CN109097362A - Operon, its carrier and its application - Google Patents
Operon, its carrier and its application Download PDFInfo
- Publication number
- CN109097362A CN109097362A CN201810990251.7A CN201810990251A CN109097362A CN 109097362 A CN109097362 A CN 109097362A CN 201810990251 A CN201810990251 A CN 201810990251A CN 109097362 A CN109097362 A CN 109097362A
- Authority
- CN
- China
- Prior art keywords
- operon
- zda
- expression
- promoter
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/77—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Corynebacterium; for Brevibacterium
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses operon, its carrier and its applications, wherein, the operon sequence includes at least, and 3 ' ends are located at any base in Corynebacterium glutamicum SEQ ID NO:6 gene coded sequence ATG 201~257bp of upstream, 5 ' ends are located at any base in Corynebacterium glutamicum SEQ ID NO:6 gene coded sequence ATG upstream 308bp~345bp.After operon of the present invention is induced agent induction, it is a kind of ultra high efficiency operon that expression activity, which is significantly higher than the inducing expression activity of traditional Ptac,.Operon of the present invention can be used in that prokaryotes are endogenous or the high efficient expression of foreign protein.
Description
Technical field
The invention belongs to technical field of bioengineering, and in particular to operon, its carrier and its application.
Background technique
Promoter be the key that one-stage control genetic transcription starting DNA sequence dna, to gene expression have important tune
Control effect, promoter mainly control the transcriptional level of gene, have research by a large amount of analytical proof in control gene expression
In various sequence areas, the influence power of promoter region is more than 45%, and operon regulates and controls the expression of entire promoter.Cause
This, the operon for screening high activity is of great significance to the research of gene expression.
The problems such as that there are protein expression efficiencies is low for currently available technology, can be few with genetic tool, and develop and can be used for external source
The efficient promoter of protein expression is the important channel solved these problems.Common inducible promoter has tac to open in recent years
Mover (Ptac), Arabinose promoter, maltose evoked promoter, propionic acid evoked promoter, temperature sensitive promoter etc., but
Be these promoters expression vigor it is very limited, and selectable type is few.In view of inducible promoter in protein expression and generation
It thanks to the significance in engineering research, is highly desirable to develop a kind of inducible promoter of the high vigor of Corynebacterium glutamicum.
Summary of the invention
The purpose of this section is to summarize some aspects of the embodiment of the present invention and briefly introduce some preferable implementations
Example.It may do a little simplified or be omitted to avoid our department is made in this section and the description of the application and the title of the invention
Point, the purpose of abstract of description and denomination of invention it is fuzzy, and this simplification or omit and cannot be used for limiting the scope of the invention.
As one aspect of the present invention, the present invention overcomes the deficiencies in the prior art, provides operon.
In order to solve the above technical problems, the present invention provides the following technical scheme that operon, in which: the operon sequence
Column include at least, and 3 ' ends are located at any in Corynebacterium glutamicum SEQ ID NO:6 gene coded sequence ATG 201~257bp of upstream
Base, 5 ' ends are located at any alkali in Corynebacterium glutamicum SEQ ID NO:6 gene coded sequence ATG upstream 308bp~345bp
Base.
As another aspect of the present invention, the present invention overcomes the deficiencies in the prior art, provides carrier.
In order to solve the above technical problems, the present invention provides the following technical scheme that carrier, in which: the carrier load power
Benefit require 1 described in operon.
A kind of preferred embodiment as carrier of the present invention: the carrier includes protein expression vector p19-0-ZDA.
As another aspect of the present invention, the present invention overcomes the deficiencies in the prior art, provides the manipulation
Application of the son in protein expression.
In order to solve the above technical problems, the present invention provides the following technical scheme that the operon is in protein expression
Application.
A kind of preferred embodiment as application of the operon of the present invention in protein expression: the operon is used for
Corynebacterium glutamicum is endogenous or the expression of foreign protein.
A kind of preferred embodiment as application of the operon of the present invention in protein expression: the foreign protein packet
Include people's gastric anti-pernicious anemia factor Protein G IF, HIS-SUMO-N akrencephalon pro-BNP.
A kind of preferred embodiment as application of the operon of the present invention in protein expression: the operon has
Induced activity.
A kind of preferred embodiment as application of the operon of the present invention in protein expression: the operon can
By any one or several inductions including benzyl alcohol, benzaldehyde, benzoic acid, catechol.
A kind of preferred embodiment as application of the operon of the present invention in protein expression: the benzyl alcohol lures
Leading concentration range is 1mM~50mM.
A kind of preferred embodiment as application of the operon of the present invention in protein expression: the benzyl alcohol lures
Leading concentration is 10mM.
Beneficial effects of the present invention: after operon of the present invention is induced agent induction, expression activity is significantly higher than tradition
The inducing expression activity of Ptac, is a kind of ultra high efficiency operon.Operon of the present invention can be used in that prokaryotes are endogenous or external source
The high efficient expression of albumen.
Detailed description of the invention
In order to illustrate the technical solution of the embodiments of the present invention more clearly, required use in being described below to embodiment
Attached drawing be briefly described, it should be apparent that, drawings in the following description are only some embodiments of the invention, for this
For the those of ordinary skill of field, without any creative labor, it can also be obtained according to these attached drawings other
Attached drawing.Wherein:
Fig. 1 is the sequence map of expression vector p19-0-ZDA.
Fig. 2 is PZDAThe comparison of different length induced activity；
1: empty control plasmid；2:PZDABenzyl alcohol is not added in -98bp；3:PZDA- 98bp adds benzyl alcohol (final concentration 10mM)；4:
PZDABenzyl alcohol is not added in -180bp；5:PZDA- 180bp adds benzyl alcohol (final concentration 10mM)；6:PZDABenzyl alcohol is not added in -200bp；7:
PZDA- 200bp adds benzyl alcohol (final concentration 10mM)；8:PZDABenzyl alcohol is not added in -257bp；9:PZDA- 257bp adds benzyl alcohol (dense eventually
Spend 10mM)；10:PZDABenzyl alcohol is not added in -308bp；11:PZDA- 308bp adds benzyl alcohol (final concentration 10mM)；12:PZDA-345bp
Benzyl alcohol is not added；13:PZDA- 345bp adds benzyl alcohol (final concentration 10mM)；14:PZDABenzyl alcohol is not added in -355bp；15:PZDA-
355bp adds benzyl alcohol (final concentration 10mM)；Wherein, PZDAAfterwards length (98bp, 180bp, 200bp, 257bp, 308bp,
345bp, 355bp) represent PZDAPositioned at the length of SEQ ID NO:6ATG upstream sequence.
Fig. 3 is PZDAExpression activity comparison under different inducers；
1:PZDAInducer is not added；2:PZDAAdd benzyl alcohol (final concentration 10mM)；3:PZDAAdd benzaldehyde (final concentration 10mM)；
4:PZDAAdd benzoic acid (final concentration 10mM)；5:PZDAAdd catechol (final concentration 10mM).
Fig. 4 is PZDAExpression activity compares under the induction of various concentration benzyl alcohol；
IPTG is not added in 1:Ptac；2:Ptac adds IPTG (100 μM of final concentration)；3:PZDABenzyl alcohol is not added；4,5,6,7,8 and
9:PZDAAdd different amounts of benzyl alcohol (final concentration is followed successively by 1mM, 10mM, 15mM, 20mM, 25mM and 50mM).
Fig. 5 is the SDS-PAGE experimental analysis figure for recombinating Corynebacterium glutamicum expressing green fluorescent protein；
Swimming lane M: albumen Marker26610；1: blank control；IPTG is not added in 2:Ptac；3:Ptac adds IPTG (final concentration
100μM)；4:PZDABenzyl alcohol is not added；5,6,7,8,9 and 10: respectively indicating PZDAAdding different amounts of benzyl alcohol, (final concentration is followed successively by
1mM, 10mM, 15mM, 20mM, 25mM and 50mM).
Fig. 6 is that recombination Corynebacterium glutamicum applies PZDAExpress people's stomach internal cause fibroin application example；
Swimming lane M: albumen Marker26610；1: blank control；2: inducing expression people's gastric anti-pernicious anemia factor.
Fig. 7 recombinates the SDS-PAGE experimental analysis figure of Corynebacterium glutamicum expression BNP；
M: albumen Marker26610；1:Ptac is not added IPTG 2:Ptac and IPTG (100 μM of final concentration) is added to express BNP；3:
PZDANot inducing expression BNP；4:PZDAAdd benzyl alcohol (final concentration 10mM) inducing expression BNP.
Fig. 8 recombinates the ELASA quantitative analysis figure of Corynebacterium glutamicum expression BNP；
IPTG is not added in 1:Ptac；2:Ptac adds IPTG (100 μM of final concentration) to express BNP；3:PZDANot inducing expression BNP；4:
PZDAAdd benzyl alcohol (final concentration 10mM) inducing expression BNP.
Specific embodiment
In order to make the foregoing objectives, features and advantages of the present invention clearer and more comprehensible, right combined with specific embodiments below
A specific embodiment of the invention is described in detail.
In the following description, numerous specific details are set forth in order to facilitate a full understanding of the present invention, but the present invention can be with
Implemented using other than the one described here other way, those skilled in the art can be without prejudice to intension of the present invention
In the case of do similar popularization, therefore the present invention is not limited by the specific embodiments disclosed below.
Secondly, " one embodiment " or " embodiment " referred to herein, which refers to, may be included at least one realization side of the invention
A particular feature, structure, or characteristic in formula." in one embodiment " that different places occur in the present specification not refers both to
The same embodiment, nor the individual or selective embodiment mutually exclusive with other embodiments.
The building of carrier p19-0:
The plasmid backbone that the present invention uses includes carrier detection p19-0, which has Escherichia coli and glutamic acid rod
The shuttling performance of bacterium can be stabilized in two kinds of bacterium；The carrier detection multiple cloning sites two sides respectively there are two terminator,
One T7 terminator and a rrnB terminator, can carry influence of the promoter to the expression cassette to avoid carrier.
The construction method of carrier detection p19-0 is as follows:
Interference Bsa I restriction enzyme site GGTCTC on pXMJ19 plasmid is sported into GGTCAC；
Using pXMJ19 as template, p19-MUT-F, p19-MUT-R are the linear plasmid after primer amplification mutation, and product is used
It is directly transformed into bacillus coli DH 5 alpha after 37 DEG C of processing 2h of Dpn I, the plasmid being correctly mutated is named as p19-mut；
p19-MUT-F GATGGTAGTGTGGGGTCACCCCATGCGAGAGTAG
p19-MUT-R CTACTCTCGCATGGGGTGACCCCACACTACCATC
Reaction system is 10 × Q5Buffer, 5 μ L, 4 μ L of dNTPs (2.5mmol/L), upstream and downstream primer (10 μm of ol/L) are each
1 μ L, Q5DNA polymerase (2U/ μ L) 0.5 μ L, 1 μ L of template, add water to 50 μ L；
PCR amplification condition are as follows: 98 DEG C of 3min；98℃15s；72 DEG C of 3.25min, 30 circulations；72℃2min；
Double digestion is carried out to plasmid p19-mut using EcoRV and Hind III, removes lac I and the tac starting in plasmid
Sub-piece；The skeleton part among two segments is cloned with PCR and to draw in downstream using primer p19-0-F, p19-0-R
T7 terminator is added in object, obtained plasmid is p19-0；
p19-0-F ATCCTATCATGCCATACCGCG
p19-0-R
CCCAAGCTTCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTA (restriction enzyme site Hind
III)。
Plasmid backbone carrier of the present invention could alternatively be other prior art carriers.
(promoter of the invention is named as P to the clone of promoterZDA):
Using the bacterial genomes extracts kit of Tiangeng biochemical technology Co., Ltd, Corynebacterium glutamicum is extracted (with paddy
For propylhomoserin bar bacterium CGMCC1.15647) genome, be used for promoter cloned template；The glutamic acid rod that the present invention uses
Bacterium CGMCC1.15647, Latin are named as C.glutamicum BZH 001, are given in 2013 in Zhangjagang City Hua Chang
Pharmaceutcal corporation, Ltd.
As one of embodiment of the invention: choosing the genes of SEQ ID NO:6 of C.glutamicum BZH 001
Gene coded sequence ATG upstream 355bp to downstream 62bp sequence area design promoter cloning primer 355ZDA-F and ZDA-R
(SEQ ID NO:6 gene coded sequence ATG originates in the 501bp base of SEQ ID NO:6 sequence, SEQ ID NO:6 gene
Coded sequence is 501bp~1355bp of sequence table SEQ ID NO:6), cloned promoter and its downstream gene ATG
62bp sequence (including ATG) afterwards, and the RBS sequence of 15bp is successively introduced at the 5 ' ends of downstream primer ZDA-R
, and BamH I digestion (AAAGGAGGACAACTA) and two reversed Bsa I restriction enzyme sites and a BamH I restriction enzyme site
Site is overlapped with second BsaI restriction enzyme site notch；
ZDA-F TTCGAAGCTTCTTTGAAGCGGTGTGTGAC (underscore is restriction enzyme site Hind III)
ZDA-R
CCGGGGATCCGAGACCAAAAAATTTTTTGGTCTCACATTAGTTGTCCTCCTTTTCAGTTGCCTTGTTG
CC (underscore restriction enzyme site is followed successively by BamHI, Bsa I and Bsa I).
Reaction system is 10 × Q5 Buffer, 5 μ L, 4 μ L of dNTPs (2.5mmol/L), upstream and downstream primer (10 μm of ol/L)
Each 1 μ L, Q5DNA polymerase (2U/ μ L) 0.5 μ L, 1 μ L of template, add water to 50 μ L.
PCR amplification condition are as follows: 98 DEG C of 3min；98℃15s；60℃15s；72 DEG C of 15s, 30 circulations；72℃45s.
The building of expression vector p19-0-ZDA:
The P that will be cloned mentioned by PCRZDAPromoter fragment and p19-0 carrier detection use the restricted of TAKALA company
Endonuclease BamH I and Hind III distinguishes double digestion, and two segments use the T4 DNA ligase of TAKALA company after digestion
It is attached, obtains expression vector p19-0-ZDA.The expression plasmid contains promoter PZDA, and be inserted into immediately promoter downstream
Two reversed BsaI restriction enzyme sites, facilitate the seamless insertion of gene.The sequence of expression vector p19-0-ZDA such as SEQ ID NO:
4。
The building of EGFP expression vector p19-0-ZDA-egfp:
By taking EGFP as an example, it is used to test the activity of promoter of the present invention using EGFP as reporter gene.
It is cloned using gene egfp of the primer egfp-F and egfp-R to fluorescin EGFP, and passes through BsaI digestion
Site is cloned into the promoter P of expression vector p19-0-ZDAZDADownstream obtain EGFP expression vector p19-0-ZDA-egfp, into
The expression of row fluorescin EGFP.The gene order of egfp is as shown in SEQ ID NO:5.
egfp-F AAGGTCTCAAATGGTGAGCAAGGGCGA (underscore is that restriction enzyme site is Bsa I)
egfp-R AAGGTCTCGGATCCTTACTTGTACAGCTCGTCCATG (restriction enzyme site Bsa I)
Reaction system is 10 × Q5 Buffer, 5 μ L, 4 μ L of dNTPs (2.5mmol/L), upstream and downstream primer (10 μm of ol/L)
Each 1 μ L, Q5DNA polymerase (2U/ μ L) 0.5 μ L, 1 μ L of template, add water to 50 μ L.
PCR amplification condition are as follows: 98 DEG C of 3min；98℃15s；60℃15s；72 DEG C of 30s, 30 circulations；72℃1min15s.
The present invention is used to test the activity of promoter of the present invention using EGFP as one of " reporter gene ", and EGFP can also
The purpose of to replace with other endogenous genes, foreign gene gene.
Promoter characterization:
First to promoter P of the present inventionZDA5 ' race experiment is carried out, determines the transcription initiation site of the promoter in SEQ
At ID NO:6 Gene A TG upstream 91bp.Method is to use 5 ' race kitsRACE 5’/3’Kit
(TaKaRa, China), operates in strict accordance with specification, determines that the transcription initiation site of the promoter is on SEQ ID NO:6ATG
It swims at 91bp.For preliminary judgement promoter core space before the 91bp of the upstream ATG, 5 ' UTR are the upstream ATG 1-90bp.
Then, separately designing upstream primer 98ZDA-F, (5 ' ends for referring to promoter are SEQ ID NO:6 gene coded sequence
ATG upstream 98bp), 180ZDA-F (refer to promoter 5 ' end be SEQ ID NO:6 gene coded sequence ATG upstream 180bp),
200ZDA-F (5 ' ends for referring to promoter are SEQ ID NO:6 gene coded sequence ATG upstream 200bp), 257ZDA-F (refer to starting
Son 5 ' end be SEQ ID NO:6 gene coded sequence ATG upstream 257bp), 308ZDA-F (refer to promoter 5 ' hold be SEQ
ID NO:6 gene coded sequence ATG upstream 308bp) and 345ZDA-F (refer to promoter 5 ' end be SEQ ID NO:6 gene compile
Code sequence ATG upstream 345bp) to PZDA5 ' end truncated.
As one of embodiment of the invention, the downstream SEQ ID NO:6 gene coded sequence ATG 62bp sequence is chosen
As source gene, i.e., the end of promoter 3 ' of the present invention is SEQ ID NO:6 gene coded sequence ATG and ATG downstream 59bp, source in region
Gene order is as shown in SEQ ID NO:2.As source gene, SEQ ID NO:6 gene coded sequence ATG and ATG downstream 59bp
Only one of implementation method of the present invention, the research of the invention finds that, the segment degree of source gene can be adjusted, and still
Promoter of the present invention is set to have inducing expression activity.
As one of embodiment of the invention, operating method is to be combined respectively with above-mentioned primer with primer egfp-R,
PCR amplification (PCR system and amplification program are same as above) is carried out by template of p19-0-ZDA-egfp plasmid, the segment that amplification is obtained
Respectively with the corresponding EGFP expression vector of carrier detection p19-0 building is connected into after Hind III and BamH I double digestion, will construct
Electroporated Corynebacterium glutamicum, chlorampenicol resistant plate are sieved respectively after good carrier is cloned by bacillus coli DH 5 alpha
Choosing, and verified by bacterium colony PCR, it can be obtained containing expression vector and can express the recombination glutamic acid rod of fluorescin
Bacterium；Pass through measurement unit thallus OD600Fluorescence intensity can react the expression quantity of fluorescin EGFP, indirect determination promoter
Intensity.
98ZDA-F TTCGAAGCTTTGTTGTTATCGAGTTCAAC (underscore is restriction enzyme site Hind III)
180ZDA-F TTCGAAGCTTAGAAATATTTATGCTTCTAAAG (restriction enzyme site Hind III)
200ZDA-F TTCGAAGCTTTGCTTGAAGTGGGGTTA (restriction enzyme site Hind III)
257ZDA-F TTCGAAGCTTCCTAGGGTTTGCTCG (restriction enzyme site Hind III)
308ZDA-F TTCGAAGCTTGCGTATGACCAACAGTG (restriction enzyme site Hind III)
345ZDA-F TTCGAAGCTTGTGTGTGACATTTGCGAG (restriction enzyme site Hind III)
Recombination Corynebacterium glutamicum containing expression vector is inoculated into the LBB liquid that 5mL is 10 μ g/L containing chloramphenicol concentration
Culture medium is incubated overnight preparation seed liquor in 30 DEG C of 230rpm, measures the OD of each seed liquor respectively600；Each seed liquor is turned respectively
It is connected to fresh 20mL/100mL (culture medium that 100mL triangular flask is equipped with 20mL) LB culture medium, makes initial OD600It is 0.2,
30 DEG C of 230rpm carry out shaking flask culture, wherein inducer is added after cultivating 2h in each recombinant bacterium；And after cultivating 20h, respectively
Thallus OD is surveyed with ultraviolet specrophotometer and sepectrophotofluorometer600With thallus fluorescence intensity, and the list of each bacterial strain is calculated
Position OD600Fluorescence intensity be used for expression activity comparison.
The P of different lengthZDAExpression activity under benzyl alcohol (final concentration 10mM) induction, as a result such as Fig. 2；Work as promoter
Promoter inducing expression activity and 355bp long when being punctured into 345bp positioned at the length of SEQ ID NO:6 Gene A TG upstream sequence
It spends corresponding promoter inducing expression activity quite, therefore illustrates that promoter of the present invention may include the SEQ ID NO:6 base
Because of 5 ' the longer sequences in end of the upstream ATG 345bp, can not also include.
The present invention continues the activity for selecting the promoter of different length segment to study promoter, continues to truncate promoter
Length positioned at SEQ ID NO:6ATG upstream sequence is 308bp, although promoter inducing expression activity is compared to 345bp
Decline, but its promoter expression activity is still apparently higher than the Ptac promoter of the prior art (in conjunction with Fig. 2, Fig. 5, Fig. 8 of the present invention
It can be seen that 257P of the present inventionZDAFor promoter under conditions of without inducer inducing expression, promoter expression activity is
It is equivalent to expression activity of the even higher than prior art Ptac under inducer inducing expression state), when being punctured into 200bp
When, although the promoter does not have inducing expression activity, but still there is good expression activity, when being punctured into 180bp, this is opened
Although mover does not have inducing expression activity, but still has good expression activity.
The above experiment shows PZDAOperon sequence be located at SEQ ID NO:6 gene coded sequence ATG upstream 201bp~
Between 345bp, from Fig. 2 result it is found that operon sequence of the present invention is compiled including at least Corynebacterium glutamicum SEQ ID NO:6 gene
201bp~257bp sequence of intervals of the upstream code sequence ATG, the operon sequence include at least, and 3 ' ends are glutamic acid rod
The 201bp of the upstream bacterium SEQ ID NO:6 gene coded sequence ATG, 5 ' ends can be Corynebacterium glutamicum SEQ ID NO:6 gene
Any base in 258bp~345bp of the upstream coded sequence ATG.
Core region sequence is located at after the 200bp of the upstream ATG；When promoter is located at the length of SEQ ID NO:6ATG upstream sequence
When degree is punctured into 98bp, which is completely lost, with empty control plasmid unit OD600 fluorescence intensity phase
When.P of the present inventionZDAInducing expression activity is best when promoter length is SEQ ID NO:6ATG upstream 345bp, unit OD600's
Fluorescence intensity reaches 16272, chooses the structure and carries out subsequent experimental.
Therefore, as one of preferred embodiment of promoter of the present invention:
In promoter of the present invention, operon region sequence is on Corynebacterium glutamicum SEQ ID NO:6 gene coded sequence ATG
Swim 201bp~345bp sequence, wherein the upstream Corynebacterium glutamicum SEQ ID NO:6 gene coded sequence ATG 345bp length sequence
Column are as shown in SEQ ID NO:1；Promoter core region sequence is Corynebacterium glutamicum SEQ ID NO:6 gene coded sequence ATG
Upstream 91bp~200bp sequence；
5 ' UTR sequences are the upstream Corynebacterium glutamicum SEQ ID NO:6 gene coded sequence ATG 1bp~90bp sequence；Portion
Point source gene order includes the 59bp sequence in the downstream SEQ ID NO:6 gene coded sequence ATG and ATG, such as SEQ ID NO:2 institute
Show.Preferably, the nucleotide sequence of the promoter is as shown in SEQ ID NO:3.
The identification of promoter induced activity:
Benzyl alcohol, benzaldehyde, benzoic acid and catechol is used to carry out P as inducer respectivelyZDAInduced activity experiment,
Experimental result is as shown in Figure 3, it is seen that benzyl alcohol, benzaldehyde, benzoic acid and catechol are to PZDAThere are obvious induced activity, but phase
With (10mM) under concentration, the inducing effect of benzyl alcohol is best, and the fluorescence intensity of unit OD600 reaches 16601.
Using benzyl alcohol as inducer, different concentration gradients is set and compares PZDAActive variation, comparing result such as Fig. 4
It is shown, 345PZDAPromoter has induced activity in a very wide Benzyl alcohol concentrations range (1mM~50mM), but in final concentration
For expression activity highest in the LB culture medium of 10mM, and much higher than the expression activity of control Ptac, the fluorescence intensity of unit OD600
Reach 16740.
SDS-PAGE analysis is carried out to each bacterial strain expression foreign protein situation simultaneously: PBS being taken to wash equivalent thallus three times, point
Not Yong the PBS of equivalent thallus is resuspended, and the micro glass beads of equivalent are added, break bacterium leach protein with high-throughput homogenizer；By homogeneous liquid
Centrifugation takes the supernatant dissolved with albumen to run protein adhesive, the concentration glue that protein adhesive upper layer is 4%, the separation gel that lower layer is 12%；As a result
As shown in Figure 5, it is seen that the result and unit OD600 thallus fluorescence intensity of each bacterial strain expression EGFP (apparent molecular weight about 30kDa)
As a result consistent.
Ptac is constructed jointly with above-mentioned RBS sequence (AAAGGAGGACAACTA), exogenous genetic fragment and plasmid pXMJ19
Positive control plasmid, using plasmid pXMJ19 itself Ptac promoter, glutamic acid that this classical positive control represents
The level of bar bacterium highly effective expressing recombinant protein, building the following steps are included:
Clone constitutes genetic fragment by RBS sequence and egfp gene, and egfp gene is required as shown in SEQ ID NO:5
Primer are as follows: SD-EGFP-F and SD-EGFP-R.PCR reaction system used and program are same as above；
SD-EGFP-F CCCAAGCTTAAAGGAGGACAACTAATGGTGAGCAAGGGCG (restriction enzyme site Hind III)
SD-EGFP-R CCCGGATCCTTACTTGTACAGCTCGTCCATG (restriction enzyme site BamH I)
Hind III and BamH I double digestion；
The connection of T4DNA ligase.
The identification of promoter power:
Using experimental program as noted earlier, using primer GIF-F and GIF-R, by people's gastric anti-pernicious anemia factor albumen, (GIF apparently divides
Son amount about 45kDa, GeneID:2694) it is expressed as expressing gene, success detects big in thallus ultrasonication precipitating
Protein expression is measured, as a result as shown in Figure 6.
GIF-F:AAGGTCTCAAATGGCCTGGTTTGCCCTG (restriction enzyme site is Bsa I)
GIF-R:AAGGTCTCGGATCCTTAATACTGGGTGAAATTGGCG (restriction enzyme site is Bsa I)；
Using experimental program as noted earlier, use primer: NT-ProBNP-F and NT-ProBNP-R replace expressing gene
It is expressed for HIS-SUMO-N akrencephalon pro-BNP (NT-proBNP, apparent molecular weight about 25kDa, GeneID:4879), and
Ptac will be contained, compareed by the Ptac carrier of IPTG inducing expression foreign gene, as a result as shown in Figure 7, Figure 8, SDS-PAGE
It is consistent with ELASA quantitative analysis results to analyze result, success detects a large amount of protein expressions in the supernatant of thallus ultrasonication,
And the application promoter 345PZDAPtac expression activity under benzyl alcohol induction than IPTG induction is higher, the end HIS-SUMO-N
The expression quantity of plasma pro-brain natriuretic peptide levels reaches 440.43mg/L.
NT-ProBNP-F:AAGGTCTC(underscore is that restriction enzyme site is Bsa to AAATGGGTCATCATCACCACCACCAC
I)
NT-ProBNP-R:AAGGTCTCGGATCCTTAGCGCGGGGCACGCAG (restriction enzyme site is Bsa I)；
The results show that the inducible promoter 345P from Corynebacterium glutamicum of the inventionZDAUnder benzyl alcohol induction
It is more considerably higher than Ptac expression EGFP, HIS-SUMO-N akrencephalon pro-BNP activity of IPTG induction, in conjunction with Fig. 2 of the present invention, figure
5, Fig. 8 can be seen that 257P of the present inventionZDAPromoter under conditions of without inducer inducing expression, live by promoter expression
Property has been equivalent to expression activity of the even higher than prior art Ptac under inducer inducing expression state, promoter of the present invention
It expresses in foreign protein and metabolic engineering and is of great significance in Corynebacterium glutamicum.Operon of the present invention is induced agent
After induction, it is a kind of ultra high efficiency operon that expression activity, which is significantly higher than the inducing expression activity of traditional Ptac,.Present invention behaviour
Vertical son can be used in that prokaryotes are endogenous or the high efficient expression of foreign protein.
It should be noted that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although referring to preferable
Embodiment describes the invention in detail, those skilled in the art should understand that, it can be to technology of the invention
Scheme is modified or replaced equivalently, and without departing from the spirit and scope of the technical solution of the present invention, should all be covered in this hair
In bright scope of the claims.
Sequence table
<110>Southern Yangtze University
<120>operon, its carrier and its application
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 345
<212> DNA
<213>Corynebacterium glutamicum (Corynebacterium glutamicum)
<400> 1
gtgtgtgaca tttgcgagca attccgcagt gtcggtggcg tatgaccaac agtgcccgaa 60
caatgaagtg aagcacatta ggggaattcc tagggtttgc tcgggggtag gtgttcgcat 120
gatgtaaatt gacaggctgt ttatgtgctt gaagtggggt tatggagaaa tatttatgct 180
tctaaaggtc cctttattgt ttttaaggtt tttgggatgt tgacggattc gatgattcgg 240
gccacagtgt tgttatcgag ttcaaccgat cacaaagatt ttttcgctag gcagtgatcc 300
gactcgcacc ccctacttca cccccaaagt ctctaggagt atgac 345
<210> 2
<211> 62
<212> DNA
<213>Corynebacterium glutamicum (Corynebacterium glutamicum)
<400> 2
atgacttcag ctgaacagat cgttgatcca acagcccacg attcgggcaa caaggcaact 60
ga 62
<210> 3
<211> 407
<212> DNA
<213>Corynebacterium glutamicum (Corynebacterium glutamicum)
<400> 3
gtgtgtgaca tttgcgagca attccgcagt gtcggtggcg tatgaccaac agtgcccgaa 60
caatgaagtg aagcacatta ggggaattcc tagggtttgc tcgggggtag gtgttcgcat 120
gatgtaaatt gacaggctgt ttatgtgctt gaagtggggt tatggagaaa tatttatgct 180
tctaaaggtc cctttattgt ttttaaggtt tttgggatgt tgacggattc gatgattcgg 240
gccacagtgt tgttatcgag ttcaaccgat cacaaagatt ttttcgctag gcagtgatcc 300
gactcgcacc ccctacttca cccccaaagt ctctaggagt atgacatgac ttcagctgaa 360
cagatcgttg atccaacagc ccacgattcg ggcaacaagg caactga 407
<210> 4
<211> 6158
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
tagcataacc ccttggggcc tctaaacggg tcttgagggg ttttttgaag cttgtgtgtg 60
acatttgcga gcaattccgc agtgtcggtg gcgtatgacc aacagtgccc gaacaatgaa 120
gtgaagcaca ttaggggaat tcctagggtt tgctcggggg taggtgttcg catgatgtaa 180
attgacaggc tgtttatgtg cttgaagtgg ggttatggag aaatatttat gcttctaaag 240
gtccctttat tgtttttaag gtttttggga tgttgacgga ttcgatgatt cgggccacag 300
tgttgttatc gagttcaacc gatcacaaag attttttcgc taggcagtga tccgactcgc 360
accccctact tcacccccaa agtctctagg agtatgacat gacttcagct gaacagatcg 420
ttgatccaac agcccacgat tcgggcaaca aggcaactga aaaggaggac aactaatgtg 480
agaccaaaaa attttttggt ctcggatccc cgggtaccga gctcgaattc agcttggctg 540
ttttggcgga tgagagaaga ttttcagcct gatacagatt aaatcagaac gcagaagcgg 600
tctgataaaa cagaatttgc ctggcggcag tagcgcggtg gtcccacctg accccatgcc 660
gaactcagaa gtgaaacgcc gtagcgccga tggtagtgtg gggtcacccc atgcgagagt 720
agggaactgc caggcatcaa ataaaacgaa aggctcagtc gaaagactgg gcctttcgtt 780
ttatctgttg tttgtcggtg aacgctctcc tgagtaggac aaatccgccg ggagcggatt 840
tgaacgttgc gaagcaacgg cccggagggt ggcgggcagg acgcccgcca taaactgcca 900
ggcatcaaat taagcagaag gccatcctga cggatggcct ttttgcgttt ctacaaactc 960
ttttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca ataaccctga 1020
taaatgcttc aataatattg aaaaaggaag agtatgagta ttcaacattt ccgtgtcgcc 1080
cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg 1140
aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc 1200
aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact 1260
tttgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca 1320
gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac 1380
atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt 1440
ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg 1500
cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc 1560
tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc 1620
gtggcgcttt ctcaatgctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc 1680
aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac 1740
tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt 1800
aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct 1860
aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa gccagttacc 1920
ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt 1980
ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg 2040
atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc 2100
atgagattat caaaaaggat cttcacctag atccttttgg ggtgggcgaa gaactccagc 2160
atgagatccc cgcgctggag gatcatccag ccattcgggg tcgttcactg gttccccttt 2220
ctgatttctg gcatagaaga acccccgtga actgtgtggt tccgggggtt gctgattttt 2280
gcgagacttc tcgcgcaatt ccctagctta ggtgaaaaca ccatgaaaca ctagggaaac 2340
acccatgaaa cacccattag ggcagtaggg cggcttcttc gtctagggct tgcatttggg 2400
cggtgatctg gtctttagcg tgtgaaagtg tgtcgtaggt ggcgtgctca atgcactcga 2460
acgtcacgtc atttaccggg tcacggtggg caaagagaac tagtgggtta gacattgttt 2520
tcctcgttgt cggtggtggt gagcttttct agccgctcgg taaacgcggc gatcatgaac 2580
tcttggaggt tttcaccgtt ctgcatgcct gcgcgcttca tgtcctcacg tagtgccaaa 2640
ggaacgcgtg cggtgaccac gacgggctta gcctttgcct gcgcttctag tgcttcgatg 2700
gtggcttgtg cctgcgcttg ctgcgcctgt agtgcctgtt gagcttcttg tagttgctgt 2760
tctagctgtg ccttggttgc catgctttaa gactctagta gctttcctgc gatatgtcat 2820
gcgcatgcgt agcaaacatt gtcctgcaac tcattcatta tgtgcagtgc tcctgttact 2880
agtcgtacat actcatattt acctagtctg catgcagtgc atgcacatgc agtcatgtcg 2940
tgctaatgtg taaaacatgt acatgcagat tgctgggggt gcagggggcg gagccaccct 3000
gtccatgcgg ggtgtggggc ttgccccgcc ggtacagaca gtgagcaccg gggcacctag 3060
tcgcggatac cccccctagg tatcggacac gtaaccctcc catgtcgatg caaatcttta 3120
acattgagta cgggtaagct ggcacgcata gccaagctag gcggccacca aacaccacta 3180
aaaattaata gtccctagac aagacaaacc cccgtgcgag ctaccaactc atatgcacgg 3240
gggccacata acccgaaggg gtttcaattg acaaccatag cactagctaa gacaacgggc 3300
acaacacccg cacaaactcg cactgcgcaa ccccgcacaa catcgggtct aggtaacact 3360
gagtaacact gaaatagaag tgaacacctc taaggaaccg caggtcaatg agggttctaa 3420
ggtcactcgc gctagggcgt ggcgtaggca aaacgtcatg tacaagatca ccaatagtaa 3480
ggctctggcg gggtgccata ggtggcgcag ggacgaagct gttgcggtgt cctggtcgtc 3540
taacggtgct tcgcagtttg agggtctgca aaactctcac tctcgctggg ggtcacctct 3600
ggctgaattg gaagtcatgg gcgaacgccg cattgagctg gctattgcta ctaagaatca 3660
cttggcggcg ggtggcgcgc tcatgatgtt tgtgggcact gttcgacaca accgctcaca 3720
gtcatttgcg caggttgaag cgggtattaa gactgcgtac tcttcgatgg tgaaaacatc 3780
tcagtggaag aaagaacgtg cacggtacgg ggtggagcac acctatagtg actatgaggt 3840
cacagactct tgggcgaacg gttggcactt gcaccgcaac atgctgttgt tcttggatcg 3900
tccactgtct gacgatgaac tcaaggcgtt tgaggattcc atgttttccc gctggtctgc 3960
tggtgtggtt aaggccggta tggacgcgcc actgcgtgag cacggggtca aacttgatca 4020
ggtgtctacc tggggtggag acgctgcgaa aatggcaacc tacctcgcta agggcatgtc 4080
tcaggaactg actggctccg ctactaaaac cgcgtctaag gggtcgtaca cgccgtttca 4140
gatgttggat atgttggccg atcaaagcga cgccggcgag gatatggacg ctgttttggt 4200
ggctcggtgg cgtgagtatg aggttggttc taaaaacctg cgttcgtcct ggtcacgtgg 4260
ggctaagcgt gctttgggca ttgattacat agacgctgat gtacgtcgtg aaatggaaga 4320
agaactgtac aagctcgccg gtctggaagc accggaacgg gtcgaatcaa cccgcgttgc 4380
tgttgctttg gtgaagcccg atgattggaa actgattcag tctgatttcg cggttaggca 4440
gtacgttctc gattgcgtgg ataaggctaa ggacgtggcc gctgcgcaac gtgtcgctaa 4500
tgaggtgctg gcaagtctgg gtgtggattc caccccgtgc atgatcgtta tggatgatgt 4560
ggacttggac gcggttctgc ctactcatgg ggacgctact aagcgtgatc tgaatgcggc 4620
ggtgttcgcg ggtaatgagc agactattct tcgcacccac taaaagcggc ataaaccccg 4680
ttcgatattt tgtgcgatga atttatggtc aatgtcgcgg gggcaaacta tgatgggtct 4740
tgttgttggc gtcccggaaa acgattccga agcccaacct ttcatagaag gcggcggtgg 4800
aatcgaaatc tcgtgatggc aggttgggcg tcgcttggtc ggtcatttcg aagggcacca 4860
ataactgcct taaaaaaatt acgccccgcc ctgccactca tcgcagtact gttgtaattc 4920
attaagcatt ctgccgacat ggaagccatc acagacggca tgatgaacct gaatcgccag 4980
cggcatcagc accttgtcgc cttgcgtata atatttgccc atggtgaaaa cgggggcgaa 5040
gaagttgtcc atattggcca cgtttaaatc aaaactggtg aaactcaccc agggattggc 5100
tgagacgaaa aacatattct caataaaccc tttagggaaa taggccaggt tttcaccgta 5160
acacgccaca tcttgcgaat atatgtgtag aaactgccgg aaatcgtcgt ggtattcact 5220
ccagagcgat gaaaacgttt cagtttgctc atggaaaacg gtgtaacaag ggtgaacact 5280
atcccatatc accagctcac cgtctttcat tgccatacgg aactccggat gagcattcat 5340
caggcgggca agaatgtgaa taaaggccgg ataaaacttg tgcttatttt tctttacggt 5400
ctttaaaaag gccgtaatat ccagctgaac ggtctggtta taggtacatt gagcaactga 5460
ctgaaatgcc tcaaaatgtt ctttacgatg ccattgggat atatcaacgg tggtatatcc 5520
agtgattttt ttctccattt tagcttcctt agctcctgaa aatctcgtcg aagctcggcg 5580
gatttgtcct actcaagctg atccgacaaa atccacacat tatcccaggt gtccggatcg 5640
gtcaaatacg ctgccagctc atagaccgta tccaaagcat ccggggctga tccccggcgc 5700
cagggtggtt tttcttttca ccagtgagac gggcaacagc tgattgccct tcaccgcctg 5760
gccctgagag agttgcagca agcggtccac gtggtttgcc ccagcaggcg aaaatcctgt 5820
ttgatggtgg ttaacggcgg gatataacat gagctgtctt cggtatcgtc gtatcccact 5880
accgagatat cctatcatgc cataccgcga aaggttttgc accattcgat ggtgtcaacg 5940
taaatgccgc ttcgccttcg cgcgcgaatt gcaagctgat ccgggcttat cgactgcacg 6000
gtgcaccaat gcttctggcg tcaggcagcc atcggaagct gtggtatggc tgtgcaggtc 6060
gtaaatcact gcataattcg tgtcgctcaa ggcgcactcc cgttctggat aatgtttttt 6120
gcgccgacat cataacggtt ctggcaaata ttctgaaa 6158
<210> 5
<211> 720
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60
ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120
ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240
cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300
ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420
aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480
ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660
ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720
<210> 6
<211> 1358
<212> DNA
<213>Corynebacterium glutamicum (Corynebacterium glutamicum)
<400> 6
acgattccct catcagggcg gtcctcaagc gcatggtcca gagttttctg aacgctttcc 60
aaatttgaaa ctggtgtgga catgtgaacc tccaagagag tgaaaagaag ttggttttgc 120
caccgcgatg tcgttttcgt ttttgctttg aagcggtgtg tgacatttgc gagcaattcc 180
gcagtgtcgg tggcgtatga ccaacagtgc ccgaacaatg aagtgaagca cattagggga 240
attcctaggg tttgctcggg ggtaggtgtt cgcatgatgt aaattgacag gctgtttatg 300
tgcttgaagt ggggttatgg agaaatattt atgcttctaa aggtcccttt attgttttta 360
aggtttttgg gatgttgacg gattcgatga ttcgggccac agtgttgtta tcgagttcaa 420
ccgatcacaa agattttttc gctaggcagt gatccgactc gcacccccta cttcaccccc 480
aaagtctcta ggagtatgac atgacttcag ctgaacagat cgttgatcca acagcccacg 540
attcgggcaa caaggcaact gacaagttca aggcaaaccg cgttgcctcc gatacctcca 600
aggaacgcgc aaacgcgatc tacgtagatc tgctcgcggc gatcgcccag gttgctcaca 660
agcatgaagt cacctacgaa gagtacgcag tgctcaagca gtggatgatc gacgttggag 720
aatacggcga gtgggccact gtggttggac gtttcgttga gcacgagatc gaagagatca 780
actacaaccg ccacgactac accggaacca agggttccat cgaaggccct tattacgtag 840
agaactctcc taagcttcct tgggatgctg agatgccaat gcgtgacaag gatcgcgcat 900
gcacccctct gatcttcgaa ggtcaggtta ctgacctcga cggcaacggt cttgatggag 960
cagaagttga gctctggcac gcagatgagg acggattcta ctcccagttc gcacctggaa 1020
tcccagagtg gaacctgcgt ggcaccatcg ttaccgatga ggaaggccgc tacaagatca 1080
agaccctgca gcctgcgcct taccagatcc ctcatgatgg cccaaccggt tggttcattg 1140
agtcttacgg tgggcaccca tggcgcccag cccacctcca cttgcgcgtt tcccacccgg 1200
gctaccgcac catcaccacc cagctttact tcgagggtgg cgagtgggtc gaaaacgacg 1260
ttgcaaccgc tgtgaagcca gaactggtcc tgcgccctga gactggcgag gatggtaacc 1320
acgttcacta cccattcgtc ctggataagg aagactag 1358
Claims (10)
1. operon, it is characterised in that: the operon sequence includes at least, and 3 ' ends are located at Corynebacterium glutamicum SEQ ID NO:
Any base, 5 ' ends are located at Corynebacterium glutamicum SEQ ID NO:6 gene in 6 gene coded sequence ATG 201~257bp of upstream
Any base in coded sequence ATG upstream 308bp~345bp.
2. carrier, it is characterised in that: the carrier load operon described in claim 1.
3. carrier as claimed in claim 2, it is characterised in that: the carrier includes protein expression vector p19-0-ZDA.
4. application of any operon in protein expression in claims 1 to 3.
5. application of the operon as claimed in claim 4 in protein expression, it is characterised in that: the operon is used for paddy ammonia
Sour bar bacterium is endogenous or the expression of foreign protein.
6. application of the operon as claimed in claim 5 in protein expression, it is characterised in that: the foreign protein includes people
Gastric anti-pernicious anemia factor Protein G IF, HIS-SUMO-N akrencephalon pro-BNP.
7. such as application of the operon described in claim 5 or 6 in protein expression, it is characterised in that: the operon has
Induced activity.
8. such as application of the operon described in claim 5 or 6 in protein expression, it is characterised in that: the operon can
By any one or several inductions including benzyl alcohol, benzaldehyde, benzoic acid, catechol.
9. such as application of the operon described in claim 5 or 6 in protein expression, it is characterised in that: the benzyl alcohol lures
Leading concentration range is 1mM~50mM.
10. such as application of the operon described in claim 5 or 6 in protein expression, it is characterised in that: the benzyl alcohol lures
Leading concentration is 10mM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810990251.7A CN109097362B (en) | 2018-08-28 | 2018-08-28 | Operon, vector thereof and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810990251.7A CN109097362B (en) | 2018-08-28 | 2018-08-28 | Operon, vector thereof and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109097362A true CN109097362A (en) | 2018-12-28 |
| CN109097362B CN109097362B (en) | 2022-05-20 |
Family
ID=64864057
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810990251.7A Active CN109097362B (en) | 2018-08-28 | 2018-08-28 | Operon, vector thereof and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109097362B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109913490A (en) * | 2019-03-13 | 2019-06-21 | 江南大学 | A kind of enhanced expression vector suitable for Corynebacterium glutamicum |
| CN112877352A (en) * | 2021-02-08 | 2021-06-01 | 华南理工大学 | Cumate induction system suitable for corynebacterium glutamicum, plasmid vector constructed by induction system and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164369A (en) * | 2017-03-21 | 2017-09-15 | 武汉远大弘元股份有限公司 | A kind of corynebacteria constitutive expression carrier promoter, the expression vector containing the promoter and lrp genes |
-
2018
- 2018-08-28 CN CN201810990251.7A patent/CN109097362B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164369A (en) * | 2017-03-21 | 2017-09-15 | 武汉远大弘元股份有限公司 | A kind of corynebacteria constitutive expression carrier promoter, the expression vector containing the promoter and lrp genes |
Non-Patent Citations (3)
| Title |
|---|
| LIU ET AL.: "Identification, repair and characterization of a benzyl alcohol-inducible promoter for recombinant proteins overexpression in Corynebacterium glutamicum", 《ENZYME ANDMICROBIALTECHNOLOGY》 * |
| WEI ZHANG ET AL.: "Construction of an expression vector that uses the aph promoter for protein expression in Corynebacterium glutamicum", 《PLASMID》 * |
| 范荣等: "谷氨酸棒状杆菌新型诱导启动子的研究", 《海南师范大学学报（自然科学版）》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109913490A (en) * | 2019-03-13 | 2019-06-21 | 江南大学 | A kind of enhanced expression vector suitable for Corynebacterium glutamicum |
| CN109913490B (en) * | 2019-03-13 | 2023-04-07 | 江南大学 | Enhanced expression vector suitable for corynebacterium glutamicum |
| CN112877352A (en) * | 2021-02-08 | 2021-06-01 | 华南理工大学 | Cumate induction system suitable for corynebacterium glutamicum, plasmid vector constructed by induction system and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109097362B (en) | 2022-05-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2806678T3 (en) | Nucleic acid comprising or encoding a histone stem-loop and a poly (A) sequence or a polyadenylation signal to increase the expression of an encoded therapeutic protein | |
| CN109097362A (en) | Operon, its carrier and its application | |
| CN109097361B (en) | Promoter, vector thereof and application thereof | |
| CA2336541C (en) | Modulation of polypeptide display on modified filamentous phage | |
| CN112111469A (en) | Gamma-glutamyl kinase mutant and application thereof | |
| CN110079551B (en) | Circular RNA expression vector and construction method and application thereof | |
| KR101692103B1 (en) | Synthetic phytase variants | |
| CN114230677B (en) | Recombinant protein containing Cap of hog cholera E2 and circovirus, preparation method and application thereof | |
| CA2308003A1 (en) | Expression control sequences | |
| CN108676809A (en) | A kind of Corynebacterium glutamicum gene group edit methods | |
| ES2275335T3 (en) | HIGHLY EFFICIENT CONTROLLED EXPRESSION OF EXOGEN GENES IN E.COLI. | |
| CN109694841A (en) | A kind of corynebacterium glutamicum recombinant bacterium, preparation method and application | |
| CN102154268A (en) | Streptomyces minitype transposable mutation system as well as construction method and application thereof | |
| CN102021197A (en) | Plant bivalent expression vector and construction method thereof | |
| CN114438115A (en) | CRISPR/Cas9 gene editing vector, construction method and application thereof | |
| Luke et al. | Development of antibiotic-free selection system for safer DNA vaccination | |
| CN113943748B (en) | Recombination system in pseudomonas syringae and application | |
| KR20220050073A (en) | Composition for delivering genes to the brain tissue and uses thereof | |
| CN102352371B (en) | PC series plasmid as well as construction method and application thereof | |
| CN112266925A (en) | Subcellular localization expression vector and construction method | |
| CN114763372A (en) | Protein with L-proline efflux function and application thereof | |
| CN110872596B (en) | Construction method of saccharomyces cerevisiae for co-utilizing xylose and arabinose | |
| CN101313064A (en) | Method for gene amplification | |
| CN114391038A (en) | Filamentous fungal expression systems | |
| CA2621608A1 (en) | Methods of optimizing the secretion of protein in prokaryotes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |