the positive bacterial strains in the step (1-1) by shaking, amplifying by using the plasmids as templates and adopting amplification primer sequences shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain fragments, cutting the gel, recovering, and then performing single enzyme digestion on the recovered target products and pLp100-35S empty carrier gel of Sma I to recover products in TAKARA

Carrying out homologous recombination reaction under the condition of an HD Cloning Kit, coating the product converted DH5 alpha on a plate containing 50 mu g/mL kanamycin for screening, selecting a monoclonal strain, carrying out colony PCR (polymerase chain reaction) by using amplification primer sequences shown in SEQ ID NO.2 and SEQ ID NO.3 for amplification, amplifying a target strip, transmitting the sequence only when the size of the fragment is consistent with the expected size, and determining the fragment as a positive strain after the sequence is correct;

(1-3) taking the positive strain obtained in the step (1-2), shaking the strain, obtaining quality-improved particles which are pLp100-35S-SlMYB75 plasmids of the recombinant expression vector, screening transformed Agrobacterium tumefaciens GV3101 on a plate containing 50 mu g/mL kanamycin and 100 mu g/mL rifampicin, selecting a single clone for colony PCR verification, and obtaining the strain after the verification is the engineering bacteria of the recombinant expression vector.

Preferably, the specific method of step (2) is: the tomato explants are transformed by a leaf disc method by using agrobacterium containing recombinant plasmid pLp100-35S-SlMYB75, and the specific steps are as follows:

a. seed disinfection

Putting wild tomato seeds into a sterilized tissue culture bottle, and pouring 70 volume percent ethanol water solution for soaking for 30s for surface disinfection; pouring out the ethanol water solution, and immediately pouring the sodium hypochlorite solution with 5% of available chlorine for soaking for 15 min; washing with sterile water for 3 times, reserving appropriate amount of sterile water to allow the seeds to be submerged, covering the bottle cap tightly, and placing on a shaking table at 100rpm for 2-3 days. Transferring the germinated seeds to a seed culture medium, and culturing in an illumination incubator.

b. Explant preculture

For the optimal period for obtaining explants when the true leaves of tomato seedlings are about to grow out, the seedlings are placed on sterile filter paper, cotyledons and hypocotyls are cut into sections by an operating blade, and the sections are carefully transferred to a KCMS pre-culture medium by tweezers for dark culture for one day.

c. Agrobacterium infection explant

To 20mL LB (containing 20. mu.L of 50. mu.g/mL kanamycin and 40. mu.L of 100. mu.g/mL rifampicin) was added 100. mu.L of the stored Agrobacterium glycerol, incubated overnight at 28 ℃ and 250rpm until OD₆₀₀About 1.0. Absorbing 1mL of bacterial liquid, centrifuging at 5000rpm for 5min, discarding the supernatant, washing with KCMS liquid culture medium once, and diluting the bacterial liquid to OD with KCMS liquid culture medium₆₀₀An optimal concentration of infection is about 0.1. And dripping 10 mu L of diluted agrobacterium tumefaciens on the wound of the explant, sealing the dish and performing dark culture for 2 days without sucking out the bacterial liquid.

d. Differentiation and rooting of explants

After 2 days of co-culture of explants with Agrobacterium, the explants were carefully transferred with forceps to primary 2Z medium for culture, and the primary medium was changed every 2 weeks. When differentiated shoots emerged, explants were transferred to 1Z medium for culture, and the medium was changed every 2 weeks. When the differentiated callus grows out buds with independent main stems, the buds are cut off and inserted into a rooting medium ENR, and the buds are transplanted into soil after rooting.

e. Identification of transgenic Positive plants

A front primer is designed at the 3' end of a SlMYB75 gene, a rear primer (SlMYB75-OE check-F: CCTCAACCTCGGAACTTCTC; SlMYB75-OE check-R: CCTGGATTTTGGTTTTTAGGG) is designed at the tail end of a 35S-Terminator (35S-Terminator) sequence, and as shown in SEQ ID No.4 and SEQ ID No.5, PCR amplification is carried out by taking the genomic DNA of T0 generation seedlings as a template, and a segment with an expected size is determined to be a transgenic positive plant after electrophoresis detection. Seeds of T0 generation are sown after kanamycin screening, total RNA of plant leaves of T1 generation is extracted, after cDNA reverse transcription, fluorescent quantitative PCR is carried out to detect the expression quantity of SlMYB75 gene (SlMYB75-qPCR-F: CCTCAACCTCGGAACTTCTC; SlMYB75-qPCR-R: TCTCCTATTGGCTTCTCACAAA), and as shown in SEQ ID NO.6 and SEQ ID NO.7, 3 strains with higher expression quantity are sown to T2 and T3 after kanamycin screening for subsequent research.

Further preferably, in step a, the light incubator conditions are: illuminating for 14 hours at the temperature of 25 ℃; dark 10 hours, temperature 20 ℃; illumination intensity, 250. mu. mol. m^-2·s^-1(ii) a Relative humidity, 80%.

A purple orange tomato variety is obtained by the cultivation method.

The invention has the beneficial effects that:

according to the invention, the endogenous gene SlMYB75 of the tomato is overexpressed in the tomato by a genetic engineering method, purple tomato fruits and plants are finally obtained, and the content of aromatic volatile matters in the fruits is obviously increased, so that the sensory value of the tomato fruits is greatly improved, and the aroma of the tomato fruits is also improved.

Specifically, a recombinant expression vector containing a tomato SlMYB75 gene is transformed by an agrobacterium-mediated leaf disc method, and a tomato is transformed to obtain a transgenic purple tomato. Compared with wild plants, the SlMYB75 gene in the transgenic tomato has obvious expression, the whole transgenic tomato plant and fruit have obvious purple phenotypes, and the aromatic volatile substance content of the transgenic tomato fruit, particularly the content of aldehyde and terpene volatile substances, is obviously higher than that of the wild plants. The method adopts a genetic engineering technology, can efficiently and stably increase the contents of anthocyanin and aromatic volatile matters in tomato fruits in a genetic manner, makes active exploration on the improvement of tomato quality, has great significance in the aspect of cultivating fruit varieties with high sense, aroma and resistance, provides reference and reference for innovative breeding strategies, aims to better adapt to the requirements of current consumers, and has wide market prospect and economic value.

Drawings

In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:

FIG. 1 is a colony PCR (polymerase chain reaction) verification gel electrophoresis diagram of a tomato SlMYB75 gene amplification product connected with a pEasy-blunt zero vector, wherein M is a DNA molecular weight standard Marker, and 1 is a target strip for detecting primer amplification;

FIG. 2 is a diagram of a verified gel electrophoresis of the colony PCR after the Agrobacterium GV3101 is transformed by the final vector pLp100-35S-SlMYB75, wherein M is a DNA molecular weight standard Marker, and 1 and 2 are target bands for detecting primer amplification;

FIG. 3 is an analysis of the expression level of the tomato SlMYB75 gene in Wild Type (WT) and transgenic (#11, #19, and #21) tomatoes; WT represents wild type, #11, #19 and #21 are 3 transgenic lines;

FIG. 4 is a comparison of the phenotype of transgenic purple orange tomato (#11) and wild type tomato (WT) plants; wherein the #11 strain (especially young leaves) exhibited macroscopic anthocyanin accumulation;

FIG. 5 is a graph comparing the mature fruit phenotype of transgenic purple orange tomatoes (#11, #19) with wild-type tomatoes (WT); the #11 and #19 strains accumulate a large amount of anthocyanin in the peel and pulp, and can be seen by naked eyes;

FIG. 6 is a graph of anthocyanin levels in wild type tomato (WT) and transgenic purple orange tomato (#11, #19) fruits; almost no anthocyanin is accumulated in WT, and a large amount of anthocyanin is accumulated in the #11 and #19 transgenic lines;

FIG. 7 is the sequence information of the open reading frame of the SlMYB75 gene;

FIG. 8 is a map of pLp100-35S vector.

Detailed Description

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

The cloning vector pEasy-blunt-Zero related to the present invention was purchased from Beijing Quanyu gold biology Co., Ltd.

A cultivation method of a purple orange tomato variety comprises the following specific steps:

(1) constructing recombinant expression vector containing SLMYB75 gene (see the sequence information of open reading frame in figure 7), transforming microbial transformant, and preparing engineering bacteria

(1-1) connecting the amplified fragment obtained by adopting the amplification primer sequences SEQ-F and SEQ-R shown in SEQ ID NO.2 and SEQ ID NO.3 with pEasy-blunt-zero vector of Beijing Quanyujin biotechnology limited, converting DH5 alpha, coating the converted fragment on a plate containing 50 mu g/mL kanamycin for screening, selecting a monoclonal strain, performing colony PCR, sequencing the amplified strain of the target fragment, and determining the strain as a positive strain after the sequencing is correct; (FIG. 1)

(1-2) extracting plasmid from the positive strain shake bacteria in the step (1-1), using the plasmid as a template and adopting amplification primer sequences shown in SEQ ID NO.2 and SEQ ID NO.3 for amplification, cutting the obtained fragments into gel, recovering, and then recovering the recovered target product and pLp100-35S (shown in a carrier map in figure 8) single enzyme-digested Sma I empty carrier gel in TAKARA

Carrying out homologous recombination reaction under the condition of an HD Cloning Kit, coating the product converted DH5 alpha on a plate containing 50 mu g/mL kanamycin for screening, selecting a monoclonal strain, carrying out colony PCR (polymerase chain reaction) by using amplification primer sequences shown in SEQ ID NO.2 and SEQ ID NO.3 for amplification, amplifying a target strip, transmitting the sequence only when the size of the fragment is consistent with the expected size, and determining the fragment as a positive strain after the sequence is correct;

(1-3) taking the positive strain obtained in the step (1-2), shaking the strain, wherein the quality-improved particles are pLp100-35S-SlMYB75 plasmid, screening the transformed agrobacterium GV3101 on a plate containing 50 mu g/mL kanamycin and 100 mu g/mL rifampicin, selecting a single clone to perform colony PCR verification (the primer pair is SEQ ID NO.2 and SEQ ID NO.3, and SEQ ID NO.2 and SEQ ID NO.5), and verifying that the passed strain is the engineering bacteria of the recombinant expression vector. (FIG. 2)

(2) Transforming tomato explants by using the engineering bacteria prepared in the step (1), co-culturing, inducing germination and rooting to obtain the purple orange tomato variety (figures 3-6)

The tomato explants are transformed by a leaf disc method by using agrobacterium containing recombinant plasmid pLp100-35S-SlMYB75, and the specific steps are as follows:

a. seed disinfection

Putting wild tomato seeds into a sterilized tissue culture bottle, and pouring 70 volume percent ethanol water solution for soaking for 30s for surface disinfection; pouring out the ethanol water solution, and immediately pouring the sodium hypochlorite solution with 5% of available chlorine for soaking for 15 min; washing with sterile water for 3 times, reserving appropriate amount of sterile water to allow the seeds to be submerged, covering the bottle cap tightly, and placing on a shaking table at 100rpm for 2-3 days. Transferring the germinated seeds to a seed culture medium, and culturing in an illumination incubator.

b. Explant preculture

For the optimal period for obtaining explants when the true leaves of tomato seedlings are about to grow out, the seedlings are placed on sterile filter paper, cotyledons and hypocotyls are cut into sections by an operating blade, and the sections are carefully transferred to a KCMS pre-culture medium by tweezers for dark culture for one day.

c. Agrobacterium infection explant

To 20mL LB (containing 20. mu.L of 50. mu.g/mL kanamycin and 40. mu.L of 100. mu.g/mL rifampicin) was added 100. mu.L of the stored Agrobacterium glycerol, incubated overnight at 28 ℃ and 250rpm until OD₆₀₀About 1.0. Absorbing 1mL of bacterial liquid, centrifuging at 5000rpm for 5min, discarding the supernatant, washing with KCMS liquid culture medium once, and diluting the bacterial liquid to OD with KCMS liquid culture medium₆₀₀An optimal concentration of infection is about 0.1. And dripping 10 mu L of diluted agrobacterium tumefaciens on the wound of the explant, sealing the dish and performing dark culture for 2 days without sucking out the bacterial liquid.

d. Differentiation and rooting of explants

After 2 days of co-culture of explants with Agrobacterium, the explants were carefully transferred with forceps to primary 2Z medium for culture, and the primary medium was changed every 2 weeks. When differentiated shoots emerged, explants were transferred to 1Z medium for culture, and the medium was changed every 2 weeks. When the differentiated callus grows out buds with independent main stems, the buds are cut off and inserted into a rooting medium ENR, and the buds are transplanted into soil after rooting.

e. Identification of transgenic Positive plants

A front primer is designed at the 3' end of a SlMYB75 gene, a rear primer (SlMYB75-OE check-F: CCTCAACCTCGGAACTTCTC; SlMYB75-OE check-R: CCTGGATTTTGGTTTTTAGGG) is designed at the tail end of a 35S-Terminator (35S-Terminator) sequence, and as shown in SEQ ID No.4 and SEQ ID No.5, PCR amplification is carried out by taking the genomic DNA of T0 generation seedlings as a template, and a segment with an expected size is determined to be a transgenic positive plant after electrophoresis detection. Seeds of T0 generation are sown after kanamycin screening, total RNA of plant leaves of T1 generation is extracted, after cDNA reverse transcription, fluorescent quantitative PCR is carried out to detect the expression quantity of SlMYB75 gene (SlMYB75-qPCR-F: CCTCAACCTCGGAACTTCTC; SlMYB75-qPCR-R: TCTCCTATTGGCTTCTCACAAA), and as shown in SEQ ID NO.6 and SEQ ID NO.7, 3 strains with higher expression quantity are sown to T2 and T3 after kanamycin screening for subsequent research.

In the step a, the conditions of the illumination incubator are as follows: illuminating for 14 hours at the temperature of 25 ℃; dark 10 hours, temperature 20 ℃; illumination intensity, 250. mu. mol. m^-2·s^-1(ii) a Relative humidity, 80%.

Table 1 shows the measurement of the content of aromatic volatiles in fruits of wild type tomato (WT) and transgenic purple orange tomato (#11, #19) at the 7-day (BR +7) and 10-day (BR +10) after fruit color breaking; where ND stands for no detection, generally indicating very low levels. It can be seen from table 1 that the majority of aromatic volatiles content in the transgenic fruits is significantly higher than that of the wild type.

TABLE 1 determination of aromatic volatile content

The formula of the culture medium is shown in the table 2.

TABLE 2 culture Medium and additives ratio Table

Note: -represents no addition. MS, MS basal salt culture medium; KH (Perkin Elmer)₂PO4, potassium dihydrogen phosphate; VB1, vitamin B1; AS, acetosyringone; 2,4-D, growth hormone; KT, kinetin; aug, amoxicillin sodium and clavulanate potassium; tm, ticarcillin sodium and potassium clavulanate; kan, kanamycin; ZR, trans-zeatin nucleoside; VR 3: vitamin B11 g/L, nicotinic acid 0.5g/L and vitamin B60.5 g/L.

Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, although the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.

Sequence listing

<110> university of Chongqing

Application of <120> SlMYB75 gene in improvement of tomato fruit aroma level

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 825

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaatactc ctatgtgtgc atcgttggga gttaggaaag gttcatggac tgaacaagaa 60

gattctcttt taagagattg cattcaaaaa tatggtgaag gaaagtggca tcttgttcct 120

gctagagctg gtttaaatcg atgtcgaaag agttgcagac taaggtggct aaactatcta 180

aggccacata tcaagagagg tgactttgct ccagatgaag tggatctcat cttgagactt 240

cacaaactct taggcaatag gtggtcactt attgctggta gacttccagg aaggacagca 300

aacgatgtga agaactattg gaatacacac tttcacaaga agttaagtat tattgctcct 360

catctacatc ctcattctcg tcctcgttct catcctcgtc tacagattaa gcataagagc 420

atcgcggtta ctaagaatga aataataaga cctcaacctc ggaacttctc aaacgttaag 480

aagaatgatt ctcattggtg caacaacaaa agtatgatca caaacacatt agacaaagat 540

gacaaacgtt gcaacgaaat cgttgtaaat atttgtgaga agccaatagg agaaaataca 600

tcgtcgatag acgatggagt tgaatggtgg acaaatttac tggaaaattg cattgaaatt 660

gaagaagaaa cagctaatac aaattttgga aaaacaccaa caatgttgtt acatgaggaa 720

atatcaccac cgttagttaa tggtgaagac aactccatgc aacaaggacc aactaataat 780

tgggatgact tttcaactga tattgactta tggaatctac ttaat 825

<210> 2

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttggagagga cagggtaccc atgaatactc ctatgtgtgc atcgt 45

<210> 3

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtcgactcta gaggatcccc attaagtaga ttccataagt caata 45

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cctcaacctc ggaacttctc 20

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cctggatttt ggtttttagg g 21

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cctcaacctc ggaacttctc 20

<210> 7

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tctcctattg gcttctcaca aa 22

<210> 8

<211> 10968

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttatcgcgcg cggtgtcatc tatgttacta gatcgggcct cctgtcaatg ctggcggcgg 60

ctctggtggt ggttctggtg gcggctctga gggtggtggc tctgagggtg gcggttctga 120

gggtggcggc tctgagggag gcggttccgg tggtggctct ggttccggtg attttgatta 180

tgaaaagatg gcaaacgcta ataagggggc tatgaccgaa aatgccgatg aaaacgcgct 240

acagtctgac gctaaaggca aacttgattc tgtcgctact gattacggtg ctgctatcga 300

ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg aatgtattta 360

gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac ctgacgtcta 420

agaaaccatt attatcatga cattaaccta taaaaatagg cgtatcacga ggccctttcg 480

tcttcaagaa ttcccatgga gtcaaagatt caaatagagg acctaacaga actcgccgta 540

aagactggcg aacagttcat acagagtctc ttacgactca atgacaagaa gaaaatcttc 600

gtcaacatgg tggagcacga cacgcttgtc tactccaaaa atatcaaaga tacagtctca 660

gaagaccaaa gggcaattga gacttttcaa caaagggtaa tatccggaaa cctcctcgga 720

ttccattgcc cagctatctg tcactttatt gtgaagatag tggaaaagga aggtggctcc 780

tacaaatgcc atcattgcga taaaggaaag gccatcgttg aagatgcctc tgccgacagt 840

ggtcccaaag atggaccccc acccacgagg agcatcgtgg aaaaagaaga cgttccaacc 900

acgtcttcaa agcaagtgga ttgatgtgat atctccactg acgtaaggga tgacgcacaa 960

tcccactatc cttcgcaaga cccttcctct atataaggaa gttcatttca tttggagagg 1020

acagggtacc cggggatcct ctagagtcga cctgcaggca tgcccgctga aatcaccagt 1080

ctctctctac aaatctatct ctctctataa taatgtgtga gtatttccca gataagggaa 1140

ttagggttct taaagggttt cgctcatgtg ttgagcatat aagaaaccct taatatgtat 1200

tttgtatttg taaaatactt ctatcagtaa aatttctaat tccctaaaaa ccaaaatcca 1260

ggggtaccga gctcgaattc caagcttggc actggccgtc gttttacaac gtcgtgactg 1320

ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca catccccctt tcgccagctg 1380

gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa cagttgcgca gcctgaatgg 1440

cgaatgctag agcagcttga gcttggatca gattgtcgtt tcccgccttc agtttagctt 1500

catggagtca aagattcaaa tagaggacct aacagaactc gccgtaaaga ctggcgaaca 1560

gttcatacag agtctcttac gactcaatga caagaagaaa atcttcgtca acatggtgga 1620

gcacgacaca cttgtctact ccaaaaatat caaagataca gtctcagaag accaaagggc 1680

aattgagact tttcaacaaa gggtaatatc cggaaacctc ctcggattcc attgcccagc 1740

tatctgtcac tttattgtga agatagtgga aaaggaaggt ggctcctaca aatgccatca 1800

ttgcgataaa ggaaaggcca tcgttgaaga tgcctctgcc gacagtggtc ccaaagatgg 1860

acccccaccc acgaggagca tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca 1920

agtggattga tgtgatatct ccactgacgt aagggatgac gcacaatccc actatccttc 1980

gcaagaccct tcctctatat aaggaagttc atttcatttg gagagaacac gggggactgg 2040

gtaccgacca tggtccgtcc tgtagaaacc ccaacccgtg aaatcaaaaa actcgacggc 2100

ctgtgggcat tcagtctgga tcgcgaaaac tgtggaattg atcagcgttg gtgggaaagc 2160

gcgttacaag aaagccgggc aattgctgtg ccaggcagtt ttaacgatca gttcgccgat 2220

gcagatattc gtaattatgc gggcaacgtc tggtatcagc gcgaagtctt tataccgaaa 2280

ggttgggcag gccagcgtat cgtgctgcgt ttcgatgcgg tcactcatta cggcaaagtg 2340

tgggtcaata atcaggaagt gatggagcat cagggcggct atacgccatt tgaagccgat 2400

gtcacgccgt atgttattgc cgggaaaagt gtacgtatca ccgtttgtgt gaacaacgaa 2460

ctgaactggc agactatccc gccgggaatg gtgattaccg acgaaaacgg caagaaaaag 2520

cagtcttact tccatgattt ctttaactat gccggaatcc atcgcagcgt aatgctctac 2580

accacgccga acacctgggt ggacgatatc accgtggtga cgcatgtcgc gcaagactgt 2640

aaccacgcgt ctgttgactg gcaggtggtg gccaatggtg atgtcagcgt tgaactgcgt 2700

gatgcggatc aacaggtggt tgcaactgga caaggcacta gcgggacttt gcaagtggtg 2760

aatccgcacc tctggcaacc gggtgaaggt tatctctatg aactgtgcgt cacagccaaa 2820

agccagacag agtgtgatat ctacccgctt cgcgtcggca tccggtcagt ggcagtgaag 2880

ggccaacagt tcctgattaa ccacaaaccg ttctacttta ctggctttgg tcgtcatgaa 2940

gatgcggact tacgtggcaa aggattcgat aacgtgctga tggtgcacga ccacgcatta 3000

atggactgga ttggggccaa ctcctaccgt acctcgcatt acccttacgc tgaagagatg 3060

ctcgactggg cagatgaaca tggcatcgtg gtgattgatg aaactgctgc tgtcggcttt 3120

aacctctctt taggcattgg tttcgaagcg ggcaacaagc cgaaagaact gtacagcgaa 3180

gaggcagtca acggggaaac tcagcaagcg cacttacagg cgattaaaga gctgatagcg 3240

cgtgacaaaa accacccaag cgtggtgatg tggagtattg ccaacgaacc ggatacccgt 3300

ccgcaagtgc acgggaatat ttcgccactg gcggaagcaa cgcgtaaact cgacccgacg 3360

cgtccgatca cctgcgtcaa tgtaatgttc tgcgacgctc acaccgatac catcagcgat 3420

ctctttgatg tgctgtgcct gaaccgttat tacggatggt atgtccaaag cggcgatttg 3480

gaaacggcag agaaggtact ggaaaaagaa cttctggcct ggcaggagaa actgcatcag 3540

ccgattatca tcaccgaata cggcgtggat acgttagccg ggctgcactc aatgtacacc 3600

gacatgtgga gtgaagagta tcagtgtgca tggctggata tgtatcaccg cgtctttgat 3660

cgcgtcagcg ccgtcgtcgg tgaacaggta tggaatttcg ccgattttgc gacctcgcaa 3720

ggcatattgc gcgttggcgg taacaagaaa gggatcttca ctcgcgaccg caaaccgaag 3780

tcggcggctt ttctgctgca aaaacgctgg actggcatga acttcggtga aaaaccgcag 3840

cagggaggca aacaatgaat caacaactct cctggcgcac catcgtcggc tacagcctcg 3900

ggaattgcta ccgagctcga atttccccga tcgttcaaac atttggcaat aaagtttctt 3960

aagattgaat cctgttgccg gtcttgcgat gattatcata taatttctgt tgaattacgt 4020

taagcatgta ataattaaca tgtaatgcat gacgttattt atgagatggg tttttatgat 4080

tagagtcccg caattataca tttaatacgc gatagaaaac aaaatatagc gcgcaaacta 4140

ggataaatta tcgcgcgcgg tgtcatctat gttactagat cgggaattaa ttcactggcc 4200

gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta cccaacttaa tcgccttgca 4260

gcacatcccc ctttcgccag ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc 4320

caacagttgc gcagcctgaa tggcgcccgc tcctttcgct ttcttccctt cctttctcgc 4380

cacgttcgcc ggctttcccc gtcaagctct aaatcggggg ctccctttag ggttccgatt 4440

tagtgcttta cggcacctcg accccaaaaa acttgatttg ggtgatggtt cacgtagtgg 4500

gccatcgccc tgatagacgg tttttcgccc tttgacgttg gagtccacgt tctttaatag 4560

tggactcttg ttccaaactg gaacaacact caaccctatc tcgggctatt cttttgattt 4620

ataagggatt ttgccgattt cggaaccacc atcaaacagg attttcgcct gctggggcaa 4680

accagcgtgg accgcttgct gcaactctct cagggccagg cggtgaaggg caatcagctg 4740

ttgcccgtct cactggtgaa aagaaaaacc accccagtac attaaaaacg tccgcaatgt 4800

gttattaagt tgtctaagcg tcaatttgtt tacaccacaa tatatcctgc caccagccag 4860

ccaacagctc cccgaccggc agctcggcac aaaatcacca ctcgatacag gcagcccatc 4920

agtccgggac ggcgtcagcg ggagagccgt tgtaaggcgg cagactttgc tcatgttacc 4980

gatgctattc ggaagaacgg caactaagct gccgggtttg aaacacggat gatctcgcgg 5040

agggtagcat gttgattgta acgatgacag agcgttgctg cctgtgatca aatatcatct 5100

ccctcgcaga gatccgaatt atcagccttc ttattcattt ctcgcttaac cgtgacaggc 5160

tgtcgatctt gagaactatg ccgacataat aggaaatcgc tggataaagc cgctgaggaa 5220

gctgagtggc gctatttctt tagaagtgaa cgttgacgat atcaactccc ctatccattg 5280

ctcaccgaat ggtacaggtc ggggacccga agttccgact gtcggcctga tgcatccccg 5340

gctgatcgac cccagatctg gggctgagaa agcccagtaa ggaaacaact gtaggttcga 5400

gtcgcgagat cccccggaac caaaggaagt aggttaaacc cgctccgatc aggccgagcc 5460

acgccaggcc gagaacattg gttcctgtag gcatcgggat tggcggatca aacactaaag 5520

ctactggaac gagcagaagt cctccggccg ccagttgcca ggcggtaaag gtgagcagag 5580

gcacgggagg ttgccacttg cgggtcagca cggttccgaa cgccatggaa accgcccccg 5640

ccaggcccgc tgcgacgccg acaggatcta gcgctgcgtt tggtgtcaac accaacagcg 5700

ccacgcccgc agttccgcaa atagccccca ggaccgccat caatcgtatc gggctaccta 5760

gcagagcggc agagatgaac acgaccatca gcggctgcac agcgcctacc gtcgccgcga 5820

ccccgcccgg caggcggtag accgaaataa acaacaagct ccagaatagc gaaatattaa 5880

gtgcgccgag gatgaagatg cgcatccacc agattcccgt tggaatctgt cggacgatca 5940

tcacgagcaa taaacccgcc ggcaacgccc gcagcagcat accggcgacc cctcggcctc 6000

gctgttcggg ctccacgaaa acgccggaca gatgcgcctt gtgagcgtcc ttggggccgt 6060

cctcctgttt gaagaccgac agcccaatga tctcgccgtc gatgtaggcg ccgaatgcca 6120

cggcatctcg caaccgttca gcgaacgcct ccatgggctt tttctcctcg tgctcgtaaa 6180

cggacccgaa catctctgga gctttcttca gggccgacaa tcggatctcg cggaaatcct 6240

gcacgtcggc cgctccaagc cgtcgaatct gagccttaat cacaattgtc aattttaatc 6300

ctctgtttat cggcagttcg tagagcgcgc cgtgcgtccc gagcgatact gagcgaagca 6360

agtgcgtcga gcagtgcccg cttgttcctg aaatgccagt aaagcgctgg ctgctgaacc 6420

cccagccgga actgacccca caaggcccta gcgtttgcaa tgcaccaggt catcattgac 6480

ccaggcgtgt tccaccaggc cgctgcctcg caactcttcg caggcttcgc cgacctgctc 6540

gcgccacttc ttcacgcggg tggaatccga tccgcacatg aggcggaagg tttccagctt 6600

gagcgggtac ggctcccggt gcgagctgaa atagtcgaac atccgtcggg ccgtcggcga 6660

cagcttgcgg tacttctccc atatgaattt cgtgtagtgg tcgccagcaa acagcacgac 6720

gatttcctcg tcgatcagga cctggcaacg ggacgttttc ttgccacggt ccaggacgcg 6780

gaagcggtgc agcagcgaca ccgattccag gtgcccaacg cggtcggacg tgaagcccat 6840

cgccgtcgcc tgtaggcgcg acaggcattc ctcggccttc gtgtaatacc ggccattgat 6900

cgaccagccc aggtcctggc aaagctcgta gaacgtgaag gtgatcggct cgccgatagg 6960

ggtgcgcttc gcgtactcca acacctgctg ccacaccagt tcgtcatcgt cggcccgcag 7020

ctcgacgccg gtgtaggtga tcttcacgtc cttgttgacg tggaaaatga ccttgttttg 7080

cagcgcctcg cgcgggattt tcttgttgcg cgtggtgaac agggcagagc gggccgtgtc 7140

gtttggcatc gctcgcatcg tgtccggcca cggcgcaata tcgaacaagg aaagctgcat 7200

ttccttgatc tgctgcttcg tgtgtttcag caacgcggcc tgcttggcct cgctgacctg 7260

ttttgccagg tcctcgccgg cggtttttcg cttcttggtc gtcatagttc ctcgcgtgtc 7320

gatggtcatc gacttcgcca aacctgccgc ctcctgttcg agacgacgcg aacgctccac 7380

ggcggccgat ggcgcgggca gggcaggggg agccagttgc acgctgtcgc gctcgatctt 7440

ggccgtagct tgctggacca tcgagccgac ggactggaag gtttcgcggg gcgcacgcat 7500

gacggtgcgg cttgcgatgg tttcggcatc ctcggcggaa aaccccgcgt cgatcagttc 7560

ttgcctgtat gccttccggt caaacgtccg attcattcac cctccttgcg ggattgcccc 7620

gactcacgcc ggggcaatgt gcccttattc ctgatttgac ccgcctggtg ccttggtgtc 7680

cagataatcc accttatcgg caatgaagtc ggtcccgtag accgtctggc cgtccttctc 7740

gtacttggta ttccgaatct tgccctgcac gaataccagc gaccccttgc ccaaatactt 7800

gccgtgggcc tcggcctgag agccaaaaca cttgatgcgg aagaagtcgg tgcgctcctg 7860

cttgtcgccg gcatcgttgc gccacatcta ggtactaaaa caattcatcc agtaaaatat 7920

aatattttat tttctcccaa tcaggcttga tccccagtaa gtcaaaaaat agctcgacat 7980

actgttcttc cccgatatcc tccctgatcg accggacgca gaaggcaatg tcataccact 8040

tgtccgccct gccgcttctc ccaagatcaa taaagccact tactttgcca tctttcacaa 8100

agatgttgct gtctcccagg tcgccgtggg aaaagacaag ttcctcttcg ggcttttccg 8160

tctttaaaaa atcatacagc tcgcgcggat ctttaaatgg agtgtcttct tcccagtttt 8220

cgcaatccac atcggccaga tcgttattca gtaagtaatc caattcggct aagcggctgt 8280

ctaagctatt cgtataggga caatccgata tgtcgatgga gtgaaagagc ctgatgcact 8340

ccgcatacag ctcgataatc ttttcagggc tttgttcatc ttcatactct tccgagcaaa 8400

ggacgccatc ggcctcactc atgagcagat tgctccagcc atcatgccgt tcaaagtgca 8460

ggacctttgg aacaggcagc tttccttcca gccatagcat catgtccttt tcccgttcca 8520

catcataggt ggtcccttta taccggctgt ccgtcatttt taaatatagg ttttcatttt 8580

ctcccaccag cttatatacc ttagcaggag acattccttc cgtatctttt acgcagcggt 8640

atttttcgat cagttttttc aattccggtg atattctcat tttagccatt tattatttcc 8700

ttcctctttt ctacagtatt taaagatacc ccaagaagct aattataaca agacgaactc 8760

caattcactg ttccttgcat tctaaaacct taaataccag aaaacagctt tttcaaagtt 8820

gttttcaaag ttggcgtata acatagtatc gacggagccg attttgaaac cacaattatg 8880

ggtgatgctg ccaacttact gatttagtgt atgatggtgt ttttgaggtg ctccagtggc 8940

ttctgtgtct atcagctgtc cctcctgttc agctactgac ggggtggtgc gtaacggcaa 9000

aagcaccgcc ggacatcagc gctatctctg ctctcactgc cgtaaaacat ggcaactgca 9060

gttcacttac accgcttctc aacccggtac gcaccagaaa atcattgata tggccatgaa 9120

tggcgttgga tgccgggcaa cagcccgcat tatgggcgtt ggcctcaaca cgattttacg 9180

tcacttaaaa aactcaggcc gcagtcggta acctcgcgca tacagccggg cagtgacgtc 9240

atcgtctgcg cggaaatgga cgaacagtgg ggctatgtcg gggctaaatc gcgccagcgc 9300

tggctgtttt acgcgtatga cagtctccgg aagacggttg ttgcgcacgt attcggtgaa 9360

cgcactatgg cgacgctggg gcgtcttatg agcctgctgt caccctttga cgtggtgata 9420

tggatgacgg atggctggcc gctgtatgaa tcccgcctga agggaaagct gcacgtaatc 9480

agcaagcgat atacgcagcg aattgagcgg cataacctga atctgaggca gcacctggca 9540

cggctgggac ggaagtcgct gtcgttctca aaatcggtgg agctgcatga caaagtcatc 9600

gggcattatc tgaacataaa acactatcaa taagttggag tcattaccca attatgatag 9660

aatttacaag ctataaggtt attgtcctgg gtttcaagca ttagtccatg caagttttta 9720

tgctttgccc attctataga tatattgata agcgcgctgc ctatgccttg ccccctgaaa 9780

tccttacata cggcgatatc ttctatataa aagatatatt atcttatcag tattgtcaat 9840

atattcaagg caatctgcct cctcatcctc ttcatcctct tcgtcttggt agctttttaa 9900

atatggcgct tcatagagta attctgtaaa ggtccaattc tcgttttcat acctcggtat 9960

aatcttacct atcacctcaa atggttcgct gggtttatcg cacccccgaa cacgagcacg 10020

gcacccgcga ccactatgcc aagaatgccc aaggtaaaaa ttgccggccc cgccatgaag 10080

tccgtgaatg ccccgacggc cgaagtgaag ggcaggccgc cacccaggcc gccgccctca 10140

ctgcccggca cctggtcgct gaatgtcgat gccagcacct gcggcacgtc aatgcttccg 10200

ggcgtcgcgc tcgggctgat cgcccatccc gttactgccc cgatcccggc aatggcaagg 10260

actgccagcg ctgccatttt tggggtgagg ccgttcgcgg ccgaggggcg cagcccctgg 10320

ggggatggga ggcccgcgtt agcgggccgg gagggttcga gaaggggggg cacccccctt 10380

cggcgtgcgc ggtcacgcgc acagggcgca gccctggtta aaaacaaggt ttataaatat 10440

tggtttaaaa gcaggttaaa agacaggtta gcggtggccg aaaaacgggc ggaaaccctt 10500

gcaaatgctg gattttctgc ctgtggacag cccctcaaat gtcaataggt gcgcccctca 10560

tctgtcagca ctctgcccct caagtgtcaa ggatcgcgcc cctcatctgt cagtagtcgc 10620

gcccctcaag tgtcaatacc gcagggcact tatccccagg cttgtccaca tcatctgtgg 10680

gaaactcgcg taaaatcagg cgttttcgcc gatttgcgag gctggccagc tccacgtcgc 10740

cggccgaaat cgagcctgcc cctcatctgt caacgccgcg ccgggtgagt cggcccctca 10800

agtgtcaacg tccgcccctc atctgtcagt gagggccaag ttttccgcga ggtatccaca 10860

acgccggcgg ccggccgcgg tgtctcgcac acggcttcga cggcgtttct ggcgcgtttg 10920

cagggccata gacggccgcc agcccagcgg cgagggcaac cagcccgg 10968

Claims (7)

1.SlMYB75Application of gene in cultivation of purple orange tomato variety, characterized in thatSlMYB75The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. Comprising the compound as claimed in claim 1SlMYB75Application of a recombinant expression vector of the gene in cultivating purple orange tomato varieties.

3. The use according to claim 2, wherein said recombinant expression vector is constructed by ligating the Sma I site of pLp100-35SSlMYB75And (3) obtaining a recombinant plasmid pLp100-35S-SlMYB 75.

4. Use according to claim 3, wherein the ligation is carried out by homologous recombinationSlMYB75A gene.

5. The use of claim 3, wherein the amplification primer sequences SEQ-F and SEQ-R shown in SEQ ID No.2 and SEQ ID No.3 are amplifiedSlMYB75The coding frame of the gene is connected to a cloning vector pEasy-blunt-Zero, and then the gene is subjected to homologous recombination reactionSlMYB75The coding frame of the gene is connected to pLp100-35S final vector, wherein, the nucleotide sequence of pLp100-35S final vector is shown in SEQ ID NO. 8.

6. A cultivation method of a purple orange tomato variety is characterized by comprising the following specific steps:

(1) construction of a composition as claimed in claim 2 containingSlMYB75Recombinant expression vector of gene, and transforming microbial transformation, preparing engineering bacteria;

(2) transforming tomato explants by using the engineering bacteria prepared in the step (1), co-culturing, inducing germination and rooting to obtain the purple orange tomato variety.

7. The cultivation method as claimed in claim 6, wherein in step (1), the microorganism transformed with Agrobacterium tumefaciens GV 3101.

Images