CN1090971C

CN1090971C - Uropoly acid-peptide composition

Info

Publication number: CN1090971C
Application number: CN99122051A
Authority: CN
Inventors: 张铭烈
Original assignee: YONGSHENG PHARMACEUTICAL CO Ltd HEFEI
Current assignee: Thai biological pharmaceutical Jiangsu Co., Ltd.
Priority date: 1999-10-26
Filing date: 1999-10-26
Publication date: 2002-09-18
Anticipated expiration: 2019-10-26
Also published as: CN1294001A

Abstract

The present invention discloses a urinary polyacid peptide composition which is a cancer resisting substance prepared by scientifically refining fresh human urine. The present invention mainly contains four kinds of organic acid of hippuric acid, phenylacetylglutamine, phenylacetic acid and indoleacetic acid, a series of heterogeneity small molecule peptide and inorganic salt, wherein the total content of the four kinds of organic acid is from 9.81 to 23.58 mg/ml, the total content of the peptide is approximately from 20.7 to 26.7%, the total content of inorganic elements is from 3077.24 to 8152.01 mug/ml, and the molecular weight is less than ten thousand. The preparation has the synergistic effects of tumor differentiation induction, tumor differentiation aid and excessive excretion resistance, and has low toxicity. The present invention can be clinically used for treating various kinds of late therioma.

Description

Uropoly acid-peptide composition

The present invention relates to the preparation method of a kind of Uropoly acid-peptide composition, Uropoly acid-peptide composition and Uropoly acid-peptide composition in treatment and prevent purposes aspect the cancer return, belong to drug world.

Malignant tumor is the commonly encountered diseases of serious harm human health, and its M ﹠ M is all very high.Can be described as one of present human dead main killer, especially the late malignant tumour patient has generally lost chances such as operation, chemotherapy, radiotherapy.Four traditional big therapies cut both ways, but often be difficult to tackle the problem at its root, thereby, cure or partly cure malignant tumor, reduce patient's misery, prolong life cycle, the quality of making the life better, be a very thorny difficult problem clinically, so capturing and treating of cancer illness is the problem that various countries' medical circle is all very paid close attention to.

Clinically after operation, chemotherapy, radiotherapy, immunotherapy, there is the people to propose the Therapeutic Method of a kind of inducing malignant tumor cell again at present, is commonly referred to as the cell differentiation therapy to the normal cell differentiation.Its dominant mechanism is: human malignant lesion's cellular abnormality Methyl transporters compound enzyme is active to raise, be possible cause one of continuous splitted major reason of tumor cell, in essence, the unusual differentiation of blocking cancerous cell of Methyl transporters compound enzyme, thereby cancerous cell is constantly divided, if can suppress the activity of this enzyme effectively and could move towards normal differentiation by inducing tumor cell.

Since unusual Methyl transporters compound enzyme is the key problem of cancer, to eliminate so after these unusual enzymes, cancerous cell should resemble to be induced the normal cell and break up and become no longer splitted terminal cell.Our experiment shows that the rRNA transmethylase of cancerous cell is responsive especially to the oligonucleotide of similar few adenylic acid, but normal enzyme has no reaction to the inhibitor of this class, this is because normal and unusual Methyl transporters compound enzyme has very significant difference, we can utilize this species diversity to seek cancer therapy drug selectively, and this medicine is commonly called differentiating inducer.Few adenylic acid is a very ideal differentiating inducer, in fact the differentiating inducer such as the interferon of extensive use at present, retinoic acid, vitamin D3, hexamethylene bisacetamide (HMBA), dimethyl sulfoxide (DMSO) and phorbol ester (phorbol ester) mostly are by inducing few adenylic acid to facilitate the differentiation of end eventually of cancerous cell; Because cancerous cell must have the purpose that the receptor of a lot of these differentiating inducers just can reach differentiation, the cancerous cell scope that this class differentiating inducer can have influence on is very little.What have a lot of receptors nearly all is some special cases, as hair cell leukemia cell a lot of interferon receptors are arranged, acute promyelocytic leukemia cell has a lot of retinoic acid and vit D3 receptor, hexamethylene bisacetamide can the generation effect be erythroleukemia cell or the like, but few adenylic acid itself can not be as medicine because special being not easy of structure absorbed by cell.

Discover the chemical compound that contains similar few ribosidoadenine acid function in the urine, unusual Methyl transporters compound enzyme can be changed and become normal enzyme, this preparation is not because there is the restriction of receptor, so can both induce differentiation to multiple cancerous cell, and promote that cancerous cell moves towards normal differentiation or makes cancer cell-apoptosis, it has been generally acknowledged that the coloured peptide in the urine extract is differentiating inducer (US4470970).

Liau, M.C. be at J.Exptl.Clin.Chemother.5:9-17, discloses butanoic acid and benzoic acid in 1992 and can be used as differentiation and help agent, separately or shared with differentiating inducer, is used for treatment for cancer; Disclose among the US5783605 with synthetic N-alkylbenzene acetamide, benzoates and heteroauxing and helped agent, be used for the treatment of cancer as differentiation.

Disclose among the US4470970 a kind ofly can from urine, extract, also can synthetic new type anticancer medicine---antineoplaston A10, its structure is a 3-phenylacetylamino-2,6-piperidines diketone, the effect with anti-multiple cancer; It has been generally acknowledged that antineoplaston A10 has the human body of inhibition and too much drains the vivo antitumor material---the effect of low-molecular-weight metabolite; Experimental results show that the antineoplaston A10 injection is its open-loop products, exist, see Hendry L.B. " DrugsExptl Clin.Res, 1987, Suppl.1:71 " with the form of phenylacetylglutamine and phenylacetyl isoglutamine sodium salt.

The medical usage of the extract of in fact urinating and urinating has been familiar with existing several centuries by domestic and international people, twoth century Greek Xenokrates (sees Turner with urine treatment cancer after Christian era, F.C.Effects of extracts of human urine on tumorsin mice.U.S.Public Health Service, 1855,1939); Floydc.Tumer finds that in nineteen thirty-nine the amicine mass-energy that produces prevents the formation (Fleming, R.F., Peczenik.O.AlkalinePhosphatase and tumor inhibition.Nature.162,338,1948) of mouse tumor from urine; Britain and Germany are that the polypeptide research of H-11 (is seen Fleming to the unknown structure name that extracts in the Urina Hominis, R., Walters, C.L., Williams, J.L.The effect of adrenal andurinary extracts on malignant tissue.Acta.Un.Inter.Can., 7,456,1951.Walters, C.L.A competitivealkaline phosphatase inhibitor from extracts of normal male urine.Enzymologia, 20,33,1958.VonKlose.G.Chemotherapie in der Nachbehandlung von GeschwulstkrankheitenSchleswing-Holstenisches Artztenblatt, 442,1962.), 16 routine inoperable patients with lung cancer are arranged in early days by this extract for treating of injection in the clinical research, observe most patients and alleviate, prolong life and do not have significant side effects; Nineteen sixty-eight Klose and Below are illustrated in more in the long periods of treatment scheme with these extract for treating 49 routine inoperable patients with lung cancer, obtain good result and (see Klose, G.Below R.verlaufsbeobachtungen bei Kranken mit inoperablen Lungentumoren beiBehandlung mitkonbinierter interner Terapie (alkylierend Substanz und korpereigenes Polypeptid) .Krebsarzt, 24,1,1969); Burzynski (Von Burzynski S.R., Stolzmann, Z., Szopa, B.et al.Antineplaston A in cancer therapy (I) physiol.Chem.Phys., 9,485,1977) the anticarcinogen antineoplaston A10 that extracts with Urina Hominis is cured 21 of patients with advanced cancer, and quiet administration has remarkable antitumor effect and do not have any toxicity, and be the second stage of at present clinical, report according to U.S. NCI, as pressing the clinical protocol that FDA stipulates, three phase clinical treatment non-Hodgkins lymphoma patients of this medicine may obtain antineoplastic Expected Results (the double too youth of the wild gold of assistant, elimination cancer, the luxuriant publishing house of generation, the Taibei, Taiwan, 1997:226), Shandong Medical University's journal 1998, what disclose antineoplaston A10 among the 26:4 preliminary presses down the tumor experiment, when dosage is 1500mg/kg, is 28% to the suppression ratio of S180.

This shows, the extract of urine is the medicine of the up-and-coming treatment cancer of a class, but prior art just discloses a certain component or some component and the effect thereof of urine extract, during effective ingredient in extracting urine, usually because the difference of adsorbent, leacheate and flow velocity difference, product that obtains and yield difference, the technology that adopts during post processing is different with method, also directly influence the composition of product, character, productive rate and therapeutic effect, in prior art, general productive rate is lower, and be directly used in pharmaceutical preparation with no longer handling behind the extract thickening filtration, owing to may contain various viruses in the urine extract, directly use, there is unpredictalbe potential danger in human body; And also there is not detailed report for the research of extraction, composition and the structure of compositions and in the effect aspect the treatment cancer in the prior art.

The objective of the invention is to remedy the deficiencies in the prior art, effective component extracting from Urina Hominis provides the pharmaceutical composition----Uropoly acid-peptide composition of a kind of treatment and prophylaxis of cancer.

Another object of the present invention is to determine the composition of Uropoly acid-peptide composition.

Another object of the present invention is to determine the content of each main component of Uropoly acid-peptide composition.

Another object of the present invention is to disclose a kind of pharmaceutical composition---Uropoly acid-peptide composition and intermediates preparation for preparing treatment and prophylaxis of cancer.

A further object of the present invention is the purposes of open Uropoly acid-peptide composition aspect the medicine that manufacturing is used for the treatment of and prophylaxis of cancer recurs.

In order to finish above-mentioned task, the technical solution used in the present invention is as follows:

1. preparation Uropoly acid-peptide composition

With fresh uric acidization, make PH smaller or equal to 3, to guarantee that it is stable and to be easy to extract; Remove by filter diameter in the acidify urine greater than 20 microns bulky grain; The bigger organic substance of molecular weight in the acidify urine is removed in ultrafiltration, behind the soak with ethanol adsorbent, wash adsorbent respectively with pure and mild deionized water, the dress adsorption column, add in the adsorption column with the acidify urine of certain flow velocity after ultrafiltration, with the effective ingredient in the adsorbents adsorb filtrate: in the acidify urine a large amount of inorganic ions and Organic substance are arranged, what be not adsorbed after entering adsorbent lodges in the post, be not adsorbed with soft water washing but remain in inorganic matter and hydrophilic organics hydrophilicity in the adsorbent, the purification effective ingredient; Be adsorbed on effective ingredient on the silicagel column with pure eluting; Collect coloured effluent, after concentrating, adjust PH to neutral with alkali, control PH is 6.0-8.5, and stand at low temperature is separated out the crystalline polymer that forms in the concentration process, removes after filtration and decrystallizes and colloidal impurity, obtains the Uropoly acid-peptide composition intermediate.

Above-mentioned intermediate can obtain exsiccant Uropoly acid-peptide composition through lyophilization, and this crude drug can be made oral capsule, or through dilution, remove purification such as virus and packing is made oral liquid or injection.

With distilled water 20L dissolving dried residue, promptly get the Uropoly acid-peptide crude product solution; Crude product is placed in the low temperature storehouse; Get the crude product upper strata liquid that leaves standstill after the processing, in 100000 grades of toilets, use the micropore filter paper filtering, collect filtrate, promptly get Uropoly acid-peptide solution; With the ultrafilter membrane ultrafiltration of 10,000 molecular weight, to remove thermal source, again through the Ultipor VF of PALL company ^TMDV50 removes virus filter and crosses filtering virus, and intracellular toxin detects to qualified, and whole preparation process is seen accompanying drawing 1.

The above-mentioned raw materials uric acidization can be used hydrochloric acid, sulphuric acid and be fit to other acid of the present invention.

During the raw material uric acid, the PH of control acidify urine is smaller or equal to 3, preferably smaller or equal to 2, and more preferably 1.0-1.8; The pressure of acidify urine ultrafiltration is 1-5Mpa.

Ultrafiltration is removed molecular weight in the acidify urine greater than 10000 or greater than 9000 organic substance.

With respect to 20 kilograms of raw material urine, the consumption of adsorbent is the 5-20 kilogram; Above-mentioned adsorbent can be selected C18 post, XAD-7, XAD-8 or XAD-16 for use and be fit to other adsorbents of the present invention, preferred C18 post and XAD-7, most preferably XAD-7; The consumption that soaks the alcohol of adsorbent is the 15-25 liter; Soak time is 5～20 minutes; The consumption of the pure and mild deionized water of washing adsorbent is 15～25 liters; The flow velocity that acidify urine adds detached dowel is 0.1-2L/min; The consumption of cleaning mixture distilled water is 5～20L, and elution speed is 0.1～3L/min, and the consumption of eluent alcohol is 5～20L, and elution speed is 0.1～3L/min; Above-mentioned eluting can use ethanol, methanol, propanol and be fit to other alcohols of the present invention, particular methanol; Above-mentioned desolventizing can be used distilling under reduced pressure, membrane technology and be fit to other method of the present invention; During distilling under reduced pressure, material temperature is controlled at 30-80 ℃;

When adjusting pH value, can use sodium hydroxide, sodium carbonate, sodium bicarbonate and be fit to other alkali of the present invention, preferred sodium hydroxide; The pH value of concentrated solution is adjusted into 6.0-8.5, preferred PH7.0-8.0, most preferably PH7.2-7.8; Adjust PH to neutral process with alkali, can be before effluent concentrate after drying, also can be behind the dry redilution of concentrated solution.

Above-mentionedly in the low temperature storehouse, place; Get the crude product upper strata liquid that leaves standstill after the processing, in 100000 grades of toilets, use the micropore filter paper filtering, collect filtrate, promptly get Uropoly acid-peptide solution; With the ultrafilter membrane ultrafiltration of 10,000 molecular weight, to remove thermal source, again through the UltiporVF of PALL company ^TMDV50 removes the process that virus filter is crossed filtering virus, can be before effluent concentrate after drying, and also can be to carry out behind the dry redilution of concentrated solution.Above-mentioned temperature in the low temperature storehouse is controlled at 0-10 ℃; Be 80-160 hour standing time.

Above-mentioned drying can be used lyophilization, also can use decompression or constant pressure and dry, and is preferably freezing.

The yield of whole process is the 0.2-4.0% of raw material urine.Can be directly used in the medicine of the various dosage forms of preparation through the Uropoly acid-peptide composition of method for preparing.

2. the separation of Uropoly acid-peptide composition and evaluation

The Uropoly acid-peptide dry product is diluted, with high performance liquid chromatography the Uropoly acid-peptide composition that adopts method for preparing is separated, and measure its composition, the pharmaceutical composition that discovery is extracted from the healthy human urine contains four kinds of organic acid, be respectively hippuric acid, phenylacetylglutamine, phenylacetic acid and heteroauxing, and a series of heterogeneity small-molecular peptides, more inorganic salt also contained, according to its composition, we are referred to as Uropoly acid-peptide composition.Mainly comprise:

1. detect the change constant of the Uropoly acid-peptide composition of the inventive method preparation according to conventional method, comprise outward appearance, particulate matter content, pH value, total weight of solids, residue on ignition, nitrogen content etc.;

2. confirm organic acid contained in the pharmaceutical composition of the present invention;

3. measure organic acid content: with hippuric acid, the pure product of phenylacetylglutamine, phenylacetic acid, heteroauxing are with reference to standard specimen, and each organic acid has been carried out quantitative analysis, and four kinds of organic acid content are respectively: hippuric acid 4.17-7.94mg/ml; Phenylacetylglutamine 4.87-10.86mg/ml; Phenylacetic acid 0.66-4.5mg/ml; Heteroauxing 0.11-0.28mg/ml; Four kinds of organic acid total contents are 9.81～23.58mg in the Uropoly acid-peptide composition, and percentage composition is 26.34-57-65%.

4. measure peptide content: adopt HPLC, the single-minded analytical column PICOTAG of Waters company ^TMThe hydrolysis total amino acids of measuring pharmaceutical composition respectively is 8.5-11.4mg/ml, free amino acid is 0.7-1.3mg/ml, thereby the content that calculates peptide ammino acid is 7.8-10.9mg/ml (difference of hydrolysis total amino acids total amount and free aminoacid content), total peptide content is 20.7-26.7%, knows that the amino acid whose content of small-molecular peptides is about 7.7-10.9mg/m; It is 90.6-95.6% that peptide ammino acid accounts for hydrolysis total amino acids amount.

5. determining molecular weight: measure the molecular weight distribution of Uropoly acid-peptide composition liquid of the present invention with the HPSEC method, adopt U.S.'s Sigma company polypeptide and small molecular protein molecular weight standard product; The molecular weight of knowing three main peaks is respectively 7000-9200,4000-5800,1000-2100; The molecular weight of Uropoly acid-peptide solution example is 9200 to the maximum, and the molecular weight of contained polypeptide is all less than 10000 dalton, and the molecular weight of determining its contained polypeptide is less than 10,000; This shows that peptide exists with the form of small-molecular peptides substantially in this product.

6. measure the composition of peptide in the Uropoly acid-peptide composition, through using the HPLC exclusion chromatography, gel column Protein 60 separates and detects the peptide components of Uropoly acid-peptide composition of the present invention, obtains a series of peptide peak (seeing accompanying drawing 28-30), and quantity is 12-15.Two fairly obvious main peaks are wherein arranged, and the retention time of one of characteristic peak is 6.805-7.493, and three batches of relative percentage compositions are respectively 15.89%, 16.16%, 16.27%, 16.56%, 17.56%, i.e. 15.89-17.56%; And the average of another characteristic peak retention time is 7.722-8.824, and three batches of relative percentage compositions are respectively 18.68%, 19.27%, 19.61%, 19.19%, 19.98%, i.e. 18.68-19.98%;

7. measure the content of inorganic elements: the content that adopts the atomic absorption spectroscopy determination inorganic elements, know and contain Ca in the Uropoly acid-peptide, Mg, Fe, Zn, Mn, Cu, Cr, Co, Na, inorganic ionss such as K, each ionic content is: Ca 10--18 μ g/ml, Mg 7--11 μ g/ml, Fe 0.1-1.2 μ g/ml, Zn 0.05-1.5 μ g/ml, Mn 0.02-0.10 μ g/ml, Cu≤0.05 μ g/ml, Cr 0.01-0.08 μ g/ml, Co≤0.1 μ g/ml, Na 3000--8000 μ g/ml, K60--120 μ g/ml, the total content of inorganic elements are 3077.24-8152.01 μ g/ml.

8. nitrogen content: press the check of Chinese Pharmacopoeia nineteen ninety-five version appendix VII D meso method, record nitrogen content and be not less than 2.0mg/ml.

9. the residue on ignition of Uropoly acid-peptide composition is less than 2.0% (w/v).

In addition, the urorhodin and the vitamin B2 that also contain trace in the Uropoly acid-peptide composition.

3. the pharmacology of Uropoly acid-peptide composition and toxicity

Be used in body and isolated test method, to multiple tumor strain cell or the pathological model due to them, carried out multi-faceted experimental study, the result is as follows:

Test at body: when the body test shows pharmaceutical composition solution dosage of the present invention at 100-1000mg/kg, to nude mice or through the tumor of the animal model of immunosuppressant Kunming mouse inoculation human tumor cells obvious inhibition growth effect is arranged, tumour inhibiting rate is all more than 30%, wherein to through the immunosuppressant Kunming mouse, the scrotum film acute promyelocytic leukemic HL-60 cell of inoculation down has significant growth inhibited effect, dosage is when 640mg/kg, suppression ratio reaches more than 64%, and present obvious differentiating phenomenon on the HL-60 cellular morphology, occur a large amount of middle late children's grains and mature cell in the cancerous tissue.During 600mg/kg, the high metastatic human hepatoma LCI-D20 nude mice model to the nude mice Glisson's capsule is inoculated down has certain inhibition tumor growth effect, tumour inhibiting rate about 43%; And the abdominal cavity that can significantly reduce transplanted hepatoma shifts, and is more remarkable with high dose (1800mg/kg) especially.Molecular biology research shows: Uropoly acid-peptide composition solution of the present invention (1200-1800mg/kg) is to proto-oncogene c-myc relevant with proliferation and differentiation in the above-mentioned LCI-D20 liver cancer tissue, N-ras, the expression of c-jun and c-fos has very significantly downward modulation effect (P＜0.01); And the mRNA that can reduce the index MMP9 gene of reflection tumor invasion and transfer ability effectively transcribes (P＜0.05).Tumor has the change of adhesion molecule expression in growth and transfer process, integrating plain β 1 subunit is the important special-shaped adhesion molecule of a class, adhesion between the mediation heterogenous cell, participate in the information conduction of cell, Uropoly acid-peptide composition solution of the present invention (1200-1800mg/kg) can make the amount decline (P＜0.05) of integrating plain β 1 subunit; The E-cadherins is the homotype adhesion molecule, participate in the adhesion between allogenic cell, the E-cadherins of former kitchen range is expressed and can obviously be reduced during neoplasm metastasis, and after the Uropoly acid-peptide composition solution 1800mg/kg treatment of the present invention, can increase E-cadherins content (P＜0.05) in the tissue, and above-mentioned effect all there is synergism with 5-FU.When Uropoly acid-peptide composition solution dosage of the present invention was 100-400mg/kg, (Smmu7721) had certain inhibitory action to the nude inoculation human hepatoma cell strain, and tumour inhibiting rate is 51.8-83.5%.Dosage can suppress the growth of mice (forearm subcutaneous vaccination HCP hepatoma carcinoma cell) liver-cancer solid tumor during for 1000mg/kg, and suppression ratio reaches 34%.After the nude mice Glisson's capsule is inoculated high secondary liver cancer LCI-D20 tumor piece, the early hepatocarcinoma group was in 16 days excision hepatocarcinoma, the advanced liver cancer group was in 22 days excision hepatocarcinoma, subcutaneous injection Uropoly acid-peptide composition solution of the present invention 960mg/kg, early, liver incisxal edge place, advanced liver cancer excision back local recurrence diameter of tumor is all very less than matched group (P＜0.01), in the liver and involve internal organs metastasis number and also obviously reduce (P＜0.05), show that to the high metastasis model of LCI-D20 nude mice hepatocarcinoma transfer and recurrence after the early stage and advanced liver cancer excision have certain preventive and therapeutic effect.

Isolated test: Uropoly acid-peptide composition solution of the present invention has growth inhibited, differentiation-inducing action to the cancerous cell of In vitro culture.Wherein people's acute promyelocytic leukemic HL-60 cell is done growth curve and morphocytology research, finding has the growth inhibited effect, and drug effect was dose-effect relationship after 6 days, IC ₅₀Be 0..18mg/ml; Dosage time effect after 7 days for 1.2mg/ml, NBT cell reduction positive percentage increases, cell greater than 50% by children's grain early to middle and advanced stage children's grain direction differentiation (and not medication group differentiation rate＜3%), be that nucleus dwindles, secundly, the caryoplasm ratio reduces, and kidney type nuclear occurs, the showed cell ripe direction differentiation of towards evening children grain.Concentration is to suppress the wellability of MHCC97 high-transfer human liver cancer cell strain more than the 5mg/mL; Can suppress MHCC97 more than the 15mg/mL to the proteic in succession adhesive capacity of fiber, and this adhesion is the initiating step of cancerous cell invasion and attack.When concentration is 1mg/mL, the growth of people's marrow blood cancerous cell (HL-60) can be obviously suppressed, and the activity of telomerase in this cell can be suppressed.Show all that below Uropoly acid-peptide composition solution of the present invention may be a kind of cell differential agent.Smmu7721 has inhibitory action to human liver cancer cell, its IC ₅₀And the 95% credible 0.78mg/mL (0.72-0.83mg/mL) that is limited to.Growth to human lung carcinoma cell AGZY-83A has inhibitory action, is dose-effect relationship, and suppression ratio about about 30% when concentration was 2.5mg/mL.

Above-mentioned experimental result is compared with the data that documents provides, and active anticancer obviously improves.

Concrete experiment content is as follows

1. Uropoly acid-peptide composition exsomatizes to people's acute promyelocytic leukemia cell (HL-60) and suppresses and induction of differentiation at bulk-growth

Expect that with platform blue row dyes the growth inhibited effect of method observation Uropoly acid-peptide composition injection to the HL-60 cell of In vitro culture, and seek the concentration of its inducing cell differentiation, with the injection Uropoly acid-peptide composition injection effect HL-60 cell of bifurcated concentration after 7 days, reuse Giemsa dyeing microscopic examination.Find,＞50% HL-60 cell by children's grain early to children's grain direction differentiation in late period, the NBT reduction reaction positive rate showed increased of cell.The degree and the drug dose of differentiation have certain dependency.

Carry out in vivo test with inocalation method under the scrotum film, with the HL-60 cell inoculation of In vitro culture under immunosuppressant Kunming mouse scrotum film, lumbar injection Uropoly acid-peptide composition injection.Result of the test shows that the Uropoly acid-peptide composition injection has significant growth inhibited effect to the HL-60 cell that is inoculated under the mice scrotum film, and dosage is when 640mg/kg, and suppression ratio reaches more than 64%.

2. anti-people's primary hepatocyte hepatocarcinoma growth of Uropoly acid-peptide composition of the present invention and the effect of shifting.

Method with nude mice inoculates down with tumor piece Glisson's capsule prepares high metastatic human hepatoma nude mice model LCI-D20.Inoculate back 10 days and be divided into 4 groups at random, (matched group; The basic, normal, high dosage group of Uropoly acid-peptide composition).The 11st day intraperitoneal injection, successive administration was put to death after 20 days, peeled off tumor and weighed, and calculated tumour inhibiting rate, and observed the abdominal cavity transfer case.

Use the RT-PCR method, the oncogene c-myc that sxemiquantitative research is relevant with hepatocarcinoma, N-ras, the gene expression of c-fos and c-jun and with the gene expression of attacking relevant matrix metalloproteinase MMP-9.Use Western trace and spot immune blotting, detect the expression of integrating plain β 1 and E-cadherins.Use immunohistochemical method the proliferative cell nuclear antigen PCNA Ki 67 of liver cancer tissue and the expression of E-cadherins are carried out the sxemiquantitative observation.

Use the high hepatoma cell strain that shifts, observe the inhibitory action that Uropoly acid-peptide composition solution of the present invention adheres to, invades profit and move MHCC97 with the homologous MHCC97 of above-mentioned model.Result of the test shows:

A.600-1800mg/kg Uropoly acid-peptide composition solution of the present invention, the high metastatic human hepatoma nude mice model LCI-D20 to the nude mice Glisson's capsule is inoculated down has certain tumor-inhibiting action, tumour inhibiting rate about 43%.

B. Uropoly acid-peptide composition high dose group of the present invention can suppress the abdominal cavity of hepatocarcinoma and shift, and does not find to shift tuberosity, and tumor is single growth.

C. molecular biology research shows, high dose Uropoly acid-peptide composition solution of the present invention is to proto-oncogene c-myc in the above-mentioned liver cancer tissue, N-ras, and the expression of c-jun and c-fos has tangible downward modulation effect (P＜0.01).Middle dosage (M group) Uropoly acid-peptide composition of the present invention only can reduce the expression (P＜0.05) of N-ras.Uropoly acid-peptide composition of the present invention can be reduced the transcribing of mRNA of MMP 9 genes effectively.

D. Uropoly acid-peptide composition solution of the present invention makes integrates plain β 1 subunit decline, and with 5-FU synergism is arranged; The E-cadherins is expressed to be increased.And both all have statistical significance.

E. the cytologic experiment result shows, can suppress the adhesive capacity of MHCC97 high-transfer cell strain to fibronectin in the dosage range of Uropoly acid-peptide composition of the present invention more than 15mg/ml.The wetting capacity that more than 5mg/ml concentration, can suppress the MHCC97 cell strain, but to the no effect of the motion of this cell.

Conclusion: in high transitivity primary hepatocarcinoma LCI-D20, Uropoly acid-peptide composition solution of the present invention has obvious inhibitory action to the growth of solid tumor.Do the time spent at high dose (1800mg/kg) and can reduce intraabdominal metastasis, most of tumors are single growth (6/8).Molecular biology research shows that Uropoly acid-peptide composition of the present invention is handled can reduce c-myc, N-ras, c-fos and c-jun expression of gene, can obviously increase the expression of adhesion molecule E-cadherins, and part suppresses to integrate the expression of plain β 1 subunit.

3. Uropoly acid-peptide composition injection isolated test is to the growth of human blood cell and the inhibition of telomerase activation

Isolated test shows that Uropoly acid-peptide composition solution of the present invention has inhibitory action and is dose-effect relationship people's marrow blood cancerous cell (HL-60); And the activity to telomerase in this cell has inhibitory action, effect in time prolongation and strengthen.So think that Uropoly acid-peptide composition solution of the present invention has the effect that promotes cell differentiation.

4. the Uropoly acid-peptide composition injection exsomatizes and at body the drug efficacy study isolated test proof Uropoly acid-peptide composition solution of the present invention of people's hepatocarcinoma Smmu is had inhibitory action to human liver cancer cell Smmu 7721, its IC ₅₀And the 95% credible 0.78mg/ml (0.72-0.83mg/ml) that is limited to.Show when Uropoly acid-peptide composition solution dosage of the present invention is 100-400mg/kg, the tumour inhibiting rate of nude inoculation human hepatoma cell strain at 51.8-83.5%, to be had the effect of certain inhibition tumor growth in body test.

5. the Uropoly acid-peptide composition injection exsomatizes to lung carcinoma cell, in the influence of body to ascites hepatocarcinoma, liver-cancer solid tumor and pulmonary carcinoma solid tumor

In order to observe the antitumor drug effect of Uropoly acid-peptide composition solution of the present invention, following 4 tests have been carried out.Isolated test is divided into 7 groups: negative (simulation process) matched group; Be subjected to 5 concentration groups of reagent thing; Positive (mitomycin) matched group.All be divided into 5 groups in the body test: negative control group; Be subjected to basic, normal, high three the dosage groups of reagent thing; Positive controls.1. the antitumor action test of exsomatizing: with the AGZY-83A cell at 5%CO ₂Cultivate in the incubator, show to be subjected to the reagent thing that the growth of human lung carcinoma cell is had inhibitory action, and present dose-effect relationship.2. in the test of body extension ascitic type liver cancer animal survival phase effect: inoculate the HCP hepatoma carcinoma cell mouse peritoneal in, be subjected to the reagent thing can improve animal quality of life, when doses, can prolong the animal survival phase (about rate elongation 24%).3. resist the test of animal liver-cancer solid tumor effect at body: mice forearm subcutaneous vaccination HCP hepatoma carcinoma cell, be subjected to the reagent thing can improve animal quality of life, can both suppress tumor growth when 3 kinds of dosage, suppression ratio on average can reach about 29%, and high dose group can reach 34.5% (P＜0.05); Though and mitomycin has obvious tumor killing effect (P＜0.01) that animal quality of life is obviously worsened.4. in the test of body antagonism animal pulmonary carcinoma solid tumor effect: be subjected to the reagent thing can improve animal quality of life, 3 kinds of dosage can both suppress growth of tumor, and dose-effect relationship is arranged, and middle high dose group suppression ratio on average can reach about 20%; Though and mitomycin has obvious tumor killing effect (P＜0.01) that animal quality of life is obviously worsened, about 1/3 animal is dead before the test date of expiry.

Result proof is subjected to the reagent thing that certain antitumous effect is arranged, and interaction property is different with mitomycin, and the former improvement and the latter are worsened animal quality of life.

6. the Uropoly acid-peptide composition injection is prevented and treated the observation of curative effect of nude mice hepatoma Metastasis recurrence

Transfer and relapse after the early stage and advanced liver cancer excision has preventive and therapeutic effect to nude mice to adopt following method proof Uropoly acid-peptide composition solution of the present invention: behind the high shifting formwork type of the nude mice hepatocarcinoma tumor inoculation, before and after shifting generation, carry out RESECTION OF LIVER CANCER, postoperative subcutaneous injection Uropoly acid-peptide composition solution of the present invention (1200mg/kg) respectively.Put to death animal in 35 days behind the tumor inoculation, shift and the metastasis situation in record the weight of animals, incisxal edge recurrence, the liver.The result proves: 1. after the advanced liver cancer excision, Uropoly acid-peptide composition solution treated animal body weight of the present invention is higher, shifts in the liver and reduces, and the liver weight in wet base reduces, incisxal edge local recurrence tumor is also less, and the internal organs number that the lung metastasis of reflection metastasis and transfer are involved also reduces; 2. after the early hepatocarcinoma excision, interior metastasis of Uropoly acid-peptide composition solution treated animal liver of the present invention and transfer are involved the internal organs number and are also reduced, and shift in the apneumia and take place.

7. the chemical sproof research of Uropoly acid-peptide composition injection reversing tumor

Use the isolated test method, the Uropoly acid-peptide composition solution of the present invention of observing various dose can increase VCR effectively to KBV ₂₀₀The inhibitory action of drug-resistant cell makes KBV ₂₀₀Durable medicine cell improves 16 times to VCR sensitivity.But Uropoly acid-peptide composition solution of the present invention does not cause KBV ₂₀₀MDR1 gene expression generation significant change in the mdr cell does not induce MRP and GST-π gene expression yet.Further studies show that, Uropoly acid-peptide composition solution of the present invention all can make in responsive H23 and the drug resistance H1435 cell MDR1 and GST-π expression of gene increase with person's Uropoly acid-peptide composition solution of the present invention dosage to weaken or disappears, all do not induce the mrp gene expression.Point out Uropoly acid-peptide composition solution of the present invention to KBV ₂₀₀With the H1435 mdr cell in various degree the drug-fast effect of reversing tumor is arranged all, and to KBV ₂₀₀Drug-resistant effect may relate to P-gp reversing drug resistance approach in addition.

8. toxicological study

Acute toxicity test: give mice and rat vein is injected or the Uropoly acid-peptide composition solution of the present invention of lumbar injection maximum volume all can not make animal cause death, can not record the LD value of series.According to mtd test, think the LD of Uropoly acid-peptide composition solution of the present invention to mice iv or ip ₅₀＞50ml/kg (quite 2000mg/kg).LD to rat iv or ip ₅₀＞30ml/kg (quite 1200mg/kg).Concentrate for mice iv and tried thing, record LD ₅₀And 95% credible 3794mg/kg (3165～4547mg/kg) that is limited to.

Long term toxicity test: two kinds of animals of shared rat and Canis familiaris L. are tested, and the result shows no matter rat and Canis familiaris L. through 6 months medication, and the administration group is compared with the simulation process matched group, and every observation index does not all have significant difference.Illustrate that Uropoly acid-peptide composition solution of the present invention is safe under 6 months situation of this kind dosage logotype, no cumulative toxicity is not found any to the body injurious effects.

The general pharmacology test: the experiment of being carried out shows that Uropoly acid-peptide composition solution low dose of the present invention does not have obvious influence to cat and rat blood pressure; In, heavy dose is that the slight and medium degree of cat and rat blood pressure descends, be one and cross property.Little, in, heavy dose of the cat heart rate is not had obvious influence; In, heavy dose slightly slows down the rat heart rate, but not statistically significant.Each 1 example occurs the property the crossed irregularity of pulse in cat and rat 7 examples except that heavy dose makes, and all the other the no electrocardios and the rhythm of the heart change.Low dose of do not have obvious influence to cat and rats breathing frequency and amplitude; Middle dosage slightly increases breathing frequency and amplitude.Little, in, heavy dose of cat and each relevant index of rat spirit nervous system are not had influence.

Special toxicity test has carried out safety evaluatio with microorganism back mutation, micronucleus, sperm deformity and 4 tests of teratogenesis.Experimental result shows: Uropoly acid-peptide composition solution of the present invention does not have mutagenesis, teratogenesis and genotoxicity effect.Pointing out Uropoly acid-peptide composition solution of the present invention to be applied in is safe clinically.

4. the pharmacology analysis of Uropoly acid-peptide composition

The main effective ingredient of Uropoly acid-peptide composition treatment and prophylaxis of cancer comprises: differentiating inducer, differentiation helps agent and anti-cachexia agent.

(1) differentiating inducer: differentiating inducer is the most important effective ingredient of Uropoly acid-peptide composition, but content seldom, and chemical constitution is yet unclear fully.Main induction material is and a bonded coloured peptide of pigment and a special organic acid.Two kinds of induction compositions are the same with oligoisoadenylate makes its consumption at unusual oncoprotein for this, to lead normal Methyl transporters compound enzyme and change and become normal enzyme, cancerous cell just syntheticly carries out that end Mo differentiation stops to divide or the generation apoptosis by what lack methyl nucleic acid as a result.Normocellular growth and function are not then urinated the interference of differentiating inducer, because normal cell does not have the unusual cancer factor, therefore this differentiating inducer is to have the very cancer-resisting substance of high selectivity.

From the research angle of enzyme, it is that inducing cancer cell carries out a turning point of end differentiation eventually that unusual Methyl transporters compound enzyme is transformed into normal enzyme.The amount of AdoMet and AdoHcy also proves the important function that the variation of enzyme is risen in the analysis of cells in the cancerous cell differentiation.The AdoMet amount of cancerous cell is high more than normal cell, because the MAT of cancerous cell ^LTThan Normocellular MAT ^LKm is high.Cancerous cell is in case differentiation becomes terminal cell, and the amount of AdoMet and AdoHcy also lowers a lot, also MAT can be described ^LTAnd SAHH ^LTLose carcinogenic factor and become MAT ^LTAnd SAHH ^LT, these results prove also that from another angle our discovery is correct.

(2) differentiation helps agent: one of main chemical compositions of Uropoly acid-peptide composition is that differentiation helps agent, it is the inhibitor of each member's enzyme of Methyl transporters compound enzyme that differentiation helps agent, the amount of these inhibitor is high also good differentiation-inducing action to can suppress each member's enzyme significantly the time, but because the cause of disease, be that the unusual cancer protein factor is not removed, differentiation is reversible, and it is impossible to reach antitumaous effect with this class preparation separately, coordinates the function that helps so we are eager to excel.When dosage is little, the division of cancerous cell and differentiation are not produced significantly effect, this dosage but has and strengthens the function that differentiating inducer is eliminated the unusual cancer factor, so we help agent to this chemical compound called after differentiation.The competitive inhibitor of MAT has phenylacetic acid, heteroauxing and hippuric acid in the Uropoly acid-peptide composition, and the inhibitor of MT then has uroerythrin and vitamin B2.MA thing inhibitor needs the dosage of mM that obvious facilitation is just arranged, and the inhibitor of MT only needs the dosage of number μ M that identical facilitation is just arranged, so the inhibitor of MT has reasonable differentiation to assist activity.

Though differentiation helps agent assistance by name, is indispensable role in its tangible differentiation therapy.Cancerous cell always has the thin breast of sub-fraction during with single differentiating inducer, about 5-10%, can not be induced differentiation.Be likely at cell division some cell in period and be subjected to the injury of differentiating inducer especially easily and be deadlocked.The program of differentiation need can not be finished two cycle divisions if cell comes to harm through two division cycles, just can not finish end differentiation eventually, therefore has the cell that minority does not have differentiation.The injury that causes cell is that differentiating inducer causes, when Methyl transporters compound enzyme differentiating inducer correction the removing oncoprotein factor, compound enzyme can resolve into separate member's enzyme, thereby they have the activity that reduces nucleic acid to damage, through pause and the reparation of segment length's time, cancerous cell restores to the original state again.This is the problem that the single differentiating inducer of clinical practice is faced, and retinoic acid has good curative effect to acute promyelocytic leukemia, but the catabasis can only keep just recurrence again of several months, recurrence be because the cancerous cell that minority arranged fully differentiation cause.If differentiation be have differentiation help agent in the presence of capable, no matter be the inhibitor of MAT or MT, then the differentiation of cancerous cell can reach a hundred per cent.Differentiation helps agent can promote differentiation on the one hand, can prevent again that on the other hand the cell damage that differentiating inducer causes from finish differentiation smoothly, and recurrence just can obviously be lowered; Can lower the demand of differentiating inducer: list helps agent also to produce effect with differentiation, and phenylacetic acid is affirmed the treatment of star cerebroma.The brain part is more special, and intrinsic induction composition disappears, so help agent evident in efficacy with differentiation.

(3) Uropoly acid-peptide composition and native chemical supervision: it is the low molecule metabolite of human body cell that cell-differentiation inducers in the urine and differentiation help agent, since natural cancer-resisting substance is arranged in the human body, does why having cancer take place? we find that the cancer patient overwhelming majority is from the low-molecular-weight metabolite of homaluria more than the normal person, persistent excessive drainage causes and lacks cancer-resisting substance in the body, thereby can't suppress the propagation of cell, finally the bed symptom occurs, serious more patient's disappearance is severe more.This is a kind of vicious cycle, loses monitoring capacity finally fully, and at this moment cancerous cell can not breed with being tied.Unusual Methyl transporters compound enzyme is a very important factor, but the destruction of native chemical monitoring capacity also is a very important factor.Must take this two factors simultaneously into account so will effectively overcome cancer, promptly will suppress unusual Methyl transporters compound enzyme, also will lower patient and excessively drain the natural anti-cancer chemical substance, so just can receive the effect of getting twice the result with half the effort.From urinating purified anticancer preparation---Uropoly acid-peptide composition, can take into account this two factors, the low molecule metabolites of the excessive drainage of patient slowly reduces, and sb.'s illness took a favorable turn by the time also just returns to normal state.

The result that why patient drains excessive small-molecular weight metabolite may be inflammation has the symptom of inflammation that excessive excretory phenomenon is just arranged.The result of inflammation impels macrophage to produce cachectin (cachectin), and the physiological action of cachectin causes patient excessively to drain.Acute inflammation does not have much relations because very fast recovery is normal to the formation of cancer.The persistent influence of chronic inflammation just can be facilitated cancer, and it is also relevant therewith that AIDS patient and hepatitis B patient tend to take place the reason of cancer finally.Cancerous cell itself also constitutes the source of disease of chronic inflammatory disease, and cancerous cell is breeding more, and the phenomenon of inflammation is serious more, and over-drastic drainage is also obvious more.The excessive drainage treatment for cancer of control is a very important problem effectively.Cell toxicity medicament itself can promote excessively to drain; supervision does not have protection that destruction is arranged on the contrary to native chemical; be not difficult to imagine that the successful needs of CT rely on all cancerous cell eliminations totally; otherwise patient is through the destruction of long-term cell toxicity medicament, do not have the protective potential remaining cancerous cell that disinthibites.Opposite, some composition can improve cancer people's excessive drainage from urinate purified anticancer preparation, after patient's native chemical supervision ability is recovered, eliminate remaining cancerous cell, need not remove all cancerous cell and can fully recover with regard to responsible protective potential own.Phenylacetylglutamine in this urine anticancer preparation just has the excessive excretory function of the cancer patient of improvement; though this chemical compound itself is to the not effect of unusual Methyl transporters compound enzyme; cancerous cell there is not direct repression yet; but owing to can prevent from excessively to drain cancer-resisting substance; protection native chemical supervision ability; the cancer patient lighter to symptom also has medical effect, and the canceration to animal simultaneously has significant preventive effect.The canceration process of zooblast is carried out easily than in animal body in cell culture, because animal has natural chemistry supervision ability, one section very long promotion to remove this protective potential period, and cancerous cell could breed.In general, promote that as this inflammation of Oleum Tiglii material can shorten the promotion phase, but phenylacetylglutamine can be protected the then generation of prophylaxis of cancer of ability of chemistry supervision.

(4) other advantage of differentiation therapy: oncogene and antioncogene are fissional regulator gene mostly, in case cancerous cell has broken up, the expression of oncogene can descend, and the expression of antioncogene can be risen, and this is the result of differentiation.But some does not have direct relation with cell division and differentiation, and and the cancerous cell related factor that cancerates also can disappear along with the differentiation of cancerous cell, for example telomerase (telomerase) is to facilitate cancerous cell to continue the splitted factor, in cancerous cell differentiation back Lock-out, we find also can cause telomerase to disappear after cancerous cell is handled through Uropoly acid-peptide composition.Suppressing apoptotic heat shock protein or bcl-2 also can disappear along with the differentiation of cancerous cell.The gene that amplification is come out also can comprise the myc gene of amplification, the multidrug resistance gene of amplification because of the cancerous cell differentiation disappears.The most important thing is the disappearance of cancer cell metastasis ability, studies show that Uropoly acid-peptide composition can suppress the interior and lung transfer of liver of hepatocarcinoma effectively.More than experiment illustrates that fully in a single day cancerous cell is divided into terminal cell is cancerous cell no longer just, the kind specific character that cancerous cell had originally all can disappear along with the differentiation of cell, so the cancerous cell that has broken up no longer constitutes a threat to patient even without apoptosis.

(5) differentiation of cell and apoptosis: if normal stem cell lack auxin will apoptosis, but in case become the influence that the cell of end differentiation is eventually just no longer lacked auxin: if the target stem cell of same steroid hormone lacks the apoptosis that steroid hormone also can cause cell: if member's enzyme of cancerous cell Methyl transporters compound enzyme is interfered or suppresses also can facilitate the apoptosis of cell.These results hint that very doughtily the apoptosis of Methyl transporters compound enzyme and cell has direct relation, if the state cell that the Methyl transporters compound enzyme can be kept compound enzyme can apoptosis, otherwise cell will apoptosis, so the change of the apoptosis of cell and Methyl transporters compound enzyme and single enzyme has confidential relation.The relation of the ratio that the activity of the rRNA transmethylase of our observation demonstration nucleosome and the activity of RNA catabolic enzyme just in time become, the very possible major function of transmethylase in compound enzyme is Methyl transporters, in case just be transformed into the nucleic acid catabolic enzyme when resolving into independent enzyme, what oligoisoadenglate this just in time is illustrated as there is the very strong activity of inducing the nucleic acid catabolic enzyme, and the result of the strong performance of nucleic acid catabolic enzyme can end the division of cell and cause the apoptosis of cell.The change of this transmethylase and nucleic acid catabolic enzyme relation is both an enzyme just as microbial DNA transmethylase and DNA nucleic acid catabolic enzyme, but have two kinds different active.

Cell-differentiation inducers suppresses the result of unusual Methyl transporters compound enzyme, can facilitate the differentiation of cancerous cell, also can facilitate the apoptosis of cancerous cell, so i.e. apoptosis voluntarily after the differentiation of some cancerous cell.Our experimental data also shows the HL-60 cancerous cell after Uropoly acid-peptide composition is handled, and the cell number that the time one breaks up for a long time can lower, and the apoptotic cells number is then increasing.Though some cancerous cell has after the differentiation promptly the cause effect relation of apoptosis voluntarily, this relation is not inevitable, because the control cell differentiation is different after all with apoptotic factor.The differentiation of control cancer cell, unusual Methyl transporters compound enzyme is most important factor, as long as suppress this kind of enzyme, cancerous cell is bound to break up, determine that apoptotic factor is a lot, the variation of mitochondrial membrane, the expression of suicide gene, protein synthesis, the appearance of new protease, the decomposition of DNA, and the number of the composition of anti-apoptosis or the like.The cause effect relation so differentiation and apoptosis are not inevitable, some cancerous cell is not easy apoptosis all the better after the normal cell differentiation.

(6) Uropoly acid-peptide composition is as complementary therapy: the shortcoming of differentiation therapy is to differ tumor is disappeared soon.Cell poisons with radiotherapy and is mainly promoting so dwindling of tumor is more obvious, can be used for remedying the deficiency of differentiation therapy by the apoptosis of cancerous cell.And the serious consequence that this therapy causes because there not being control abnormity Methyl transporters compound enzyme then can be made up with Uropoly acid-peptide composition.We find because the DNA that cell toxicity medicament causes excessively methylates, if just can not take place when cell-differentiation inducers is arranged, so Uropoly acid-peptide composition can prevent the serious consequence that chemotherapy excessively methylates and causes because of DNA.Moreover, Uropoly acid-peptide composition even the effect that can promote radiation and chemotherapy, because cancerous cell is too much because of the expression of oncogene or anti-apoptosis factor often to the repellence of these two kinds of therapies, and these factors can reduce because of the differentiation of cancerous cell, and therefore the result of differentiation can increase the sensitivity of radiotherapy and cytotoxic chemotherapy.Experiment proved originally to radiotherapy have repellence cancerous cell after differentiating inducer is handled, can become the radiotherapy sensitivity, equally also can increase sensitivity to chemotherapy.Uropoly acid-peptide composition also proves the significantly curative effect of increasing in the result of dying patient's clinical practice, and alleviates side effect, improves patient's quality of life.The effect that Uropoly acid-peptide composition has obvious anticancer to shift, itself does not have toxicity again, prevents the ideal medicament that recurs beyond doubt after the operation.

(7) effect of differentiation therapy

Differentiation therapy also is in the budding stage, Burzynski cures the cancer patient in late period with urine anticancer preparation antineoplaston A10, have the patient of 40-60% to reach more than 50% or all tumor disappear, wherein 1/3rd exceed 5 years and do not have recurrence, this class medicine biggest advantage is to be free from side effects.

The Methyl transporters compound enzyme by MAT, MT and SAHH in conjunction with forming.The activity of compound enzyme improved when auxin was arranged, and ribosomal generation and DNA methyl distribute duplicates the master and can carry out smoothly, and cell is to be able to turn round at division cycle.In case auxin has not existed, the Methyl transporters compound enzyme takes the lead in losing activity, and the activity of nucleic acid synzyme quite stable still, at this moment cell can synthesize the nucleic acid that lacks methyl, thereby cell changes differentiation over to by division, ribosome no longer produces, and differentiation gene is expressed, and this like cell stops division with regard to being divided into terminal cell.

Cancerous cell produces special rho factor and MAT and SAHH and combines, this unusual cancer factor makes compound enzyme maintain active very high steady statue, therefore cancerous cell can't carry out end Mo and breaks up and rest on division cycle and turn round and do not stop, cancerous cell needs external inhibition factor, balance out as the cancer factor of Uropoly acid-peptide composition with unusual Methyl transporters compound enzyme, cancerous cell will carry out end Mo differentiation as normal cell so.

In sum, Uropoly acid-peptide composition is the cancer-resisting substance that is formed through the science refining refinement by fresh Urina Hominis, and effective ingredient comprises that differentiating inducer, differentiation help agent and anti-cachexia agent, and differentiating inducer is the special antagonist of unusual Methyl transporters compound enzyme; It is the inhibitor of each member's enzyme of Methyl transporters compound enzyme that differentiation helps agent, and the inducing action of very strong enhancement differentiating inducer is arranged; Anti-too much eccritic then can recover patient's chemistry supervision association energy, and Uropoly acid-peptide composition of the present invention combines the various medicines of differentiation therapy, by its synergism, has improved the curative effect to cancer greatly.

The present invention from Urina Hominis through extracting and modern means such as purification, make and contain a certain proportion of peptide, amino acid derivativges, the compounding substances of organic acid and inorganic microelement, system has carried out physics and chemistry, drug effect, pharmacology, systematic studys such as toxicity, said preparation has induction to tumor, differentiation helps and anti-too much excretory synergism, and toxicity is low, can promote cancerous cell to move towards normal differentiation or make cancer cell-apoptosis, as novel antitumor drug, can be used for the treatment of multiple late malignant tumour clinically, experimental result shows that this medicine has therapeutic effect and avirulence to kinds of tumors, have very high selectivity, can be cancer patient and bring glad tidings.

Describe the pharmacology and the toxicity of preparation method, pharmaceutical composition and the pharmaceutical composition of medicine of the present invention in detail below in conjunction with drawings and Examples;

Brief Description Of Drawings

Fig. 1 is preparation technology's flow chart of Uropoly acid-peptide

Fig. 4 is the HPLC spectrogram of hippuric acid control sample

Fig. 5 is the HPLC spectrogram of phenylacetylglutamine control sample

Fig. 6 is the HPLC spectrogram of phenylacetic acid control sample

Fig. 7 is the HPLC spectrogram of heteroauxing control sample

Fig. 8 is the HPLC spectrogram of four kinds of organic acid control samples

Fig. 9 is Uropoly acid-peptide composition solution (lot number a 980906) organic acid HPLC spectrogram

Figure 10 is Uropoly acid-peptide composition solution (lot number a 980907) organic acid HPLC spectrogram

Figure 11 is Uropoly acid-peptide composition solution (lot number a 980908) organic acid HPLC spectrogram

Figure 12 is the HPLC spectrogram of Uropoly acid-peptide composition solution (lot number 980908) hippuric acid conclusive evidence

Figure 13 is the HPLC spectrogram of Uropoly acid-peptide composition solution (lot number 980908) phenylacetylglutamine conclusive evidence

Figure 14 is the HPLC spectrogram of Uropoly acid-peptide composition solution (lot number 980908) phenylacetic acid conclusive evidence

Figure 15 is the HPLC spectrogram of Uropoly acid-peptide composition solution (lot number 980908) heteroauxing conclusive evidence

Figure 16 is the HPLC spectrogram of 17 seed amino acid national standard product

Figure 17 is the HPLC analysis of spectra of Uropoly acid-peptide composition solution (lot number 980906) free amino acid

Figure 18 is the HPLC analysis of spectra of Uropoly acid-peptide composition solution (lot number 980907) free amino acid

Figure 19 is the HPLC analysis of spectra of Uropoly acid-peptide composition solution (lot number 980908) trip homoamino acid

Figure 20 is the HPLC analysis of spectra of Uropoly acid-peptide composition solution (lot number 980906) hydrolysis amino acid

Figure 21 is the HPLC analysis of spectra of Uropoly acid-peptide composition solution (lot number 980907) hydrolysis amino acid

Figure 22 is the HPLC analysis of spectra of Uropoly acid-peptide composition solution (lot number 980908) hydrolysis amino acid

Figure 23 is the HPLC spectrogram of peptide standard specimen molecular weight determination

Figure 24 is the standard curve of molecular weight determination

The HPLC spectrogram of Figure 25 Uropoly acid-peptide composition solution (lot number 980906) molecular weight determination

The HPLC spectrogram of Figure 26 Uropoly acid-peptide composition solution (lot number 980907) molecular weight determination

The HPLC spectrogram of Figure 27 Uropoly acid-peptide composition solution (lot number 980908) molecular weight determination

Figure 28 Uropoly acid-peptide composition solution (980906) peptide components is analyzed the HPLC chromatogram

Figure 29 Uropoly acid-peptide composition solution (980907) peptide components is analyzed the HPLC spectrogram

Figure 30 Uropoly acid-peptide composition solution (980908) peptide components is analyzed the HPLC spectrogram

Figure 31 Uropoly acid-peptide composition solution is to the HL-60 cell growth inhibition of In vitro culture

Figure 32 Uropoly acid-peptide composition solution (1.2mg/ml) acts on 6 days to the HL-60 cell growth inhibition

The photomicrograph of HL-60 cell after 7 days of Figure 33 matched group effect In vitro culture

The photomicrograph of HL-60 cell after 7 days of Figure 34 Uropoly acid-peptide composition solution of the present invention (1.2mg/ml) effect In vitro culture

The photomicrograph of HL-60 cell after 7 days of Figure 35 RA (1 μ g/ml) effect In vitro culture

Figure 36 lumbar injection Uropoly acid-peptide composition solution is to the growth inhibited effect of the HL-60 cell of growth down of mice scrotum film

Figure 37 Uropoly acid-peptide composition solution effects is cut into slices the painted photomicrograph of HE---matched group in the effect of the HL-60 cell that mice scrotum film is grown down after 7 days

Figure 38 Uropoly acid-peptide composition solution effects is cut into slices the painted photomicrograph of HE in the effect of the HL-60 cell that mice scrotum film is grown down after 7 days

Figure 39 retinoic acid positive controls acts on the effect of the HL-60 cell of growth under the mice scrotum film and cuts into slices the painted photomicrograph of HE after 7 days

Figure 40 Uropoly acid-peptide composition solution is to the influence of expression of proto-oncogenes in the liver cancer tissue

Figure 41 Uropoly acid-peptide composition solution is to the influence of the MMP-9 gene expression of liver cancer tissue

Figure 42 Uropoly acid-peptide composition solution is to the influence of plain β 1 subunit of the integration of liver cancer tissue and E-cadherins content

Figure 43 Uropoly acid-peptide composition solution is to the inhibition of the external infiltration of MHCC97 hepatoma cell strain

Figure 44 Uropoly acid-peptide composition solution is to inhibitory action A:C group (last figure) L group (figure below) of people's primary hepatocyte hepatocarcinoma nude mice model LCI-D20 growth

Figure 45 Uropoly acid-peptide composition solution is to inhibitory action B:M group (last figure) H group (figure below) of people's primary hepatocyte hepatocarcinoma nude mice model LCI-D20 growth

Figure 46 Uropoly acid-peptide composition solution is to human liver cell hepatocarcinoma LCI-D20 effect gene

The evaluation of A.RNA (denaturing formaldehyde gel electrophoresis) (going up a left side)

B. Uropoly acid-peptide composition is to human liver cell hepatocarcinoma LCI-D20 MMP-9 effect gene (RT-PCR) (going up right)

C. Uropoly acid-peptide composition is to human liver cell hepatocarcinoma LCI-D20 proto-oncogene influence (RT-PCR) (down)

Figure 47 immunohistochemistry detects the expression of E-cadherins among the human liver cell hepatocarcinoma nude mice model LCI-D20

A. liver plasma membrane E-cadherins express positive (on)

B. the E-cadherins is expressed strong positive (* 100) (+++) (descending) in the normal liver cell

The E-cadherins expression positive increases (* 100) (++) among Figure 48 immunohistochemistry detection human liver cell hepatocarcinoma nude mice model LCI-D20

Figure 49 immunohistochemistry detects the expression of Ki67 among the human liver cell hepatocarcinoma nude mice model LCI-D20

A. the expression (* 100) (+) of Ki67 is (A) in the Uropoly acid-peptide composition processed group liver cancer tissue

B. the expression (* 100) (++) of Ki67 is (B) in the Uropoly acid-peptide composition processed group liver cancer tissue

The C. expression (* 100) of Ki67 in the Uropoly acid-peptide composition processed group liver cancer tissue (+++) (C)

It is 1 and the growth curve of blood cell (HL-60cells) during 2mg/ml at dosage that Figure 50 grows in anuria polyacid peptide combinations and Uropoly acid-peptide composition

Figure 51 with the Uropoly acid-peptide

composition solution testing

2,4 of dosage 1 or 2mg/ml with 6 days after compare the test of the propagation of blood cell (HL-60cells) (cells survival rate (%)) with matched group

Figure 52 blood cell the contrast with two Uropoly acid-peptide composition dosage under relevant telomerase activation

Figure 53 grows in, the relevant telomerase activation of the blood cell (HL-60cells) of anuria polyacid peptide combinations solution.

Figure 54 Uropoly acid-peptide composition solution is in the outward appearance of body to the CTX positive controls tumor of people's hepatocarcinoma Smmu drug efficacy study

Figure 55 Uropoly acid-peptide composition solution is in the outward appearance of body to the normal saline negative control group tumor of people's hepatocarcinoma Smmu drug efficacy study

Figure 56 Uropoly acid-peptide composition solution is in the outward appearance of body to the high dose group tumor of people's hepatocarcinoma Smmu drug efficacy study

Figure 57 Uropoly acid-peptide composition solution is in the outward appearance of body to the middle dosage group tumor of people's hepatocarcinoma Smmu drug efficacy study

Figure 58 Uropoly acid-peptide composition solution is in the outward appearance of body to the low dose group tumor of people's hepatocarcinoma Smmu drug efficacy study

Figure 59 Uropoly acid-peptide composition solution exsomatizes to the test group of lung carcinoma cell influence, and the lung carcinoma cell growth curve of 3 groups of positive and negative

Embodiment one. the preparation of Uropoly acid-peptide

About 450ml adds in the 20kg freshly voided urine with the 1mol/L hydrochloric acid solution, is adjusted to pH value and is about 3; After the filtration, collect urine.

Use the ultrafiltration apparatus ultrafiltration: in ultrafiltration apparatus, add deionized water, wash the bubble ultrafilter membrane; To collect urine and pour in the charging bucket, the beginning nanofiltration, controlled pressure 5Mpa, flow velocity 800ml/ minute, collect molecular weight and be lower than 10000 low molecule filtrate, discard high molecular filtrate.

With C18 silica gel 5kg, soaked 5 minutes with ethanol 15L, be positioned over funnel-form in the bag of packing into and mould in the bucket, make adsorption column, column section amasss 0.018m ²,, use 15 liters of ethanol and 25 liters of deionized water wash C18 silica gel more successively respectively once with deionized water flush away ethanol; Then the flow velocity of low-molecular-weight filtrate with 2L/ minute added in the post: after adding, earlier with the flow velocity washing C18 silicagel column of 25L distilled water with 0.5L/ minute; Reuse 10L ethanol adds in the C18 silicagel column with 3L/ minute flow velocity, makes the effective ingredient desorption that is adsorbed, and collecting coloured moiety is effective eluent; Effective eluent of collecting is added vacuum drier, slow heat temperature raising, the control feed temperature is 30 ℃, evaporates substantially up to solvent; Lyophilization obtains the Uropoly acid-peptide composition dry product.

With distilled water 20L dissolving dried residue, promptly get the Uropoly acid-peptide crude product solution; Regulate the pH value to 6.0 of Uropoly acid-peptide crude product with the 2mol/L sodium hydroxide solution after; Crude product was placed 80 hours in 1 ℃ low temperature storehouse; Get the crude product upper strata liquid that leaves standstill after the processing, in 100000 grades of toilets, use the micropore filter paper filtering, collect filtrate, promptly get Uropoly acid-peptide solution; With the ultrafilter membrane ultrafiltration of 10,000 molecular weight, to remove thermal source, again through the Ultipor VF of PALL company ^TMDV50 removes virus filter and crosses filtering virus, and the response rate is about 0.18% (volume ratios) of inventory, and it is qualified to detect through intracellular toxin.

Uropoly acid-peptide dry powder can be made oral tablet or capsule by compound other additive, and Uropoly acid-peptide solution can be made oral liquid, also can make injection.

Embodiment two. the preparation of Uropoly acid-peptide

About 500ml adds in the 20kg freshly voided urine with the 1mol/L hydrochloric acid solution, is adjusted to pH value and is about 2; Filter the back and collect urine.

Use the ultrafiltration apparatus ultrafiltration: in ultrafiltration apparatus, add deionized water, wash the bubble ultrafilter membrane: will collect urine and pour in the charging bucket, and open feed pump, the beginning nanofiltration, controlled pressure is 1Mpa, flow velocity 900ml/ minute, collect molecular weight and be lower than 10000 low molecule filtrate, discard high molecular filtrate.

With XAD-8 silica gel 10kg, soaked 20 minutes with ethanol 25L, be positioned in the bag of packing into and mould in the bucket, make adsorption column, with deionized water flush away ethanol, use 25 liters of ethanol and 20 liters of deionized water wash XAD-8 silica gel more successively respectively once; Then the flow velocity of low-molecular-weight filtrate with 1.5L/ minute added in the post; After adding, earlier with the flow velocity washing XAD-8 post of 20L distilled water with 3L/ minute; Reuse 15L ethanol adds in the XAD-8 post with 1.0L/ minute flow velocity, makes the effective ingredient desorption that is adsorbed, and collecting coloured moiety is effective eluent; Effective eluent of collecting is added vacuum drier, slow heat temperature raising, the control feed temperature is 70 ℃, evaporate partial solvent after; Get the Uropoly acid-peptide crude product solution; Regulate the pH value to 8.0 of Uropoly acid-peptide crude product with the 2mol/L sodium hydroxide solution after; Crude product was placed 160 hours in 10 ℃ low temperature storehouse; Get the crude product upper strata liquid that leaves standstill after the processing, in 100000 grades of toilets, use the micropore filter paper filtering, collect filtrate, promptly get Uropoly acid-peptide solution: with the ultrafilter membrane ultrafiltration of 10,000 molecular weight, to remove thermal source, again through the Ultipor VF of PALL company ^TMDV50 removes virus filter and crosses filtering virus, by vacuum drying, obtains the Uropoly acid-peptide composition dry product again.

The response rate is about 0.8% (volume ratios) of inventory, and it is qualified to detect through intracellular toxin.

Embodiment three. the preparation of Uropoly acid-peptide

About 520ml adds in the 20kg freshly voided urine with the 1mol/L hydrochloric acid solution, is adjusted to pH value and is about 1.2; Filter the back and collect urine.

Use the ultrafiltration apparatus ultrafiltration: in ultrafiltration apparatus, add deionized water, wash the bubble ultrafilter membrane: will collect urine and pour in the charging bucket, and open feed pump, the beginning nanofiltration, controlled pressure is 2Mpa, flow velocity 1200ml/ minute, collect molecular weight and be lower than 10000 low molecule filtrate, discard high molecular filtrate.

With XAD-7 silica gel 15kg, soaked 10 minutes with ethanol 20L, be positioned over funnel-form in the bag of packing into and mould in the bucket, make adsorption column, with deionized water flush away ethanol, use 20 liters of ethanol and 15 liters of deionized water wash XAD-7 more successively respectively once; Then the flow velocity of low-molecular-weight filtrate with 1.0L/ minute added in the post; After adding, earlier with the flow velocity washing XAD-7 post of 15L distilled water with 1.5L/ minute; Reuse 15L ethanol adds in the XAD-7 post with 0.5L/ minute flow velocity, makes the effective ingredient desorption that is adsorbed, and collecting coloured moiety is effective eluent; Effective eluent of collecting is added vacuum drier, slow heat temperature raising, the control feed temperature is 80 ℃, up to solvent evaporated; Lyophilization obtains the Uropoly acid-peptide composition dry product.

With distilled water 20L dissolving dried residue, promptly get the Uropoly acid-peptide crude product solution; Regulate the pH value to 7.4 of Uropoly acid-peptide crude product with the 2mol/L sodium hydroxide solution after; Crude product was placed 120 hours in 5 ℃ low temperature storehouse; Get the crude product upper strata liquid that leaves standstill after the processing, in 100000 grades of toilets, use the micropore filter paper filtering, collect filtrate, promptly get Uropoly acid-peptide solution; With the ultrafilter membrane ultrafiltration of 10,000 molecular weight, to remove thermal source, again through the Ultipor VF of PALL company ^TMDV50 removes virus filter and crosses filtering virus, and the response rate is about 2.5% (volume ratios) of inventory, and it is qualified to detect through intracellular toxin.

Embodiment four. the preparation of Uropoly acid-peptide

About 510ml adds in the 20kg freshly voided urine with the 1mol/L hydrochloric acid solution, is adjusted to pH value and is about 1.5; Filter the back and collect urine.

Use the ultrafiltration apparatus ultrafiltration: in ultrafiltration apparatus, add deionized water, wash the bubble ultrafilter membrane; To collect urine and pour in the charging bucket, open feed pump, the beginning nanofiltration, controlled pressure is 1.5Mpa, flow velocity 1000ml/ minute, collect molecular weight and be lower than 9000 low molecule filtrate, discard high molecular filtrate.

With XAD-16 12kg, soaked 23 minutes with methanol 22L, be positioned over funnel-form in the Nylon Bag of packing into and mould in the bucket, make adsorption column, column section amasss 0.022m ²,, use 17 liters of ethanol and 23 liters of deionized water wash XAD-16 more successively respectively once with deionized water flush away methanol; Then the flow velocity of low-molecular-weight filtrate with 0.5L/ minute added in the post: after adding, earlier with the flow velocity washing XAD-16 post of 22L distilled water with 1.2L/ minute; Reuse 20L methanol adds in the XAD-16 post with 2L/ minute flow velocity, makes the effective ingredient desorption that is adsorbed, and collecting coloured moiety is effective eluent; Effective eluent of collecting is added vacuum drier, slow heat temperature raising, the control feed temperature is 65 ℃, up to solvent evaporated; Lyophilization obtains the Uropoly acid-peptide composition dry product.

With distilled water 20L dissolving dried residue, promptly get the Uropoly acid-peptide crude product solution; Regulate the pH value to 7.0 of Uropoly acid-peptide crude product with the 2mol/L sodium hydroxide solution after; Crude product was placed 110 hours in 5 ℃ low temperature storehouse; Get the crude product upper strata liquid that leaves standstill after the processing, in 100000 grades of toilets, use the micropore filter paper filtering, collect filtrate, promptly get Uropoly acid-peptide solution; With the ultrafilter membrane ultrafiltration of 10,000 molecular weight, to remove thermal source, again through the Ultipor VF of PALL company ^TMDV50 removes virus filter and crosses filtering virus, and the response rate is about 3.2% (volume ratios) of inventory, is packaged as finished product after the intracellular toxin detection is qualified.

Embodiment five. the preparation of Uropoly acid-peptide

About 490ml adds in the 20kg freshly voided urine with the 1mol/L hydrochloric acid solution, is adjusted to pH value and is about 2.5; Filter the back and collect urine.

Use the ultrafiltration apparatus ultrafiltration: in ultrafiltration apparatus, add deionized water, wash the bubble ultrafilter membrane; To collect urine and pour in the charging bucket, open feed pump, the beginning nanofiltration, controlled pressure is 2.5Mpa, flow velocity 1100ml/ minute, collect molecular weight and be lower than 9000 low molecule filtrate, discard high molecular filtrate.

With XAD-16 silica gel 20kg, soaked 8 minutes with ethanol 17L, be positioned over funnel-form in the Nylon Bag of packing into and mould in the bucket, make adsorption column, column section amasss 0.010m ²With deionized water flush away ethanol, use 22 liters of ethanol and 18 liters of deionized water wash XAD-16 more successively respectively once, then the flow velocity of low-molecular-weight filtrate with 0.7L/ minute added in the post: after adding, earlier with the flow velocity washing XAD16 post of 18L distilled water with 1.2L/ minute; Reuse 8L ethanol adds in the XAD-16 post with 0.8L/ minute flow velocity, makes the effective ingredient desorption that is adsorbed, and collecting coloured moiety is effective eluent; Effective eluent of collecting is added vacuum drier, slow heat temperature raising, the control feed temperature is 60 ℃, up to solvent evaporated; Lyophilization obtains the Uropoly acid-peptide composition dry product.

With distilled water 20L dissolving dried residue, promptly get the Uropoly acid-peptide crude product solution; Regulate the pH value to 7.0 of Uropoly acid-peptide crude product with the 2mol/L sodium hydroxide solution after; Crude product was placed 100 hours in 5 ℃ low temperature storehouse; Get the crude product upper strata liquid that leaves standstill after the processing, in 100000 grades of toilets, use the micropore filter paper filtering, collect filtrate, promptly get Uropoly acid-peptide solution.

With the ultrafilter membrane ultrafiltration of 10,000 molecular weight, to remove thermal source, again through the Ultipor VF of PALL company ^TMDV50 removes virus filter and crosses filtering virus, and the response rate is about 3.9% (volume ratios) of inventory, is packaged as finished product after the intracellular toxin detection is qualified.

Embodiment six. the physicochemical constant of Uropoly acid-peptide composition

Take by weighing each four parts of the about 0.4g of Uropoly acid-peptide composition dry powder respectively, add the 10ml deionized water, obtain Uropoly acid-peptide composition solution, lot number is respectively 980905,980906,980907,980908,980909 every part solid contents and sees the following form;

Project 980,905 980,906 980,907 980,908 980906

Gu total (g/ml) 0.0372 0.0384 0.0397 0.0405 0.0409

Sampling and testing is as follows respectively:

1. the color of character and solution: (lot number: 980905,980906,980907,980908,980909) outward appearance all is light yellow, brown to the dark-brown clear liquid to five batches of test samples of Uropoly acid-peptide composition solution of the present invention.

2. particulate matter inspection: press two appendix IX of Chinese Pharmacopoeia nineteen ninety-five version C check, this product is all up to specification.

3.pH value: press two appendix VI of Chinese Pharmacopoeia nineteen ninety-five version H and check that the pH value of Uropoly acid-peptide composition solution of the present invention is:

Project 980,905 980,906 980,907 980,908 980909

PH 6.0 7.39 7.49 7.35 8.0

4. residue on ignition: press two appendix VIII of Chinese Pharmacopoeia nineteen ninety-five version N and check that the residue on ignition of this product is:

Project 980,906 980,907 980908

Residue on ignition (g/ml) 0.0141 0.0142 0.0148

Must not be decided to be according to residue on ignition as a result and to surpass 2.0% (w/v).

5. nitrogen content: press the check of Chinese Pharmacopoeia nineteen ninety-five version appendix VII D meso method, precision is measured this product 1ml and is measured, and measures nitrogen content and is:

Project 980,905 980,906 980,907 980,908 980909

Nitrogen content (mg/ml) 2.01 2.28 2.39 2.36 3.25

Must not be lower than 2.0mg/ml according to nitrogen content as a result.

6. element determination method: atomic absorption spectroscopy determination result: (unit: μ g/ml) as follows

Project 980,905 980,906 980,907 980,908 980909

Ca 10 14 11 16 18

Mg 7 9 8 9 11

Fe 0.1 0.3 0.8 0.4 1.2

Zn 0.05 0.1 0.1 0.1 1.5

Mn 0.02 0.06 0.06 0.07 0.10

Cu 0.01 ＜0.01 ＜0.01 ＜0.01 0.03

Cr 0.01 0.04 0.03 0.04 0.08

Co 0.05 ＜0.05 ＜0.05 ＜0.05 ＜0.1

Na 3000 5000 5000 6000 8000

K 60 80 100 100 120

Total amount 3077.24 5103.56 5120.05 6125.67 8152.01

Embodiment seven. the affirmation of organic acid structure in the Uropoly acid-peptide composition

With mainly containing four kinds of organic acid in the HPLC analysis confirmation pharmaceutical composition of the present invention: hippuric acid, phenylacetylglutamine, phenylacetic acid and heteroauxing, and measured content.

Test sample: Uropoly acid-peptide composition, lot number: 980908 (solid content 0.0405mg/ml);

With reference to standard specimen: purchase pure product, hippuric acid, phenylacetylglutamine, phenylacetic acid, heteroauxing in Sigma company;

Method: HPLC method

Instrument and chromatographic condition:

Waters 510 high performance liquid chromatographs, 481 type detectors, U6K manual injector, Tianjin, island C-6RA integrator

Post: ZORBAX 300SB-C18 4.6 * 150mm 5 μ

Mobile phase: methanol: water (15: 85) 0.5% acetic acid

Flow velocity: 0.6ml/min

35 ℃ of column temperatures

Detect wavelength 260nm

The preparation of reference substance solution

It is an amount of to take by weighing hippuric acid, phenylacetic acid, phenylacetylglutamine, heteroauxing respectively, dissolve and be made into the reference substance solution of following concentration with the 0.4M sodium hydroxide solution: hippuric acid 6.559mg/ml, phenylacetylglutamine 7.576mg/ml, phenylacetic acid 4.09mg/ml, heteroauxing 0.214mg/ml.

Through 0.45 μ m membrane filtration, get each filtered solution 1 μ l (phenylacetylglutamine is got 5 μ l) respectively, write down corresponding chromatogram, characteristic peak is hippuric acid Rt=5.9; Phenylacetylglutamine Rt1=6.3, Rt2=7.117; Phenylacetic acid Rt=11.467; Heteroauxing Rt=13.98 sees accompanying drawing 4-7.

The need testing solution preparation: it is an amount of to get test sample, and through 0.45 μ m membrane filtration, as need testing solution, sample introduction 1 μ l writes down corresponding chromatogram and sees Fig. 2 with filtered solution.

The preparation of conclusive evidence solution: get phenylacetic acid, heteroauxing, hippuric acid, phenylacetylglutamine solution reference substance solution respectively, mix in right amount with need testing solution, through 0.45 μ m membrane filtration, filtered solution is as the test liquid (conclusive evidence solution) that adds reference substance.Sample introduction 2 μ l write down corresponding chromatogram respectively, and compare with sample organic acid analysis collection of illustrative plates.

The conclusive evidence of hippuric acid (seeing accompanying drawing 12): by comparing with the hippuric acid spectrogram, add as can be seen in the test sample chromatogram behind the hippuric acid, the peak area that does not add relevant position (Rt=5.933) in the sample spectrogram of hippuric acid except that the peak area ratio of Rt=6.1 obviously increases, all the other each peak-to-peak area basically identicals, thus 9# peak (Rt=5.933) is hippuric acid among the conclusive evidence sample chromatogram figure.

The conclusive evidence of phenylacetylglutamine (seeing accompanying drawing 13) is by comparing with the phenylacetylglutamine spectrogram, add as can be seen in the test sample chromatogram behind the phenylacetylglutamine, the peak area that does not add relevant position (Rt=6.383) in the sample spectrogram of phenylacetylglutamine except that the peak area ratio of Rt=6.398 obviously increases, all the other each peak-to-peak area basically identicals, thus 10# peak (Rt=6.383) is phenylacetylglutamine among the conclusive evidence Uropoly acid-peptide sample chromatogram figure.

The conclusive evidence of phenylacetic acid (seeing accompanying drawing 14): by comparing with the phenylacetic acid spectrogram, add as can be seen in the test sample chromatogram behind the phenylacetic acid, the peak area that does not add relevant position (Rt=11.333) in the sample spectrogram of phenylacetic acid except that the peak area ratio of Rt=11.833 obviously increases, all the other each peak-to-peak area basically identicals, thus 19# peak (Rt=11.333) is phenylacetic acid among the conclusive evidence sample chromatogram figure.

The conclusive evidence of heteroauxing (seeing accompanying drawing 15): by comparing with the heteroauxing spectrogram, add as can be seen in the test sample chromatogram behind the heteroauxing, the peak area that does not add relevant position (Rt=13.733) in the sample spectrogram of heteroauxing except that the peak area ratio of Rt=13.767 obviously increases, all the other each peak-to-peak area basically identicals, thus 22# peak (Rt=11.733) is heteroauxing among the conclusive evidence sample chromatogram figure.

Embodiment eight. and organic acid content determines in the Uropoly acid-peptide composition

Instrument, chromatographic condition:

Instrument Waters 510 high performance liquid chromatographs

Post ZORBAX SB-C18 3.0mm * 150mm

Mobile phase methanol: water (15: 85) 0.5% acetic acid

Flow velocity 0.4ml/min

35 ℃ of column temperatures

Detect wavelength 260nm

Operation:

A. the preparation of reference substance solution

1. hippuric acid: get 5.7 milligrams and be dissolved in 2.5 ml methanol.

2. phenylacetylglutamine: get 8.3 milligrams and be dissolved in 2.5 milliliters of 0.4mol/L sodium hydroxide solutions.

3. phenylacetic acid: get 43.0 milligrams and be dissolved in 2.5 ml methanol.

4. heteroauxing; Get 4.7 milligrams and be dissolved in 2.5 ml methanol.

Respectively get 200 μ l, mixing, sample size are 10 μ l; The HPLC collection of illustrative plates of four kinds of organic acid reference substances is seen Fig. 8

B. need testing solution preparation

The test sample lot number: 980905 (solid content 0.0372mg/ml) 980906,980907,980908,980909 (solid content 0.0409mg/ml) get stock solution with 5 times of ultra-pure water dilutions after, 0.45 μ m membrane filtration, sample introduction 10 μ l; The HPLC spectrogram of test sample is seen Fig. 9-11.By analyzing, four kinds of organic acid content are as shown in the table:

Four kinds of organic acid content of table 6.

Project (mg/ml) 980,905 980,906 980,907 980,908 980909

Hippuric acid 4.17 5.97 6.60 7.03 7.94

Phenylacetylglutamine amine 4.87 8.22 6.96 9.20 10.86

Phenylacetic acid 0.66 3.77 3.70 3.87 4.50

Heteroauxing 0.11 0.19 0.19 0.20 0.28

Total amount 9.81 18.15 17.45 20.30 23.58

Percentage composition (%) 26.34 47.27 43.95 50.12 57.65

Above result draws, and four kinds of organic acid content are respectively: hippuric acid 4.17-7.94mg/ml; Phenylacetylglutamine 4.87-10.86mg/ml; Phenylacetic acid 0.66-4.5mg/ml; Heteroauxing 0.11-0.28mg/ml; Four kinds of organic acid total contents are 26.34-57.65% in the Uropoly acid-peptide composition.

Embodiment nine. Uropoly acid-peptide composition peptide ammino acid Determination on content

One of Uropoly acid-peptide composition master composition of the present invention is a small-molecular peptides, by measuring the method for free amino acid and hydrolysis amino acid amount, determines the amount of peptide ammino acid, and method of testing and result are as follows:

One, the mensuration of free amino acid

Method: the PICO.TAG of Waters company ^TMThe determined amino acid method.

Reagent and instrument: 17 seed amino acid reference substances; Phenyl isothiocyanate (PICO) derivating agent; Triethylamine; Sodium acetate; Acetonitrile.

High-pressure pump, gradient controller, UV-detector, integrator, post thermostat, PICO.TAG ^TMWork station and amino acid analysis dedicated columns.

Chromatographic condition:

1. mobile phase:

A liquid Sodium acetate trihydrate 19.0g is dissolved in the 1000mL ultra-pure water, adds triethylamine 0.5mL, transfers pH 6.4 with glacial acetic acid, filters.Get filtrate 940mL and add acetonitrile 60mL;

B liquid 60% acetonitrile solution;

2. detect wavelength 254nm;

3. column temperature is 38 ℃;

4. gradient

Time flow velocity A% B% curve number

Start 1.0 100 0

10.0 1.0 54 46 5

10.5 1.0 0 100 6

11.5 1.0 0 100 6

12.0 1.5 0 100 6

12.5 1.5 100 0 6

20.0 1.5 100 0 6

20.5 1.0 100 0 6

5. sample diluting liquid is got sodium hydrogen phosphate 710mg and is added ultra-pure water 1000mL dissolving, and use 10% phosphoric acid: pH 7.4 is standby for acetonitrile liquid (95: 5) accent.

Assay method:

Need testing solution and 5 μ L reference substance solution are placed the sample tubule respectively, and the reaction bulb of packing into, in vacuum drying on the PICO.TAG work station after 30 minutes, every pipe adds the dry again liquid of 10 μ L (ethanol: water: triethylamine=2: 2: 1), vacuum drying 30 minutes, every pipe adds 20 μ L derivating agents, and (phenyl isothiocyanate: ethanol: triethylamine: water=1: 7: 1: 1), room temperature was placed after 20 minutes, vacuum drying.Every pipe adds 200 μ L sample diluting liquids, and sample introduction is measured.

Calculate: is that standard is calculated by external standard method with national aminoacid standard substance; The content that obtains free amino acid is:

Project 980,905 980,906 980,907 980,908 980909

Free amino acid (mg/ml) 0.7 1.0 0.9 0.9 1.3

The assay method of hydrolysis amino acid

Method: the PICO.TAG of Waters company ^TMThe determined amino acid method.

Reagent and instrument: 17 seed amino acid reference substances: phenyl isothiocyanate (PICO) derivating agent; Triethylamine; Sodium acetate; Acetonitrile.

Two high-pressure pumps, gradient controller, UV-detector, integrator, post thermostat, PICO.TAG ^TMWork station and amino acid analysis dedicated columns.

Chromatographic condition:

1. mobile phase:

A liquid Sodium acetate trihydrate 19.0g is dissolved in the 1000mL ultra-pure water, adds triethylamine 0.5mL, transfers with glacial acetic acid

PH6.4 filters.Get filtrate 940mL and add acetonitrile 60mL;

B liquid 60% acetonitrile solution;

2. detection wavelength: 254nm;

3. column temperature: 38 ℃;

4. gradient:

Time flow velocity A% B% curve number

Start 1.0 100 0

10.0 1.0 54 46 5

10.5 1.0 0 100 6

11.5 1.0 0 100 6

12.0 1.5 0 100 6

12.5 1.5 100 0 6

20.0 1.5 100 0 6

20.5 1.0 100 0 6

5. sample diluting liquid: get sodium hydrogen phosphate 710mg and add ultra-pure water 1000mL dissolving, use 10% phosphoric acid: pH 7.4 is standby for acetonitrile liquid (95: 5) accent.

Assay method:

Need testing solution and 5 μ L reference substance solution are placed the sample tubule respectively, and the reaction bulb of packing into, in vacuum drying on the PICO.TAG work station after 30 minutes, add at the bottom of the reaction bulb contain the 6mol/L hydrochloric acid 200ul of 1% phenol after, use the nitrogen replacement air, the operation triplicate.To reflect the bottled thermostatic heater (105 ℃ hydrolysis 2 hours) of going into.Every pipe adds the dry again liquid of 10 μ L, and (ethanol: water: triethylamine=2: 2: 1), vacuum drying 30 minutes, every pipe add 20 μ L derivating agents (phenyl isothiocyanate: ethanol: triethylamine: water=1: 7: 1: 1), room temperature were placed after 20 minutes, vacuum drying.Every pipe adds 200 μ L sample diluting liquids, and sample introduction is measured.

Calculate: is that standard is calculated by external standard method with national aminoacid standard substance; The content that obtains hydrolysis amino acid is:

Project 980,905 980,906 980,907 980,908 980909

Hydrolysis total amino acids (mg/ml) 8.5 10.6 10.7 10.6 11.4

Peptide ammino acid content: peptide ammino acid=hydrolysis total amino acids-free amino acid

The result

(1) the HPLC chromatogram (seeing accompanying drawing 16) of aminoacid national standard product (Nat'l Pharmaceutical ﹠ Biological Products Control Institute's distribution).

(2) free amino acid of the HPLC chromatogram of the free amino acid of Uropoly acid-peptide composition solution and each peak correspondence is seen accompanying drawing 17-19.

(3) free amino acid of the HPLC chromatogram of the hydrolysis total amino acids of Uropoly acid-peptide composition solution and each peak correspondence is seen accompanying drawing 20-22)

By Figure 16-22 as seen, during the free amino acid of three batches of Uropoly acid-peptide composition solution and hydrolysis amino acid are measured, the retention time basically identical of each amino acid whose retention time and reference substance (17 seed amino acid national standard product).

For example: in the 17 seed amino acid national standard product, the retention time Rt=1.800 of free amino acid among the retention time Rt=1.867 of glutamic acid (Glu), Uropoly acid-peptide composition solution (lot number 980906), the retention time Rt=1.817 of glutamic acid after the hydrolysis; The retention time Rt=6.483 of alanine in the reference substance, the retention time Rt=6.508 of free acid propyl in the Uropoly acid-peptide composition solution (lot number 980906), the retention time Rt=6.308 of alanine after the hydrolysis; The retention time Rt=8.383 of tyrosine in the reference substance, the retention time Rt=6.508 of free cheese base acid in the Uropoly acid-peptide composition solution (lot number 980906), the retention time Rt=8.342 of tyrosine after the hydrolysis; As seen the retention time basically identical at each peak in each amino acid whose retention time and the reference substance, slightly drift.

(4) experimental result of amino acid content is as follows in the Uropoly acid-peptide composition solution:

Project (mg/ml) 980,905 980,906 980,907 980,908 980909

Hydrolysis amino acid amount 8.5 10.6 10.7 10.6 11.4

Free amino acid 0.7 1.0 0.9 0.9 1.3

Peptide ammino acid amount 7.8 9.6 9.8 9.7 10.9

HPLC, PICOTAG ^TMIt is 0.8-1.3mg/ml that the specificity system detects this product free aminoacid content, hydrolysis total amino acids content is 8.5-11.4mg/ml, by calculating the peptide ammino acid amount is 7.7-10.9mg/ml, it is 90.6-95.6% that peptide ammino acid accounts for hydrolysis total amino acids amount, total peptide content is about 20.7-26.7%, thereby the composition of this peptide should be one of main composition of Uropoly acid-peptide composition solution of the present invention.

Embodiment ten. the mensuration of Uropoly acid-peptide composition peptide molecular weight

The molecular weight of peptide has not yet to see report in the Uropoly acid-peptide composition of the present invention, now measures the molecular weight of Uropoly acid-peptide composition solution of the present invention with the HPSEC method.

1. test sample: Uropoly acid-peptide composition solution is produced by our company lot number is provided: 980905,980906,980907,980908,980907.

2. peptide standard specimen: provide polypeptide and small molecular protein molecular weight standard product by Nat'l Pharmaceutical ﹠ Biological Products Control Institute.

3. experiment material and method

Instrument is formed Waters 510 pumps, 481 type detectors, U6K injector, integrator or work station, pH meter.

Chromatographic condition

The aqueous solution of mobile phase 0.05%TFA 10% acetonitrile

Flow velocity 1.0ml/min

Post TSK GEL G2000SW * L7.8mm * 300mm 5 μ.

The column temperature room temperature

Detect wavelength 214nm

The molecular weight standard curve plotting

Take by weighing ribonuclease A (M.W13700) 2mg, insulin (M.W.5808) 2mg, Somatostain (M.W.1521) 2mg, 6 peptides (M.W.564) 2mg, be dissolved in respectively in the 1ml mobile phase, respectively get mixed in equal amounts again, behind 0.45 μ m membrane filtration, sample introduction 1 μ l, write down corresponding retention time, repeat sample introduction 5 times, its retention time relative standard deviation must not be greater than 2.0%.With the retention time is abscissa, and the molecular weight logarithm is that vertical coordinate carries out linear regression, and correlation coefficient must not be less than 0.99.Go out retention time by regression equation calculation corresponding to molecular weight 1.0 ten thousand.

Test sample is measured: it is an amount of to get test sample, 0.45 μ m membrane filtration, and sample introduction 1 μ l writes down corresponding spectrogram, presses the area normalization method and calculates.

4. experimental result

The HPLC spectrogram of peptide standard specimen molecular weight determination is seen accompanying drawing 23.

1. peptide standard specimen molecular weight determination result is as shown in the table:

Retention time

Sample introduction number of times ribonuclease A insulin Somatostain 6 peptides

1 6.413 7.248 8.797 12.602

2 6.583 7.423 8.98 12.833

3 6.558 7.408 8.983 12.837

4 6.685 7.565 9.142 12.902

5 6.635 7.512 9.13 13.053

x+s 6.575+0.103 7.431+0.121 9.006+0.140 12.845+0.163

RSD(％) 1.56 1.63 1.56 1.26

2. regression equation and standard curve

Carry out linear regression (giving up 6 peptides a bit) with first three point, get regression equation, standard curve is seen Figure 24:

Y=6.685-0.39X, r=0.9991 (range of linearity Rt 6.5748-90064)

3. according to regression equation calculation, the retention time of corresponding molecular weight 10,000 is Rt=6.88

4. the molecular weight determination spectrogram of Uropoly acid-peptide composition solution example is seen accompanying drawing 25-27, in the spectrogram, the retention time at first three peak all in the range of linearity of standard curve, according to regression equation calculation, this three peaks (1#, 2#, 3#) corresponding molecular weight such as following table:

980,905 9,200 5,800 2,100,980,906 8,800 5,200 1,700,980,907 7,500 4,300 1,400,980,908 8,000 4,660 1,600,980,909 7,000 4,000 1,000 3 each the peak corresponding molecular weight in 3# peak, 2# peak, 1# peak are respectively 7000-9200,4000-5800,1000-2100.

5. Uropoly acid-peptide composition: the molecular weight of solution example is 9200 to the maximum, and the molecular weight of contained polypeptide less than 10000 dalton, this shows that all peptide exists with the form of small-molecular peptides substantially in these product.

Embodiment 11. the peptide analysis of components of Uropoly acid-peptide composition

The main composition of Uropoly acid-peptide composition except that free amino acid and four kinds of organic acid, still has a certain proportion of small-molecular peptides, through separate the peptide components of these product with the HPLC exclusion chromatography, obtains molecular weight 10,000 following heterogeneity small-molecular peptides components.

1. test sample: our company produces lot number is provided: 980906,980907,980908.

2.HPLC exclusion chromatography

Reagent: phosphate buffer (0.02mol/L) takes by weighing potassium dihydrogen phosphate 2.72g, is dissolved in the 500ml ultra-pure water,

Transfer pH to 7.4 with 0.1mol/L NaOH, be diluted to 1000ml with ultra-pure water.

Instrument and system

Waters HPLC 510 type pumps, 481 type detectors, 740 type data processors;

Post Protein-Pak. ^TM60 7.8mm * 300mm;

Flow velocity 1.0ml/min;

Mobile phase phosphate buffer (0.02mol/L);

37 ℃ of column temperatures;

Detect wavelength 280nm.

Get test sample 5 μ l to be measured, sample introduction, the record analysis result calculates the relative percentage composition of peptide.

3. result

Through using the HPLC exclusion chromatography, gel column Protein 60 separates and detects the peptide components of Uropoly acid-peptide composition of the present invention, obtains a series of peptide peak (seeing accompanying drawing 28-30), and quantity is 12-15.Two fairly obvious main peaks are wherein arranged, and the retention time of one of characteristic peak is 6.805-7.493, and three batches of relative percentage compositions are respectively 15.89%, 16.16%, 16.27%, 16.56%, 17.56, i.e. 15.89-17.56; And the average of another characteristic peak retention time is 7.722-8.824, and three batches of relative percentage compositions are respectively 18.68%, 19.27%, 19.61%, 19.19%, 19.98%, i.e. 18.68-19.19.

Its result is as follows:

Project 980,905 980,906 980,907 980,908 980908

Retention time RT ₁6.805 7.153 7.163 7.163 7.493

Relative percentage composition I% 15.89 16.16 16.27 16.56 17.54

Retention time RT ₂7.722 8.111 8.117 8.118 8.824

Relative percentage composition II% 18.68 19.27 19.61 19.19 19.98

Embodiment 12. and Uropoly acid-peptide composition solution exsomatizes to the HL-60 cell and growth inhibited effect and induction of differentiation in the body experiment.

1. be subjected to the reagent thing: Uropoly acid-peptide composition solution is produced by our company lot number 970813, vial plug aluminium lid sterile packaged, every bottle of 100ml, solid content: 200mg/ml is provided

2. animal

Mice is a Kunming kind closed colony, and body weight 18-22g is all femalely, is provided by Chinese Academy of Sciences's Shanghai Experimental Animal Center.The quality certification number: the moving pipe of middle section can 005.Each treated animal number is 8, and health was raised 7 in advance.

3. feeding and management condition

Group support, 5 in every cage, fan is opened in indoor temperature, humidity, illumination and naturally ventilated in case of necessity.The abundance of freely ingesting supplies water.Observed for 1 week before the experiment and write down corresponding situation.

4. tumor cell line

People's acute promyelocytic leukemia cell (HL-60) is by the cultivation of going down to posterity of Shanghai medicine institute of Chinese Academy of Sciences oncology pharmacology group.

5. reagent

Retinoic acid (RA) Rui Jin, Shanghai hospital provides lot number 961109.

Cyclophosphamide Shanghai No.12 Pharmaceutical Factory produces, lot number 960706.

Thrombin, Fibrinogen, RPMI-1640, NBT, PMA are all available from Sigma company.

6. Uropoly acid-peptide composition solution exsomatizes to the HL-60 cell growth inhibition

6.1 test method and step

Platform expects that blue row dyes method: be used to observe the growth inhibited situation of pair cell, blank is established in test, preparation contrast, medication group and positive controls.

The cell of taking the logarithm and growing, counting, with RPMI-1640 training liquid preparation cell suspension, cell number is 2.0 * 10 ⁵/ ml, Cell sap add 96 orifice plates, place 37 ℃, CO ₂Incubator, drug effect 6 days adds platform and expects blue living cell counting number, calculates the suppression ratio of medicine to growth of tumour cell.

As evaluation criterion, computational methods are as follows with suppression ratio:

Suppression ratio=(matched group viable count-medication group viable count)/matched group viable count * 100%

6.2 result of the test

At first observe the Uropoly acid-peptide composition solution effects in the time of 6 days, to the effect of HL-60 cell inhibiting (being the dose-effect relationship test), totally three batches of tests, the result closes and lists in table 7.Wherein a collection of result makes accompanying drawing 31.Uropoly acid-peptide composition solution of the present invention as can be known has the direct growth inhibitory action to the HL-60 cell of In vitro culture.Behind the drug effect cell 6 days, its IC ₅₀Be 0.18mg/ml.

Table 7 variable concentrations Uropoly acid-peptide composition solution is to 1 batch 2 batches 3 batches of the inhibitory action group drug level of HL-60 cell growth

(mg/ml) viable count suppression ratio (%) viable count suppression ratio (%) viable count suppression ratio (%) contrast 62 ± 10 0 93 ± 50 54 ± 60 pharmaceutical compositions of the present invention 0.05 53 ± 8 15* 93 ± 30 61 ± 50

0.1 38±6 38* 62±4 33 53±4 2

0.5 27±2 56* 26±1 72* 18±2 66*

1.0 7±1 89* 4±2 96* 8±2 85*

1.5 1±0 98* 1±0 99* 0 100*

2 0 99* 0 100* 0 100*RA 1# 15±2 76* 2±1 97* 5±1 91*

#?μg/ml，*?P＜0.01

With the Uropoly acid-peptide composition solution of 1.2mg/ml, carried out the processing different number of days and dynamic observed the HL-60 cell growth curve is inhibiting again, every day, the counting cells number the results are shown in Table 8 and accompanying drawing 32.Cellular control unit is linear growth as can be known, and the growth of medication group cell is suppressed, and to postvaccinal the 6th day, cell number was still close when medication group cell and inoculation.

The inhibition situation that table 8 Uropoly acid-peptide composition function cells is not grown to the HL-60 cell on the same day

Cell number (* 10 ⁴/ ml)

Natural law matched group Uropoly acid-peptide combination of the present invention (1.2mg/ml) behind the drug effect

0 1.5 1.5

1 3±0.6 1±0.5

2 7±1 1±0.5

3 12±1 1±0.5

4 28±4 2±1

5 61±3 2±0

6 85±3 4±0.5

6.3 conclusion (of pressure testing)

The experiment in vitro result shows that Uropoly acid-peptide composition solution of the present invention has the effect of obvious inhibition to the HL-60 cell, and dose-effect relationship is arranged.Drug effect 6 days, when concentration during greater than 2mg/ml, cell is all dead, and it is to the IC of HL-60 cell ₅₀Be 0.18mg/ml, and can make the HL-60 cell growth curve obviously be suppressed (curve flattens).

7. Uropoly acid-peptide composition solution solution of the present invention is to HL-60 cell induction differentiation

7.1 test method and step

7.1.1 NBT reduction reaction: drug effect cell 7 days, obtained cell suspension, with the speed centrifugalize of 1000rpm, collecting cell is abandoned supernatant, wash 1 time with PBS, add the NBT working solution that contains TPA, 37 ℃ are incubated 45 minutes, centrifugal 1000rpm collecting cell, microscopy, microscopically is observed 200 cells, bluish violet person is arranged for NBT reduction positive cell in the endochylema, calculates NBT reacting positive percentage of cells.

7.1.2 the observation of morphological change: drug effect cell 7 days, obtained cell suspension, centrifugal 1000rpm collecting cell is abandoned supernatant, cell is applied on the microscope slide, dries, and fixes 3 minutes with methanol, the buffer flushing is dried, and cellular morphology is examined under a microscope in Giemsa dyeing.Count 200 cells, calculate mature cell percent.

7.2 result of the test

The observed result of NBT reduction reaction and morphocytology is comprehensively listed in table 9.As can be known: 1. drug effect HL-60 cell is 7 days, and cell NBT reduction reaction positive percentage increases, have greater than 50% cell in, children's grain direction differentiation in evening, comparing difference with matched group has highly significant meaning (P＜0.01) statistically.The differentiation rate of not medication group is less than 3%.2. medication component changes into ripe cell percentage also apparently higher than matched group (P＜0.01).3. the respective value of RA group illustrates that also all apparently higher than matched group (P＜0.01) this test method is effectively reliable.

Microscopically cellular morphology observed result is listed in accompanying drawing 33-35.

The induction of differentiation of table 9 Uropoly acid-peptide composition interaction in vitro HL-60 cell after 7 days

Group concentration NBT positive cell differentiation and maturation cell

Number/200 % number/200 %

Contrast＜3＜3

Medicine of the present invention

Compositions 1.2mg/ml 93 ± 9 47 115 ± 9 58

RA 1.0μg/ml 159±17 80 176±3 88

7.3 conclusion (of pressure testing)

In vitro tests shows that Uropoly acid-peptide composition solution of the present invention has the growth inhibited effect to the HL-60 cell when 1.2mg/ml, under this drug level effect, the HL-60 cell culture after 7 days NBT reduction reaction positive cell increase, there is the cellular morphology more than 50% to change, nucleus dwindles, secundly, the caryoplasm ratio reduces, and kidney type nuclear occurs.Showed cell is by the ripe direction differentiation of children's grain towards evening children grain early.

8. Uropoly acid-peptide composition solution is tested people's acute promyelocytic leukemia cell (HL-60) growth inhibited and induction of differentiation at body

8.1 test method and step

8.1.1 test method

Inocalation method under the mice scrotum is selected in vivo test for use.

8.1.2 test procedure

The take the logarithm HL-60 cell of trophophase of the preparation of fibrin clot, the centrifugal 5min of 1000 * g/min concentrates volume to 1ml, wherein contains cell 4 * 10 ⁷Individual.Priority adds fibrin and the thrombin working solution makes it to form cell clot, in training liquid it is cut into the equal-volume fritter and is used for transplanting.

The kunming mice of 25-28g is selected in inoculation for use, and inoculation intraperitoneal injection of cyclophosphamide the previous day (150mg/kg) is to suppress its organism immune response.During transplanting grumeleuse is inserted under the mice scrotum film.

8.1.3 grouping and dosage setting

Animal random packet before the administration, every treated animal number is 8.Uropoly acid-peptide composition solution solution of the present invention establishes 320,640, three dosage groups of 1280mg/kg, and the various dose group is diluted to desired concn with normal saline, and positive controls is the tumor inducing differentiation agent of using clinically at present with retinoic acid (RA), RA.The matched group normal saline.

8.1.4 medication

Be intraperitoneal injection.Uropoly acid-peptide composition solution solution of the present invention was in inoculation back administration next day, continuous 7 days.Blank is given normal saline.

8.1.5 therapeutic evaluation

Put to death animal on the 8th day, and under anatomical lens, measured the tumor line of apsides to connect the order micrometer.

Gross tumor volume=major diameter * minor axis * minor axis/2.

Tumour inhibiting rate=(matched group tumor volume-medication group tumor volume)/matched group tumor volume * 100%.

8.1.6 morphologic observation

The mice with tumor kidney is fixing in 10% formaldehyde, use paraffin embedding, section, HE dyeing, microscopically is observed metamorphosis.

8.2 result of the test

The statistical disposition of data is calculated ED with t-check and Logit method ₅₀, all handle with " pharmacology calculates and statistical procedure " software.

Each is organized result of the test and lists in table 10 (comprising totally three batches of repeated trials) and accompanying drawing 36.As seen its tumour inhibiting rate of increase with Uropoly acid-peptide composition solution solution dosage of the present invention also therefore rises.To first result, Logit method calculating Uropoly acid-peptide composition solution solution of the present invention is 87mg/kg to the ED50 of mouse-borne tumor.Two, three batches of result value are higher.T-check shows that the tumour inhibiting rate of each dosage group compares with matched group that all there were significant differences.Medicine is similar to positive controls RA tumour inhibiting rate at the tumour inhibiting rate of middle dosage during with high dose, and mice body weight hair color does not all have obvious bad variation after the administration.

Table 10 various dose Uropoly acid-peptide composition of the present invention finishes body weight tumor volume (mm to HL-60 cell growth inhibition group concentration (mg/kg) beginning body weight under the mice scrotum ³) suppression ratio (%) normal saline 26 ± 2 25 ± 2 2.96 ± 2.09 pharmaceutical composition 320 26 of the present invention ± 2 24 ± 2 1.25 ± 1.0 57.8

640 26±2 23±2 1.01±0.51 65.9**

1,280 26 ± 2 24 ± 2 0.98 ± 0.46 66.9**RA 11 26 ± 2 24 ± 2 1.09 ± 0.39 63.2* normal saline 27 ± 2 27 ± 2 8.29 ± 5.65 pharmaceutical composition 320 27 of the present invention ± 2 26 ± 2 4.37 ± 1.27 47.6

640 27±2 27±2 2.82±2.09 66.0**

1,280 27 ± 2 27 ± 2 3.12 ± 2.42 62.4**RA 11 27 ± 2 27 ± 2 3.62 ± 2.23 56.3* normal saline 26 ± 2 25 ± 2 9.04 ± 4.30 pharmaceutical composition 320 26 of the present invention ± 2 27 ± 2 6.46 ± 2.24 28.5

640 26±2 27±2 3.25±1.86 64.0**

1280 26±2 26±2 3.68±3.45 59.2**RA 11 26±2 23±2 3.25±1.34 64.0**?P＜0.05，**?P＜0.01

Each is organized the morphology microphotograph of the HL-60 cell of growth under the scrotum film and sees accompanying drawing 37-39.

8.3 conclusion (of pressure testing)

Show by in vivo test, growth has the obvious suppression effect to Uropoly acid-peptide composition solution of the present invention to the HL-60 cell, dosage is when 640mg/kg about inhibitory rate to 66%, three times the repeated trials result shows, its tumour inhibiting rate still maintains this level after strengthening dosage, has shown the non-lethal characteristics of differentiating inducer.

Present intravital induction test model is few, we adopt in the world, and mature methods is the following inoculation of the scrotum film analytic process of Fimgert, the human body tumour cell of In vitro culture is inoculated under immunosuppressant kunming mice scrotum film, medication is after fixing, section, HE dyeing, microscopy observation of cell form.Found that Uropoly acid-peptide composition solution of the present invention presents tangible differentiating phenomenon on the HL-60 cellular morphology when 640-1280mg/ml, occur a large amount of middle late children's grains and mature cell in the tumor tissue, its differentiation degree is more obvious when 1280ml/kg.

Embodiment 13. anti-people's primary hepatocyte hepatocarcinoma growth of Uropoly acid-peptide composition solution and the effect of shifting

1. be subjected to the reagent thing: the injection Uropoly acid-peptide composition is produced by our company and is provided.Close and defend medicine and criticize lot number 980701, solid content 200mg/ml, every bottle of 100ml (95) No. 003.

2. animal subject

Nude mouse strain: SPF level, BALB/C nude mouse.Provide by laboratory animal portion of Shanghai Pharmaceutical Inst., Chinese Academy of Sciences (Shanghai City management of laboratory animal committee approval is also issued unit with the quality certification).The quality certification number: Shanghai is moving closes the card word No. 122.Body weight 18-22 gram, every treated animal number is 8.

3. cell strain

LCI-D20 human primary liver cancer's high metastasis model is set up by Shanghai Medical Univ's liver cancer research.This hepatocarcinoma can grow and have intraperitoneal and lung to shift under Glisson's capsule fast behind the in-situ inoculating, the rate of transform can reach 100%.

Bel7402 MHCC97 is set up by Shanghai Medical Univ's liver cancer research.This cell and LCI-D20 human primary liver cancer's high metastasis model homology has high transfer characteristic.

4. in the inhibitory action of body injection Uropoly acid-peptide composition to growth of people's primary hepatocyte hepatocarcinoma and transfer

4.1 experimental technique

4.1.1 the high preparation of shifting nude mice model of LCI-D20 human primary liver cancer

The high metastatic tumor piece of LCI-D20 human primary liver cancer is cut into 1mm under aseptic condition ³Size is standby.The pre-raising after 7 days of nude mice performed a surgical operation.Nude mice anesthesia back routine disinfection is opened the abdominal cavity, with the capable peplos setting of casing inoculation of tumor piece, closes abdomen and animal is put back to raising, observes.Postoperative does not have infection, and wound healing is good.Postoperative continues to feed 10 days, beginning administration in the 11st day, continuous 20 days.

4.1.2 the experiment grouping is given and dosage regimen

Matched group: normal saline

Low dose group (L): injection Uropoly acid-peptide composition 600mg/kg.

Middle dosage group (M): injection Uropoly acid-peptide composition 1200mg/kg.

High dose group (H): injection Uropoly acid-peptide composition 1800mg/kg.

Because the high nude mice pair cell differentiation agent tretinoin (RA) and insensitive that shifts of LCI-D20 human primary liver cancer, no sure curative effect is not so positive controls is established in this experiment.

4.1.3 experimental technique and observation index

Medicine is lumbar injection.Model mouse continued to feed 10 days after surgery, beginning administration in the 11st day, continuous 20 days.Located animal on the 21st day, and cut open the belly and observe the situation of tumor growth and abdominal cavity transfer.

Tumor is weighed and is calculated tumour inhibiting rate with following formula;

Tumor control rate (%)=(1-T/C) * 100

T is that the average tumor of administration group is heavy in the formula: C is that the average tumor of matched group is heavy.

The hepatoma Metastasis observation index: the perusal belly cavity tumor send out tuberosity, multiple nodules and the situation that extensively shifts.

4.2 experimental result

4.2.1 the injection Uropoly acid-peptide composition the results are shown in Table 11 to the high inhibitory action that shifts hepatocarcinoma LCI-D20 growth of people's transplantability.Injection Uropoly acid-peptide composition 3 dosage all have inhibitory action to the growth of tumor as can be known.

Table 11 injection Uropoly acid-peptide composition begins the heavy tumor control rate of body weight final weight knurl (%) contrast 8 22.8 ± 1.6 24.5 ± 1.5 2.5 ± 0.75 0.0 injection Uropoly acid-peptide pharmaceutical composition L 600 8 22.3 ± 0.6 25.4 ± 1.8 1.4 ± 0.31 42.77* to the high inhibitory action group mg/kg n that shifts liver cancer LCI-D20 growth of people's transplantability

M 1200 8 22.5±0.9 25.3±1.5 1.4±0.17 43.21**

H 1800 8 24.0±1.9 25.7±1.9 1.5±0.37 41.54**

* P＜0.05, Student t-test statistical disposition is pressed in * * P＜0.01

The high influence of shifting the transfer of hepatocarcinoma LCI-D20 abdominal cavity the results are shown in Table 12 4.2.2 the injection Uropoly acid-peptide composition is to people's transplantability.Shift in the abdominal cavity that shows injection Uropoly acid-peptide composition treatment can significantly reducing transplanted hepatoma.Each group of treatment is all found extensively to shift wherein especially evident in efficacy with the H group.

Table 12 injection Uropoly acid-peptide composition does not have to shift and sends out the tuberosity multiple nodules and extensively shift the high group mg/kg n that influences that shifts that hepatocarcinoma LCI-D20 abdominal cavity shifts of people's transplantability

(every Mus mean) contrast 802 (2.5) 33 injection Uropoly acid-peptide pharmaceutical composition L 600 813 (2.3) 40

M 1200 8 2 4(2.0) 2 0

H 1800 8 6 1(1.0) 1 0

5. the injection Uropoly acid-peptide composition is to the influence of expression of proto-oncogenes in the liver cancer tissue

5.1 experiment material and method

5.1.1 the experiment material liver cancer tissue is taken from matched group and the injection Uropoly acid-peptide composition is handled each group.Tissue places-80 ℃ of preservations standby.TRIzol is available from GIBOCO company.The AMV reverse transcriptase, Taq archaeal dna polymerase, Rnasin, dNTP, Oligo (dT) ₁₅Available from PROMAGA company.The PCR primer is synthetic in Canada by Shanghai match Parkson corporate agent.Primer sequence is as follows:

Gene PCR primer (5 '-3 ') expanding fragment length (bp)

c-myc TTCAGCTTGTACCTGCAGGATCTGA 338

CCTCCAGCAGAAGGTGATCCAGACT

N-ras GACTGAGTACAAACTGGTGGTGG 221

GATGTACTGGTCCCTCATGGCA/GCTG

c-fos GCAGACTACGAGGCCGTCATC 542

TTCAGCAGGTTGGCAATCTC

c-jun ATGACTGCAAAGATGGAAACGACC 264

GATGTGCCCGTTGCTGGACTGGAT

β-actin(1) CTTCCTTCCTGGGCATGGAG 315

TGGAGGGGCCGGACTCGTCA

β-actin(2) ATGGGTCAGAAGGACTCCTAC 450

ACGCTCGGTCAGGATCTTCAT

5.1.2 RNA extracts this experiment and adopts the TRIzol one-step method.Add 1ml TRIzol liquid after the homogenate of 50mg hepatocarcinoma, the concussion mixing, room temperature was placed 5-10 minute.Add the 0.2ml chloroform, put upside down mixing, placed on ice 5 minutes, 12000rpm, 4 ℃ are centrifugal 15 minutes.Get about 0.6ml supernatant liquid, add the 0.5ml isopropyl alcohol, room temperature was placed 30 minutes, 12000rpm, and 4 ℃ are centrifugal 10 minutes.Supernatant discarded is washed twice with 75% ethanol of pre-cooling.It is dried to evaporate into to abandon the rearmounted room temperature of ethanol 20 minutes.The DNA of the purification of every pipe is kept at-70 ℃ with the water dissolution that 50 μ l DEPC handle.

5.1.3 reverse transcription reaction (Reverse Transcription, RT) 10 μ l RNA samples add 5X reverse transcription buffer 10 μ l respectively 70 ℃ of degeneration 10 minutes, 2.5mM dNTPs, 12 μ l; AMV reverse transcriptase 20U, RNasin 50U, Oligo (dT) ₁₅200ng; Supply volume to 50 μ l with DEPC water.42 ℃ of incubations 1 hour, 95 ℃ of degeneration 10 minutes.

5.1.4 (Polymerase Chain Reaction PCR) gets reverse transcription reaction thing (cDNA) respectively and is used for the PCR reaction polymerase chain reaction,PCR.Its system is: reverse transcription reaction thing, 5 μ l; The 10xPCR buffer, 5 μ l; On, each 20pmol of downstream primer; The Taq archaeal dna polymerase, 5U; 2.5mM dNTPs, 2 μ l; 15mM Mgcl ₂5 μ l, last water is supplied volume to 50 μ l.Reaction condition is: 95 ℃, and 1 minute; 60 ℃, 1 minute; 72 ℃, 1.5 minutes.Totally 35 circulations; 72 ℃ were extended 10 minutes down then.The PCR product is through 2% agarose (containing the bromination second pyridine of 0.5 μ g/ml) electrophoresis, electrophoresis pattern by VDS gel images analytical system scanning analysis must measure band integral optical density (IntegratedOptical Density, IOD).

5.1.5 calculate and add up this experiment with β-actin as inner reference standard.

Gene relative expression value=IOD _{Measure band}/ IOD _β-actin

Student t-test is a statistical method.

5.2 result of the test

5.2.1 the injection Uropoly acid-peptide composition is to the high influence of shifting expression of proto-oncogenes in the hepatocarcinoma LCI-D20 tissue of transplantability

The results are shown in Table 13 and Figure 40.Studies show that high dose injection Uropoly acid-peptide composition (H group organize with H+CT) is to proto-oncogene c-myc in the above-mentioned liver cancer tissue; N-ras; The expression of c-jun and c-fos has tangible downward modulation effect.The injection Uropoly acid-peptide composition only can reduce the expression of N-ras to middle dosage (M group), and low dosage injection Uropoly acid-peptide composition (L group) is to the no effect of expression of the mRNA of said gene. table 13 injection Uropoly acid-peptide composition is to high downward modulation effect group c-myc N-ras c-fos c-jun contrast 1.99 ± 0.90 2.12 ± 0.52 1.46 ± 0.55 1.07 ± 0.19 injection Uropoly acid-peptide pharmaceutical composition L 1.89 ± 0.70 2.36 ± 0.26 1.07 ± 0.15 1.56 ± 0.21 that shift expression of proto-oncogenes in the liver cancer LCI-D20 tissue of people's transplantability

M 2.11±0.85 1.56±0.46* 0.61±0.32 0.85±0.37

H 0.67±0.38** 0.81±0.31** 0.54±0.41** 0.26±0.19**

5-FU 1.06±0.50* 0.79±0.12** 0.88±0.35** 0.51±0.19**

This table data are gene relative expression value, * P＜0.05, and * * P＜0.01 is compared with matched group

6. the injection Uropoly acid-peptide composition is to liver cancer tissue matrix metalloproteinase 9 (Matrix Metalproteinase-9, MMP-9) adjusting of gene expression

6.1 material and method

The same B-1-1 of the method for RT-PCR.

The forward primer 5 ' of MMP-9-TGGCCGGCCACTGTGCGCCCCTCCGAG-3 '.Downstream primer 5 '-CACTAGGTTCACCTTCGTTCCGGGTACT-3 '.Expanding fragment length is 633bp.94 ℃ of PCR reaction conditions, 1min; 55 ℃, 1min; 72 ℃, 1min; Totally 40 circulations, 72 ℃ are extended 5min.

6.2 result

The results are shown in Table MMP-9 item and Figure 41 of 14.MMP-9 is a discovered in recent years, and (Extracellular Matrix, ability ECM) is relevant, is one of objective indicator of reflection tumor invasion and transfer ability with tumor cell hydrolysis extracellular matrix.The injection Uropoly acid-peptide composition can be reduced the transcribing of mRNA of this gene effectively.Studies show that, in the dosage range that this institute adopts, be certain dosage effect.And synergy is arranged with 5-FU (5-fluorouracil Shanghai Xudong Hipu Medicine Co., Ltd, the accurate word (1995) of medicine is defended No. 013013 in Shanghai, lot number 980704, preparation 0.5g/10ml).

Table 14 injection Uropoly acid-peptide composition is to the inhibitory action of MMP-9 genetic transcription; The treatment of injection Uropoly acid-peptide composition contrasts 8 2.37 ± 0.73 524.6 ± 210.3 281.6 ± 127.9 injection Uropoly acid-peptide pharmaceutical composition L 600 8 2.07 ± 0.31 393.9 ± 165.1 333.5 ± 179.8 to integrin beta 1 subunit of liver cancer tissue and the effect group mg/kg n MMP-9 integrin beta 1 E-cadherins of E-cadherins content

M 1200 8 1.31±0.44* 306.0±88.1* 365.64±234.3

H 1800 8 0.78±0.36** 322.9±96.3* 393.10±122.8*

5-FU+H 20+1800 8 0.58±0.28** 303.4±109.7* 597.60±323.2**

Compare * P＜0.05 with the C group; * P＜0.01.

Data are with the expression of integral optical density Mass/g tissue.

7. the injection Uropoly acid-peptide composition is to integrating the influence that plain β 1 subunit and E-cadherins are expressed

7.1 material and method

The collection of material liver cancer tissue is the same.Anti-plain β 1 subunit monoclonal antibody of integration (Anti-human Integrin β 1mAb) is looked into stannum by biochemistry teaching and research group of preclinical medicine institute of Shanghai Medical Univ and is very taught present.Anti-E-cadherins antibody (Anti-human E-Cadherin mAb) is available from Santa-Crus company.The HRP-sheep anti-mouse igg, magnificent company.Other reagent are analytical pure.

Add lysate RIPA1ml behind the Western blotting samples weighing, ice bath was placed 10 minutes.4 ℃ of following 500rpm centrifugal 15 minutes then, get supernatant.To make SDS polyacrylate hydrogel electrophoresis (SDS-PAGE) behind the sample on the sample liquid of handling.Electrophoresis places half dry type electrotransfer instrument with gel after finishing, from gel, directly protein transduction is moved on the pvdf membrane, add first antibody with envelope film in the confining liquid that contains 3%BSA after two hours then, 4 ℃ are spent the night, washing two of back adding HRP labelling in second day routinely resists, behind the incubation two hours, develop the color with DAB.Pvdf membrane after the colour developing is dried.Under the VDS image analysis system, scan sxemiquantitative, get the IOD value of band.Gel is then made coomassie brilliant blue staining to understand the situation of electrotransfer.

Spot immune trace (Dot Immunoblotting) is placed on pvdf membrane in the methanol earlier and soaks into (about 3 minutes), after floating 3 times with deionized water, wash film twice with 0.02M PBS, film is placed in the electric hybridization instrument then, but after the formation negative pressure, every hole adds sample stock solution 10 μ l. (sample disposal is with the Western blotting).Specimen is all made the double point sample, behind the point sample film is added first antibody with envelope film in the confining liquid that contains 3%BSA after two hours, and 4 ℃ are spent the night, second day routinely washing back add the two anti-of HRP labelling, incubation developed the color with DAB after two hours.Pvdf membrane after the colour developing is dried.Under the VDS image analysis system, scan sxemiquantitative, get the Mass value of speckle.

The result represents to represent with IOD or Mass/g liver cancer tissue.

7.2 result

Tumor often has the change of adhesion molecule expression in growth and transfer process.Integrating plain β 1 subunit (Integrin β 1 subunit) is the important special-shaped adhesion molecule of a class, and the adhesion between the mediation heterogenous cell participates in the information conduction of cell.And E-cadherins (E-Cadherin) the important homotype adhesion molecule that also is a class participates in the adhesion between allogenic cell; The E-cadherins of original position kitchen range is expressed and is had tangible minimizing during neoplasm metastasis.The result shows: compares with matched group (C group), and after the treatment of injection Uropoly acid-peptide composition, the M group, the H group, the decline of the plain β 1 subunit amount of integration of H+CT group has statistical significance.And the rising significance of the content of the E-cadherins of H group and H+CT group.See Table continuous item and Figure 42 of 14.

8. use immunohistochemistry and detect the influence of injection Uropoly acid-peptide composition treatment the E-cadherins and the proliferative cell nuclear antigen Ki 67 of liver cancer tissue

8.1. material and method

The anti-people's proliferative cell of material nuclear antigen Ki 67 antibody are available from magnificent company.All the other reagent are with above-mentioned part.

Method

1) after the fresh HCC specimen was used methylcellulose (OCT) embedding, preparation 8 μ frozen sections are at room temperature fixed 10 minutes with acetone then on cryostat, and were standby.

2) section is with flush away after normal sheep serum sealing half an hour.Add E-cadherins or Ki 67 working solutions (1: 50) respectively, place 4 ℃ to spend the night.

3) anti-with PBS liquid flush away one, totally three times, go to organize buffer (as follows) on every side with the filter paper suction, add biotinylation two anti-(anti-sheep or anti-Mus IgG) again, at room temperature incubation is one hour.Add three anti-(A+B mixture) after reuse PBS flush away two resists, incubation is one hour under the room temperature, uses the PBS flush away then.

4) DAB solution (0.5mg/ml) adds 3%H ₂O ₂Drop in section behind the 5-10 μ l mixing and go up dyeing.Wet sheet sees at microscopically and brown yellow granule occurs, then flush away DAB liquid.Section is with haematoxylin redyeing, dehydration mounting microscopy.

5) criterion

E-cadherins brown yellow granule be positioned endochylema and/the positive cell of cancerous cell of after birth.Positive cell accounts for the percentage ratio of tumor cell sum :≤5% for+; ≤ 20% is ++;＞20% is +++.

Ki 67 brown yellow granules are positioned the positive cell of cancerous cell of karyon.Positive cell accounts for the percentage ratio of tumor cell sum :≤5% for+; ≤ 20% is ++;＞20% is +++.

8.2 result

8.2.1 the immunohistochemistry that the injection Uropoly acid-peptide composition is expressed E-cadherins in the LCI-D20 liver cancer tissue detects

The results are shown in Table 15, show that the injection Uropoly acid-peptide composition can increase the expression of E-cadherins in the tissue.Compare with matched group, the positive rate of each group of treatment increases.Wherein increase the most remarkable with the M group.

The semi-quantitative results group mg/kg n E-cadherins Ki 67 that table 15 immunohistochemical method detects E-cadherins, Ki 67 in the liver cancer tissue

+ ++ ++++ ++ +++contrast 8530440 injection Uropoly acid-peptide pharmaceutical composition L 600 8161350

M 1200 8 1 2 5 1 6 1

H 1800 8 1 6 1 4 4 0

8.2.2 the injection Uropoly acid-peptide composition detects the immunohistochemistry that Ki in the LCI-D20 liver cancer tissue 67 expresses

Result's demonstration sees Table 15 right sides, and the injection Uropoly acid-peptide composition of various dosage is handled does not have tangible the influence to Ki67 expression in the LCI-D20 liver cancer tissue.

9. the injection Uropoly acid-peptide composition is to the influence of high-transfer human liver cancer cell strain MHCC 97 adhesions, infiltration and travelling performance

9.1 the injection Uropoly acid-peptide composition is to the influence of high-transfer human liver cancer cell strain MHCC97 adhesion property

9.1.1 material and method

1) the fibronectin bag is diluted to 10ng/ml with 1mg/ml fibronectin (Fibronectin, Sigma company) with 0.01mol/L PBS by the preparation of plate.Washing the back with the DMEM culture fluid of serum-free allocates to 5 * 10 with the DMEM culture fluid of serum-free ³Cell/50 μ l.By 96 hole ELISA Plate, 37 ℃, 4 ℃ are spent the night behind 2 hours incubations with every hole 100 μ l bag.Wash plate with PBS next day, reuse 0.1%BSA (Sigma company) sealing, 37 ℃, 2 hours.It is stand-by to wash the back with PBS.

2) cell preparation 0.25% pancreatin; The 0.02%EDTA peptic cell, and wash the back with the DMEM culture fluid of serum-free and allocate to 5 * 10 with the DMEM culture fluid of serum-free ³Cell 50 μ l.

3) adhere to experiment and add the human liver cancer cell MHCC97 that has handled, 5 * 10 on by plate at the fibronectin bag ³Cells/well.Control wells adds 50 μ l PBS; Experimental port adds the injection Uropoly acid-peptide composition to the concentration of setting.Every hole cumulative volume is 100 μ l.37 ℃, 5%CO ₂Hatched the soft not adherent cell of flush away 4 hours.Every hole is fixed 30 minutes with 100 μ l, 10% neutral formalin, 5% violet staining 10 minutes.SLT 210 microplate reader are measured optical density, and wavelength is 595nm.

4) grouping

Matched group 50 μ l DMEM (contain 5 * 10 ³Cell)+50 μ l PBS

Injection Uropoly acid-peptide composition experimental group

The 10mg/ml group: 50 μ l DMEM (contain 5 * 10 ³Cell)+25 μ l injection Uropoly acid-peptide composition+25 μ l PBS

The 15mg/ml group: 50 μ l DMEM (contain 5 * 10 ³Cell)+37.5 μ l injection Uropoly acid-peptide composition+12.5 μ l PBS

The 20mg/ml group: 50 μ l DMEM (contain 5 * 10 ³Cell)+50 μ l injection Uropoly acid-peptide composition

9.1.2 result

The results are shown in table 16.This experiment is carried out 6 times altogether, and it comes to the same thing, the trend unanimity.Except that 10mg/ml injection Uropoly acid-peptide composition does not have the significant difference compared with the control, 15mg/ml and 20mg/ml injection Uropoly acid-peptide composition have significant difference (P＜0.05) to the MHCC97 high-transfer cell strain compared with the control to the adhesion inhibition effect of fibronectin.

Table 16 injection Uropoly acid-peptide composition influences group mg/ml OD to high-transfer human liver cancer cell strain MHCC97 adhesion property ₅₉₅X ± s F check: contrast 0.152 0.171 0.161 0.142 0.160 0.139 0.154 ± 0.012 injection Uropoly acid-peptide pharmaceutical composition, 10 0.142 0.137 0.168 0.134 0.142 0.135 0.143 ± 0.013 P＞0.05

15 0.091 0.096 0.062 0.109 0.098 0.070 0.088±0.018 P＜0.05

20 0.078 0.063 0.047 0.077 0.057 0.047 0.062±0.014 P＜0.05

The result of variance analysis (F check) is compared in p＜0.0001, injection Uropoly acid-peptide composition integral body with matched group

9.2 the injection Uropoly acid-peptide composition exsomatizes to the high inhibitory action that shifts hepatoma cell strain protease of MHCC97 people to influence, the injection Uropoly acid-peptide composition of high-transfer human liver cancer cell strain MHCC97 wetting property

9.2.1 material and method

With 0.05mol/L TBS liquid (Tris-HCl, pH 7.6; 0.17mol/L NaCl, 0.02mol/L CaCl ₂) preparation 2% agarose, autoclave sterilization is when being cooled to 37 ℃ and the type i collagen of preheating (Collagen Type I Solution, 3mg/ml, Japanese Wako Pure Chemical Industries, Ltd.) by after the mixing in 1: 1, join 24 well culture plates, every hole 800 μ l, 4 ℃ condense and spend the night.Inferior daily puncher punching adds MHCC 97 cells of handling well respectively in the different holes then, and every hole 20 μ l (contain 1 * 10 ⁴Cell).Every group 3 hole.The careful DMEM training liquid that adds serum-free.37 ℃, hatched in 24 hours.The careful gel film that takes out behind the normal saline thorough washing, is dipped in 0.1% Coomassie brilliant blue R, 250 solution (with the preparation of 45% methanol-10% glacial acetic acid), and dyeing is 30 minutes under the room temperature, moves in 45% methanol-10% glacial acetic acid solution and decolours, and takes pictures.

Cell preparation is the same.Injection Uropoly acid-peptide composition concentration is set to 1.25mg/ml, 2.5mg/ml and 5.0mg/ml.

9.2.2 result

The results are shown in Table 14 and accompanying drawing 43.In the matched group, because the MHCC97 cell has the ability of secretion collagenase and gelatinase, the pair cell epimatrix has the ability of strong degraded as collagen protein.So in this experiment, extracellular collagen protein major part is degraded, so Coomassie brilliant blue R 250 does not dye or less dyeing.Compare with matched group, the injection Uropoly acid-peptide composition of 1.25mg/ml is handled the inhibition that does not show collagenase; And the injection Uropoly acid-peptide composition of 2.5mg/ml presents the inhibition to collagenase; 5.0mg/ml above injection Uropoly acid-peptide composition shows maximum inhibitory action.Illustrate that the injection Uropoly acid-peptide composition can suppress the wellability of MHCC97 cell.

9.3 the injection Uropoly acid-peptide composition is to the influence of high-transfer human liver cancer cell strain MHCC97 travelling performance

9.3.1 material and method

Prepare 0.7% agarose with 0.01mol/L PBS liquid, autoclave sterilization, cooling is added to 24 well culture plates slightly, every hole 2000 μ l, 4 ℃ condense and spend the night.Inferior daily puncher punching adds the MHCC97 cell of handling well respectively in the different holes every hole 20 μ l (containing 5000 cells) then.Every group 3 hole.The careful DMEM training liquid 1.5ml that contains 10% people AB type serum that adds.Inhale after 24 hours and remove to train liquid.Add again respectively and contain 0.625mg/ml, 1.25mg/ml, 2.5mg/ml, the DMEM training liquid (containing 10% people AB type serum) of 5mg/ml and 10mg/ml injection Uropoly acid-peptide composition.Every hole adds 1.5ml, every group 3 hole.Changed liquid once in per two days, cultivated altogether 5 days, the displacement of per 24 hours observation cells.

9.3.2 result

The cell that the removes 10mg/ml injection Uropoly acid-peptide composition degeneration necrosis that becomes, do not see that tangible cell outwards moves outside, all the other each groups are compared no significant difference with matched group: cell outwards all has and moves, and the difference not statistically significant of displacement.Embodiment 14. and injection Uropoly acid-peptide pharmaceutical composition isolated test is to the growth of human blood cell and the inhibition of telomerase activation

People's marrow blood cancerous cell (HL-60 cells) strain obtains from Changgeng Univ.'s medical college clinic study.Cell strain remains on (GIBCO, Long Island, New York) in the culture medium that is suspended in RPMI-1640, and comprising 10% cattle fetal blood, clear (HyClone, Ligan is UT) in 5% carbon dioxide and 95% air themperature, 37 ℃ incubator.

Purification comes out injection Uropoly acid-peptide pharmaceutical composition (also claiming differentiating inducer) from fresh Urina Hominis, can guide unusual methyl compound enzyme to be transformed into normal methyl compound enzyme.Injection Uropoly acid-peptide pharmaceutical composition is our company's sample.

The growth curve of blood cell have, no injection Uropoly acid-peptide pharmaceutical composition in the presence of the time construct in experiment.Total cell number is to calculate with hematimeter.Cell survival is decided by that staining cell expects blue dyeing counting with 0.25% tire, and the part of the cell that is not colored is as remaining part.The cellular morphology microscopic examination.The evaluation of differentiation situation is the change that does not have the viability and the cellular morphology of lost cell through the disappearance of observing energy for growth.

Cell extraction: the material solution [10mM Tris-hydrochloric acid (pH 7.5), 1mM magnesium chloride, 1mM EGT, 0.5%CHAPS, 10% glycerol (v/v)] of making CHAPS cell decomposition buffer is preserved in 4 ℃ of temperature.Add phenylmethanesulphonyl floride (PMSF) and mercaptoethanol before using, make final concentration be respectively 0.1 and 5mM.The extraction of cell be with cell suspension in the CHAPS buffer, cell number is 2 * 10 ³Cells/ml places ice to cultivate 30 minutes, then with 14,000g 4 ℃ centrifugal 30 minutes, supernatant moves into test tube as the telomerase activation test.Protein concentration is measured (Pierce) with Commassie protein test agent.

The test of telomerase: telomerase activation quantitatively be (TRAP) (Kim et al.1994) to be duplicated in telomere unit amplification with PCR method.The TS primer (5 '-AATCCGTCGAGCAGAGTT-3 ') and CX (primer (5 '-[CCCTAA] ₃CCCTAA-3 ') be synthetic with the dna synthesizer device (Model 380 B, Applied Biosystems) of ancient Chinese name for Venus centre.5 of TS primer '-terminal indicates with [γ-32P] ATP with the T4 polynucleotide kinase.TRAP's is quantitative, at first allow telomerase extend the TS primer, with 0.1 μ g TS primer, the 2.5mM dNTPs of 500nCi radioelement sign, 20mM Tris-hydrochloric acid (pH 8.2), 1.5mM magnesium chloride, 63mM potassium chloride, 0.005% Tween-20,1mM EGTA, 0.1mg/ml BSA, and the Tag DNA synzyme of 2 units.The RNase A that in reactant liquor, also adds 0.5 μ g.Behind the telomerase extension, the CX primer that adds 0.1 μ g carries out pcr amplification, altogether 30 cycles 94 ℃ 30 seconds, 55 ℃ 30 seconds, then 72 ℃ 1.5 minutes.The PCR product separates with gel electrophoresis 54mM boric acid, 1.2mM EDTA, and the DNA banding pattern shows with autoradiogram and SyBr dyeing.The dyeing photo is taken pictures under the 254nm irradiation under ultraviolet ray.As for telomerase activation quantitatively, the autoradiogram ImageQuaN of TRAP product ^Tm(Molecular Dynamics) makes the computer density scan.Each sample of handling compares relative density with the sample that does not have to handle after removing the buffer floors.

Result of the test:

1. injection Uropoly acid-peptide pharmaceutical composition is induced the inhibition of differentiation back to the blood cell breeding

Figure 50. the expression blood cell is grown up in no injection Uropoly acid-peptide pharmaceutical composition with the growth curve of 6 days blood cell of two kinds of injection Uropoly acid-peptide pharmaceutical composition dosage use.When dosage 2mg/ml, cell shows toxic reaction to injection Uropoly acid-peptide pharmaceutical composition, because viable cell promptly is reduced to 1 * 10 ⁴Under the level of cell/culture.More be reduced to the 4th day and the 6th day cell number and be less than a logarithmic level (Figure 51) that begins cell number.4 days times to the of 1mg/ml and the 5th day, compare showed cell with matched group and approximately reduce 90%.

2. the activated state of blood cell telomerase behind the injection Uropoly acid-peptide pharmaceutical composition induction

The past attempts showed cell extracts thing may be because of containing the quantitative values (Bnoccoli etal.1995) that some unknown factor can reduce TRAP.For correct quantitative we with different Cell sap concentration (0.01 to 3 μ g) to obtain the straight line amplitude of enzymatic activity.Figure 52 show blood cell the contrast with two injection Uropoly acid-peptide pharmaceutical composition dosage in the presence of relevant telomerase activation.During with the injection Uropoly acid-peptide pharmaceutical composition of 1mg/ml concentration, can see that very clearly the density of telomerase reduces, the complexity of PCR product and density are with incubation time successively decrease (Figure 52 C, D, E).When blood cell was cultivated with the injection Uropoly acid-peptide pharmaceutical composition of 2mg/ml, the telomerase activation both of the blood cell of survived 2 days and 4 days reduced to the degree (Figure 53 2F, G) that almost can not discover.Survived 2 days in we are not having injection Uropoly acid-peptide pharmaceutical composition to exist to blood cell same solution, the cell of 4 days and 6 days is tested and is found and at the telomerase activation similar (not pointing out data) of the blood cell of the 4th day and harvest in the 6th day.What this does not have basic different harvest in 2 days with blood cell shown in Figure 52 second row (B).The autoradiogram of PCR product grow in no injection Uropoly acid-peptide pharmaceutical composition (the 2nd day, B is capable) or injection Uropoly acid-peptide drug regimen substrate concentration when 1mg/ml (the 2nd day, C is capable; The 4th day, D was capable; The 6th day, E was capable) the external extraction thing of blood cell (HL-60 cells).Simultaneously with injection Uropoly acid-peptide drug regimen substrate concentration carry out when the 2mg/ml similar test (the 2nd day, F is capable; The 4th day, G was capable).A is capable, positive control (result takes from the telomerase test of acellular extraction thing).Blood cell (HL-60cells) the telomerase activation of the 4th day and harvest in the 6th day show with the 2nd day B capable (not have demonstration) the photo profile identical basically.

Above-mentioned result with autoradiogram quantitative PCR product is as can clearlyer represent the disappearance of telomerase activation when quantitative with the density device, and at the injection Uropoly acid-peptide pharmaceutical composition of 1mg/ml, the activity of telomerase is with incubation time successively decrease (Figure 53 first half).On the other hand, show in the activity of the telomerase of the cell of the 2nd day and harvest in the 4th day and acutely ease down to the degree (Figure 53 Lower Half) that to discover.The results are shown in the percentage rate (%) of the relevant density of curve representation among the figure.If it is 100% that per the 2nd, 4 or 6 day nothing is tried the density of the contrast of thing.The value number of density is to read film and change acquisition with the survey of density device from the autoradiogram of Fig. 3 test.Each activity of being tried example is to remove not have with the telomerase activation that is tried example to be subjected to examination contrast * 100%.

Discuss

One is repeated 5 ' TTAGGG3 ' order continuously is telomere (Harley, 1991 that occur in the eukaryotic chromosome two ends; Blackburn, 1992; De Lange, 1994; Morin, 1995; Kiplin, 1995; Rhyu, 1995).The function of telomere supposition comprises following several: (i) the protection end of chromosome is to prevent the effect of exonuclease and ligase; (ii) prevent the activity of DNA damage survey point; (Hartey 1992 (iii) to compensate the loss of DNA end when duplicating each time; Blackburn, 1992; De Lange, 1994; Kipling, 1995).The Hexanucleotide of telomere is facilitated (Blackburn, 1992) by this telomerase of ribonucleic acid nucleoprotein.There is the effect of many reported literature telomerase to relate to the eternal mitotic activity (Rhyu, 1995) of the aging and cancerous cell of cell.The activity of human cell's telomerase can be measured (Kim et al.1994) at fetus and adult's the testis and the follicle of ovary.But the activity of telomerase is surveyed (the Counter et al.1995 that do not come out at most human cell tissue; Kim et al.1994).The activity of relative telomerase is (the Kim et al.1995 that can be discovered in most tumor and eternal cultured cell; Taharaet al, 1995; Chadeneau et al.1995; Hiyama al.1995).

In this research, we have proved that injection Uropoly acid-peptide pharmaceutical composition is a kind of effective induction preparation, and it can suppress the activity of telomerase in the blood cell.These cellular exposure are produced inhibitory action (Figure 50) when the injection Uropoly acid-peptide pharmaceutical composition.Based on the test of DNA analysis blood cell numeration flow, these cells that broken up show the G1 stage (data does not show) that rests on cell cycle.Also show simultaneously use 1 or during 2mg/ml injection Uropoly acid-peptide pharmaceutical composition telomerase activation inhibition and time confidential relation arranged for a long time, the inhibition of telomerase activation is likely because of induced differentiation rather than simple antigrowth effect.

Because human telomerase reverse is active and the particular associative of cancer, this enzyme becomes good medical target.Just may limit these frequency dividing cells to the special inhibition of the telomerase in the cancerous cell or adjusting downwards, reach the inhibition growth of tumor finally.What up to the present active adjusting was known about telomerase in the body is few.The attenuating cell of telomerase activation becomes resting state once this type of report (Holt et al.1996).In addition, induce the activity of downward adjustable side granzyme that some reports are arranged recently for several JEG-3 with cell differentiation.These results can be from cell from promyelocytic leukemia cell (Sharma et al.1995; Albanell et al.1996), erythroleukemia (Sharma et al.1995), the blood cell of medullary cell (Zhang et a1.1996), embryonal carcinoma (Albanellet al., 1996; Kurk et al.1996), the cell of glioma and melanoma (Cheng et al.1997) etc. is obtained.Yet two kinds of mouse cell strains and two kinds of people's tumor, glioma and melanoma do not lose telomerase activation (Cheng et al.1997) with the method for induction.This may with different relevant in order to the kind of cancerous cell of research.

Telomerase activation extracts the S of thing and M stage at the cell cycle of Xenopus model (Mantell and Greider, 1994) and shows very actively, and this points out telomerase activation is not that the dna replication dna that is colored body is regulated.Therefore, the activity that stops perhaps can not enough to suppress telomerase of a cell cycle.On the other hand, not all splitted cell needs the activity of telomerase.Thisly what may partly be interpreted as there is the cell of some differentiation to keep the ability of breeding, and be to divide under the telomerase activation not having; Simultaneously why as described above have different inhibition in various external malignant tumor induction results to telomerase activation.The former obvious example has fibrocyte, lymphocyte, benign tumor and certain leukemia such as ALL and CML (Morin, 1995 of differentiation; Kim et al.1994; Tahara et al.1995).

Generally speaking, our research found that injection Uropoly acid-peptide pharmaceutical composition to blood cell through cell differentiation induced the antineoplastic curative effect, subsidiary have an effect that suppresses telomerase activation.There are very confidential relation the inhibition of telomerase activation and dosage and time.The melanoma cell strain that the result of our preliminary study shows two kinds of people is handled the activity that 7 days results do not suppress telomerase with the injection Uropoly acid-peptide pharmaceutical composition dosage of 0.5-4mg/ml.The cancerous cell that obtains from the hemopoietic primordial stem cell responds to induction and the telomerase activation of regulating them downwards is likely, and may regulate not reaction to the active differentiation of telomerase from the solid tumor cell that back mutation again gets.The sensitivity difference that the telomerase activation of different types of cancerous cell suppresses differentiation, some cancerous cell may respond and other just not reaction of cancerous cell to " differentiation therapy ".Yet there is any to remember, even to the responseless tumor cell of injection Uropoly acid-peptide medicine composite for curing, if when share with other therapies such as X-ray therapy, with accept X-ray therapy separately and compare, find easier cancerous cell to be killed, therefore before use injection Uropoly acid-peptide pharmaceutical composition, a small amount of cancerous tissue of should taking a sample identifies whether it contains telomerase, whether is suitable for injection Uropoly acid-peptide medicine composite for curing to determine it.

Conclusion (of pressure testing)

Prove by isolated test: injection Uropoly acid-peptide pharmaceutical composition can suppress the growth of people's marrow blood cancerous cell (HL-60); And can suppress the activity of telomerase in this cell, prompting injection Uropoly acid-peptide pharmaceutical composition may be a kind of cell differential agent.

Embodiment 15. and injection Uropoly acid-peptide pharmaceutical composition exsomatizes and at the drug efficacy study of body to people's hepatocarcinoma Smmu

Be subjected to the reagent thing: injection Uropoly acid-peptide pharmaceutical composition is produced by our company and is provided.Lot number 970810.Vial plug aluminium lid sterile packaged, every bottle of 100ml.Solid content; 200mg/ml.Outward appearance is the clear and bright liquid of dark-brown.There are not precipitation and floccule phenomenon, good fluidity, non-foaming foam vibrates.The lucifuge room temperature preservation.Before the test directly or with the suitable diluted for use of the DMEM of no Ox blood serum.

Animal

Nude mice male and female half and half, body weight 18-20g, Nat'l Pharmaceutical ﹠ Biological Products Control Institute's animal breeding field provides.Health was raised 7 in advance.

Feeding and management condition

Raise by SPF animal requirement management.Group support, 5 in every cage, indoor temperature, humidity, illumination and Ventilation Control are satisfied the criteria.The abundance of freely ingesting supplies water.Observed for 1 week before the experiment and write down corresponding situation.

Tumor cell line

People's hepatocarcinoma Smmu 7721 cells are by the cultivation of going down to posterity of Nat'l Pharmaceutical ﹠ Biological Products Control Institute's biochemical drug and genetically engineered drug chamber.

Reagent and equipment

Reagent

Culture medium DMEM (Sigma) liquid adds 10% calf serum, each 100 units/ml of penicillin and streptomycin, and pH transfers to 7.2-7.4.

MTT Sigma produces, and is mixed with the solution of 0.4mg/ml with DMEM liquid.

The dimethyl sulfoxide Beijing Chemical Plant, analytical pure.

Cyclophosphamide (CTX) 200mg/ props up Hualian Pharmaceutical Co., Ltd., Shanghai.

Instrument

Incubator CO2 gas incubator (Forma Scientific 333 types)

Microplate reader ETERTECH ∑ 960 types

Test item, method and result of the test

1. the antitumor that exsomatizes is tested

1.l test method and step

Mtt assay is measured the inhibitory action of test sample to cancerous cell.The take the logarithm cancerous cell of trophophase, is suspended in the culture medium cell dissociation with the Versens Digestive system, and cell concentration is transferred to 1.O * 10 ⁵Individual/ml, spread 96 porocyte culture plates, 100 μ l/ holes, add test sample 100 μ l/ holes, blank and normal cell control wells are established in every concentration 4 holes, culture plate is put in 37 ℃ of 5% CO2 gas incubator, cultivates abandoning supernatant 72 hours, add MTT liquid 100 μ l/ holes, put in 37 ℃ of 5% CO2 gas incubator abandoning supernatant 4 hours, add dimethyl sulfoxide 100 μ l/ holes, put on the agitator and vibrate, till the granule dissolving, measure OD value, wavelength 550nm, regression Calculation IC with microplate reader ₅₀, i.e. 50% cell survival concentration.The OD value is 4 hole meansigma methodss.

1.2 result of the test

Result of the test sees Table 17.Matched group OD value is 1.131, and cell survival rate is decided to be 100%.

OD average/matched group OD average * 100% of cell survival rate=each dosage group of injection Uropoly acid-peptide pharmaceutical composition

As seen along with injection Uropoly acid-peptide drug regimen substrate concentration increase OD and cell survival rate obviously reduce, close dose-dependence is arranged.

Obtain the IC of injection Uropoly acid-peptide pharmaceutical composition by table 1 data ₅₀Equal O.78 ± O.41 (x ± s) the stripped effect of table 17 variable concentrations injection Uropoly acid-peptide pharmaceutical composition to people's hepatocarcinoma Smmu 7721 cells

Concentration (mg/ml) n OD value-(the cell survival % of x ± s) (x ± s)

0.0625 6 1.050±0.028 95.65±4.14

O.125 6 0.981±0.023 89.35±4.32

0.25 6 0.930±0.035 84.72±4.40

0.5 6 0.780±0.014 71.07±2.77

1 6 0.521±0.022 47.52±2.56

2 6 O.268±0.006 24.40±1.06

4 6 0.049±0.011 4.45±0.95

1.3 conclusion

Injection Uropoly acid-peptide pharmaceutical composition is to the half-inhibition concentration IC of vitro human hepatoma carcinoma cell ₅₀In the scope of 0.72-0.83mg/ml.

2. test at the body antitumor

2.1 test method and step

Grouping is totally 5 groups; 3 dosage groups of injection Uropoly acid-peptide pharmaceutical composition; Positive control is CTX; Negative control is a normal saline.

Inoculation hepatoma carcinoma cell suspension 1-2 * 10 ⁷Individual/Mus, the back subcutaneous vaccination.The nude mice (the visible small rice grain size of naked eyes) that tumor is gone up in the back selection inoculation of one week of inoculation is grouping at random, and every group of 4-6 only.

The dosage test sample with normal saline be diluted to 200,100,50mg/ml, lumbar injection 0.2ml/ only/time, promptly 400,200, the 100mg/kg body weight, every day 1 time, continuous 10 days.

Route of administration can replace with lumbar injection by " new drug (Western medicine) preclinical study guideline compilation " clinical application intravenously administrable person, so lumbar injection is adopted in this experiment.

2.2 result of the test

Table 18 is respectively organized the heavy (x ± s) of each batch nude mice anti-tumor in vivo result of the test batch group dosage (mg/kg) n tumor ^-Press down tumor %1 and contrast 4 2.55 ± 1.15 0.0 injection Uropoly acid-peptide pharmaceutical compositions 45 3.40 ± 1.44 0.0

40 4 2.66±0.80 0.0

400 5 0.67±0.32 73.7*

CTX 100 5 0.50 ± 0.18 80.4*2 contrasts 5 4.19 ± 2.62 0.0 injection Uropoly acid-peptide pharmaceutical compositions 100 6 1.83 ± 0.79 56.3

200 6 1.26±0.98 69.9*

400 5 1.36±1.06 67.5

CTX 100 5 0.41 ± 0.33 90.2*3 injection Uropoly acid-peptide pharmaceutical composition 100 5 1.59 ± 0.28 52.1

200 6 1.23±0.46 70.6*

400 5 0.69 ± 0.51 83.5*4 injection Uropoly acid-peptide pharmaceutical composition 100 5 2.02 ± 0.99 51.8

200 6 1.27±0.56 69.7*

400 5 1.24±0.94 70.4*

*?P＜0.05，**?P＜0.01

Successive administration 10 days, drug withdrawal was put to death animal after 24 hours, dissected and to peel off the tumor piece, claimed tumor heavy, calculated tumour inhibiting rate and did the t-test with blank, and P＜0.05 o'clock represents that difference has the significance meaning.4 times result of the test sees Table 18.

Computing formula presses down tumor %=100 * (C-T)/C

T is that the average tumor of administration group is heavy in the formula, and C is that the average tumor of matched group is heavy.

The apparent size of the tumor of 5 groups is seen accompanying drawing 54-58.

2.3 conclusion

When injection Uropoly acid-peptide pharmaceutical composition dosage is 100-400mg/kg nude mice body weight, the tumour inhibiting rate of nude inoculation human hepatoma cell strain at 51.8-83.5%, had the effect of certain inhibition tumor growth.Embodiment 12 injection Uropoly acid-peptide pharmaceutical compositions exsomatize to lung carcinoma cell, in the influence of body to ascites hepatocarcinoma, liver-cancer solid tumor and pulmonary carcinoma solid tumor

Be subjected to the reagent thing: injection Uropoly acid-peptide pharmaceutical composition our company produces and provides.Totally 3 lot numbers: 960601,960606,960608.Vial plug aluminium lid sterile packaged, every bottle of 100mL.Solid content: 40mg/mL.Outward appearance is the clear and bright liquid of dark-brown.There are not precipitation and floccule phenomenon, good fluidity, non-foaming foam vibrates.The lucifuge room temperature preservation.

Directly or with normal saline suitably dilute application before the test.

Animal:

Mice is a Kunming kind closed colony, and body weight 18-22g is all femalely, is provided the quality certification number by laboratory animal portion of Chinese Medical Sciences University (Liaoning Province's management of laboratory animal committee approval also issue certificate of competency unit, Shenyang 110001): No. the 521st, the real moving word of the Liao Dynasty.Health was raised 7 in advance.

C ₅₇The black Mus body weight 18-21g of/BL pure lines is all femalely, is provided the quality certification number by laboratory animal portion of Chinese Medical Sciences University: No. the 532nd, the real moving word of the Liao Dynasty.Health was raised 7 in advance.

Feeding and management condition: group support, 5 in every cage, indoor temperature, humidity, illumination and naturally ventilated have heating installation winter, open fan in case of necessity.The laboratory animal Mus full-valence pellet feed that feedstuff provides for Shenyang City's laboratory animal feed factory, standard code DB21-741-93, the sufficient water supply of freely ingesting.Observed for 1 week before the experiment and write down corresponding situation.

4. tumor cell line

(1) human lung carcinoma cell line AGZY-83A draws from the institute of oncology, Anshan.Be used for isolated test.

(2) hepatoma cell strain HCP, institute of materia medica, Chinese Academy of Sciences Shanghai Pharmacology Lab provides.Liquid nitrogen is preserved.Be used for mouse ascites tumor and solid tumor models.

(3) Mus lung cancer cell line Lewis lung cancer, Shanghai Institute of Pharmaceutical Industry of Chinese Academy of Sciences medicine provides.Use C ₅₇/ BL Mus carries out the solid tumor moulding.

Reagent and equipment

RPMI cultivates powder U.S. JR Scientific Inc production.

Seriation goods in calf serum Tianjin are produced.

Mitomycin Japan Kyowa Hakko Kogyo company limited is produced lot number: 098AFC.

24 well culture plate U.S. Corning (New York) products.

Test item, method and result of the test

1. antitumor action exsomatizes

1.1 test method

(1) test grouping, concentration and dosage regimen design

Be divided into following 7 groups:

Negative (simulation process) matched group adds the RPMI/1640 culture fluid;

Low concentration group adds and is subjected to reagent thing (0.157mg/mL);

In the concentration group add and be subjected to reagent thing (0.313mg/mL);

The high concentration group adds and is subjected to reagent thing (0.625mg/mL):

Ultrahigh concentration group (2 groups) adds and is subjected to reagent thing (1.25 or 2.5mg/mL);

Positive controls adds mitomycin (0.01mg/mL).

Establish 3 repeating holes for every group.

(2) method and step

Earlier the AGZY-g3A cell recovery is cultivated, treated that cell grows when vigorous, cell is made for 1 * 10 ⁴The concentration of individual/mL, every hole adds 1mL in 24 orifice plates, by corresponding medicinal liquids of appearance such as above-mentioned grouping addings, puts 37 ℃ of 5%CO again ₂In the incubator, expected with 0.4% that blue dyeing counting was dead, viable count every 24 hours, instrumentation is 7 days continuously.(3) computing formula

Inhibitory rate of cell growth (%)

=(1-respectively organizes viable count/negative control group viable count) * 100

1.2. result of the test

Result of the test is listed in table 19, is subjected to the reagent thing when finite concentration cancerous cell to be had certain inhibitory action as can be known, and amount-result relation is arranged.But (1.25 or 2.5mg/mL) inhibitory action and no longer increasing when concentration higher concentration group is big again, thereby do not detect concrete IC ₅₀Value.。

Each group of table 19 to the growth curve of concentration group 0.313 6.67 high concentration group 0.625 30.00 ultrahigh concentration group 1.25 29.74 positive controls mitomycins 0.010 (100) negative control, high concentration and positive controls in the tested medicine 0.157 2.67 of inhibiting rate (%, the 7th day 3 hole averages) group drug concentration (mg/mL) inhibiting rate (%) negative control group RPMI/1640 nutrient solution-0.00 low concentration group of human lung carcinoma cell shown in Figure 59.

1.3 conclusion (of pressure testing) by above result as can be known: be subjected to the reagent thing that the growth of human lung carcinoma cell is had inhibitory action in the isolated test, and present amount-result relation.But action intensity is different with mitomycin with character, and the latter makes cell dead rapidly, not regrowth.It is not typical cytotoxic agent that this explanation is subjected to the reagent thing.

2. the test that acts in the body extension ascitic type liver cancer animal survival phase

2.1 test method

(1) tumor moulding

After the hepatoma carcinoma cell recovery with the liquid nitrogen preservation, be inoculated in and make formation ascites in the mouse peritoneal.Extract ascites out and collect cancerous cell, making cancerous cell density with the normal saline dilution is 2 * 10 ⁶Individual/mL.Get 75 mices, every mouse peritoneal inoculation 0.2mL (4 * 10 ⁵Individual cancerous cell), random packet begins test after 24 hours.

(2) test grouping, dosage and dosage regimen design

Be divided into following 5 groups (every group of 15 mices).Being subjected to reagent object height dosage is 1250mg/kg, quite 7.5 times of the clinical consumption of people (167mg/kg).Mitomycin dosage is 1mg/kg, also about 8 times of the suitable clinical consumption of people.

Negative (simulation process) matched group iv normal saline;

Low dose group iv is subjected to reagent thing (6.25mg/20g):

Middle dosage group iv is subjected to reagent thing (12.5mg/20g):

High dose group iv is subjected to reagent thing (25.0mg/20g);

Positive controls iv mitomycin (0.02mg/20g).

Medicine is not with normal saline dilution (high dose group is diluted), and every mice is through tail vein iv saline or medicinal liquid 0.5mL/20g, once a day, and continuous 14 days.

(3) method and step: each is organized successive administration and stops iv after 14 days, but continues the general situation of breeding observing animal, and record is respectively organized the death time of each animal and body weight when dead.

(4) computing formula

Increase in life span (%)=100 * (T-C)/C

T ... the The average survival time natural law of each group

C ... the The average survival time natural law of negative control group

2.2 result

As above test has successively been carried out two batches altogether, and table 20 is listed in result's merging.In table, gone back primary part observation the general state of animal (appetite, the mental status, activity, fur) the data.The mitomycin treated animal, all have be off one's feed, lassitude, the Mi that withers, activity less, fur is unglazed and modest: being tried thing group and negative control group does not then have this situation.

The average of body weight, existence natural law and increase in life span when each treated animal of table 20 is dead

Body weight existence natural law average rate elongation when group dosage n is dead

(mg/kg) (g) (days) (％)

Negative control group-30 23.41 17.66 0.0

Low dose group 312.5 30 23.51 17.03-3.6

Middle dosage group 625 28 25.77 18.52 4.9

High dose group 1,250 30 25.06 21.92 24.1

Positive controls 1.0 29 20.61 19.61 11.0

The result shows: be subjected to the reagent thing can improve animal quality of life than mitomycin, the weight of animals does not reduce; Can prolong the animal survival phase when doses, dose-effect relationship is arranged, though do not reach＞30% criterion of therapeutical effect, rate elongation can reach about 24%.

3. resist the test of animal liver-cancer solid tumor effect at body

3.1 test method

(1) tumor moulding

After the recovery of the HCP hepatoma cell strain of liquid nitrogen cryopreservation, it is subcutaneous to be inoculated in the mice forearm, form tumor after, take out tumor, preparation cancerous cell suspension.Get 50 mices, every mice is by 3 * 10 ⁵It is subcutaneous that individual cancerous cell is inoculated in the mice forearm.Be divided into 5 groups at random, 10 every group.Weigh, begin test after 24 hours.

(2) test grouping, dosage and dosage regimen design

Be divided into following 5 groups (every group of 10 mices):

Negative (simulation process) matched group iv normal saline;

Low dose group iv is subjected to reagent thing (5.0mg/20g);

Middle dosage group iv is subjected to reagent thing (10.0mg/20g);

High dose group iv is subjected to reagent thing (20.0mg/20g);

Positive controls iv mitomycin (0.03mg/20g).

(3) method and step

Each organized successive administration after 14 days, put to death mice with ether, weighed, and separated tumor and claimed tumor heavy.Getting main organs and tumor after the perusal, to put into neutral formalin in the lump fixing.

(4) computing formula

Tumor control rate (%)=(1-T/C) 100

T ... the average tumor of each group is heavy

C ... the average tumor of negative control group is heavy

3.2 result

As above test has successively been carried out three batches altogether, and table 20 is listed in result's merging.In table, gone back primary part observation the general state of animal (appetite, the mental status, activity, fur) the data.The mitomycin treated animal, all have be off one's feed, lassitude, the Mi that withers, activity less, fur is unglazed and modest; Being tried thing group and negative control group does not then have this situation, and is tried thing treated animal state and also be better than negative control group.Each treated animal all has death in the process of the test.

Each treated animal of table 21 survival number, tumor heavily reach the average (x ± s) of suppression ratio

The heavy suppression ratio of the average tumor of group dosage n surviving animals

(mg/kg) n body weight (g) (g) (%)

Negative control group-30 25 19.5 1.13 ± 0.64 0.0

Low dose group 250 30 27 19.2 0.86 ± 0.57 23.9

Middle dosage group 500 30 26 20.9 0.81 ± 0.61 28.3

High dose group 1,000 30 29 22.4 0.74 ± 0.52 ^*34.5 ^*

Positive controls 1.5 30 26 18.2 0.21 ± 0.17 ^*81.4 ^*

^**?P＜0.01， ^*?P＜0.05

The result shows: be subjected to the reagent thing can both suppress growth of tumor when 3 kinds of dosage, dose-effect relationship is arranged, suppression ratio on average can reach about 29%, and high dose group can reach 34.5%, and comparing difference with negative control has still significant meaning (P＜0.05) statistically.Be subjected to the reagent thing can improve animal quality of life, though and mitomycin has obvious tumor killing effect that animal quality of life is obviously worsened.

4. resist the test of animal pulmonary carcinoma solid tumor effect at body

4.1 test method

(1) tumor moulding

C with the strain of two subcutaneous lotus Lewis lung cancer ₅₇Black Mus is put to death, and 75% ethanol disinfection skin is cut skin and taken out the tumor piece, shred grinding after, cross 200 order nets, centrifugal, transferring cell concentration with normal saline is 1 * 10 ⁶Individual/mL, be total to 28mL.Get 70 C ₅₇The black Mus of/BL pure lines, every subcutaneous injection 0.25mL.Be divided into 5 groups by the principle of correspondence between the body weight group, 10 every group.Begin test after 24 hours.

(2) test grouping, dosage and dosage regimen design

Be divided into following 5 groups (every group of 10 mices):

Negative (simulation process) matched group ip normal saline;

Low dose group ip is subjected to reagent thing (5.0mg/20g);

Middle dosage group ip is subjected to reagent thing (10.0mg/20g);

High dose group ip is subjected to reagent thing (20.0mg/20g);

Positive controls ip mitomycin (0.025mg/20g).

Medicine dilutes with normal saline, every ip in mice saline or medicinal liquid 0.5mL/20g, once a day, continuous 10 days.

(3) method and step: each organized successive administration after 10 days, and mice is put to death in the cervical vertebra dislocation, weighs, and separated tumor and claimed tumor heavy.Getting main organs and tumor after the perusal, to put into neutral formalin in the lump fixing.

(4) computing formula

Tumor control rate (%)=(1-T/C) * 100

T ... the average tumor of each group is heavy

C ... the average tumor of negative control group is heavy

4.2 result

As above test has successively been carried out three batches altogether, and table 22 is listed in result's merging.In table, gone back primary part observation the general state of animal (appetite, the mental status, activity, fur) the data.The mitomycin treated animal, all have be off one's feed, lassitude, the Mi that withers, activity less, fur is matt and modest; Being tried thing group and negative control group does not then have this situation, and animal feed drinking-water and active state are good, and fur is along sliding glossy.Each treated animal all has death in the process of the test.

Each treated animal of table 22 survival number, tumor heavily reach the average (x ± s) of suppression ratio

(mg/kg) (n) (g) (％)

Negative control group-30 26 1.210 ± 0.43 0.0

Low dose group 250 30 25 1.107 ± 0.41 8.5

Middle dosage group 500 30 28 0.978 ± 0.35 19.2

High dose group 1,000 30 27 0.952 ± 0.44 21.3

Positive controls 1.25 30 19 0.513 ± 0.43 ^*57.6 ^*

^**?P＜0.01

The result shows: be subjected to the reagent thing can both suppress growth of tumor when 3 kinds of dosage, dose-effect relationship is arranged, middle high dose group suppression ratio on average can reach about 20%.Be subjected to the reagent thing can improve animal quality of life, though and mitomycin has obvious tumor killing effect (P＜0.01) that animal quality of life is obviously worsened, about 1/3 animal is dead before the test date of expiry.

Test Summary

The result of 4 tests has proved that injection Uropoly acid-peptide pharmaceutical composition has antitumor drug effect to a certain degree.1. the antitumor action that exsomatizes is tested: show to be subjected to the reagent thing that the growth of human lung carcinoma cell is had inhibitory action, and present dose-effect relationship.2. in the test of body extension ascitic type liver cancer animal survival phase effect: be subjected to the reagent thing can improve animal quality of life, when doses, can prolong the animal survival phase (about rate elongation 24%).3. in the test of body antagonism animal liver-cancer solid tumor effect: be subjected to the reagent thing can improve animal quality of life, when 3 kinds of dosage, can both suppress tumor growth, suppression ratio on average can reach about 29%, and high dose group can reach 34.5% (P＜0.05): though and mitomycin has obvious tumor killing effect (P＜0.01) that animal quality of life is obviously worsened.4. in the test of body antagonism animal pulmonary carcinoma solid tumor effect: be subjected to the reagent thing can improve animal quality of life, 3 kinds of dosage can both suppress growth of tumor, and dose-effect relationship is arranged, and middle high dose group suppression ratio on average can reach about 20%; Though and mitomycin has obvious tumor killing effect (P＜0.01) that animal quality of life is obviously worsened, about 1/3 animal is dead before the test date of expiry.So think and be subjected to the reagent thing that certain antitumous effect is arranged, and interaction property is different with mitomycin, the former improvement and the latter are worsened animal quality of life.

Embodiment 16. the observation of curative effect of Uropoly acid-peptide pharmaceutical composition control nude mice hepatoma Metastasis recurrence

The transfer and relapse of hepatocarcinoma is one of principal element that influences at present the hepatocarcinoma curative effect.Even behind the early stage radical excision of small liver cancer, relapse rate was also up to 43.5%[1 in 5 years].This experiment is the row RESECTION OF LIVER CANCER before and after the nude mice hepatoma Metastasis takes place, and postoperative adopts Uropoly acid-peptide pharmaceutical composition subcutaneous injection, observes at body and tests the curative effect whether it has the recurrence of control nude mice hepatoma Metastasis.

Be subjected to the reagent thing: the Uropoly acid-peptide pharmaceutical composition is produced by our company lot number is provided: 970508.Vial plug aluminium lid sterile packaged, every bottle of 100ml.Solid content: 40mg/ml.Outward appearance is the clear and bright liquid of dark-brown.There are not precipitation and floccule phenomenon, good fluidity, the non-foaming foam that vibrates, lucifuge room temperature preservation.Directly or with normal saline suitably dilute application before the test.

Animal: nude mice is the BALB/CA strain, and is male, and the institute of materia medica, Shanghai provides.Mus 4-6 in age week, body weight 17-20g.Totally 13.Health was raised 7 in advance.

Feeding and management condition: raise by SPF animal requirement management.Group support, 5 in every cage, indoor temperature, humidity, illumination and Ventilation Control are satisfied the criteria.The abundance of freely ingesting supplies water.Observed for 1 week before the experiment and write down corresponding situation.

Tumor cell line: the tumor source is the high metastasis model of the mountain hospital liver cancer research LCI-D20 of institute nude mice hepatocarcinoma in the Shanghai Medical Univ, and disconnected neck is put to death animal, opens abdomen and gets tumor tissues, is cut into 0.2 * 0.2 * 2cm ³Size places 4 ℃ normal saline standby.

Test method

Animal Model Making: nude mice is with 1% pentobarbital sodium 40-50ng/kg intraperitoneal injection of anesthesia; The about 1cm of upper left abdomen transverse incision is exposed to incision with liver, cuts Glisson's capsule 0.3cm, and the tumor piece is planted in liver, and 8-0 not damaged surgical sutures is sewed up fixedly tumor piece of Glisson's capsule, sends liver back to abdominal cavity gently, closes abdomen.Send back in the cage after anesthesia is clear-headed and raise the postoperative ad lib.

This animal pattern shifted in the plantation back on the 19th day.Laboratory animal is divided two groups at random, and the early cancer organizes in back 16 days capable RESECTION OF LIVER CANCER of inoculation, and the advanced liver cancer group is in back 22 days capable RESECTION OF LIVER CANCER of inoculation.Behind above-mentioned same method anesthetized animal, get upper right abdomen transverse incision, be about 1cm, liver is exposed under the otch, examine the scope of plantation tumor growth in the liver, the strand eyelet closes normal liver tissue, local excision's liver cancer tissue at the about 0.2cm of distance borderline tumor place.After checking that local no liver cancer tissue is residual, push a moment, abdomen is closed in the hemorrhage back of no activity.Subcutaneous injection normal saline 1ml sends back in the cage after anesthesia is clear-headed and raises ad lib.

Drug dose and infusion protocol: share calcium ion and Vit C for heightening the effect of a treatment simultaneously.The mixed solution preparation; Uropoly acid-peptide medicine composition injection 1ml (40mg)+10% calcium gluconate 0.1ml+Vit C 0.5ml (250mg).Dose is every animal subcutaneous injection every day 1.6ml.Early hepatocarcinoma group 16-24 days continuous subcutaneous injections totally 9 days after inoculation, 23-31 days continuous subcutaneous injections are totally 9 days after the advanced liver cancer winding kind.Matched group is injected isometric normal saline.

Observation index: in back 35 days of inoculation, nude mice is weighed the back to pluck the way execution animal of eyeball blood-letting, after getting two lungs and weighing, be put in 10% formalin solution fixing, paraffin embedding, each wax stone 50um at interval cut one of the thick section of 5um, continuous 10, totally 20 in bilateral lung, the number of record metastasis.Complete taking-up hepatic tissue, metastasis number, distribution and incisxal edge recurrence situation in the record naked eyes liver.Incisxal edge recurrence kitchen range size is calculated by (tumor maximum diameter+perpendicular diameter of tumor) ÷ 2. and observed and recorded shifts the number that involves internal organs.

Result of the test

1. the nude mice body weight changes

The early hepatocarcinoma excision: the matched group average weight is 24.3 ± 2.1g, and Uropoly acid-peptide pharmaceutical composition group is 25.8 ± 1.9g, though Uropoly acid-peptide pharmaceutical composition group is high slightly, handles through measurement data t-test statistics, and difference does not have significance (P＞0.05).

The advanced liver cancer excision: the matched group average weight is 21.3 ± 1.8g, and Uropoly acid-peptide pharmaceutical composition group is 25.1 ± 2.0g.Credit is analysed by statistics, and Uropoly acid-peptide pharmaceutical composition group increases difference than matched group body weight significance (P＜0.05).

2. local transfer and relapse situation in the liver

Transfer and relapse situation in the different treatment group of table 23 hepatocarcinoma (x ± s)

The metastasis number involves number of sheets liver weight in wet base/body weight/100 incisxal edge diameter of tumor in the group example number liver

(individual/only) (individual/only) (CM)

The early hepatocarcinoma excision

Contrast 5 7.2 ± 2.3 3.7 ± 0.6 7.8 ± 0.70 1.1 ± 0.2

Uropoly acid-peptide

Pharmaceutical composition 5 2.6 ± 2.3 1.8 ± 1.3 ^*7.6 ± 0.54 0.5 ± 0.2 ^*

The advanced liver cancer excision

Contrast 5 8.6 ± 8.2 4.6 ± 1.5 8.3 ± 0.43 0.9 ± 0.4

Uropoly acid-peptide

Pharmaceutical composition 5 1.0 ± 1.0 1.2 ± 0.8 ^*6.3 ± 0.41 ^*0.5 ± 0.1

* compare P＜0.05 with corresponding matched group, * * and corresponding matched group be P＜0.01 relatively

Normal nude mice liver is 7 leaves, and the early hepatocarcinoma excision: metastasis in the liver all appears in 5 animals of matched group, 7.2 of metastasis numbers, and involving the number of sheets is 3.7.5 animals of Uropoly acid-peptide pharmaceutical composition group have 3 to shift, and 2.6 of metastasis numbers involve 1.8 of the numbers of sheets.The advanced liver cancer excision: metastasis in the liver all appears in 5 animals of matched group, mostly is 22 most, and all 7 leaves are all got involved; Metastasis is 1 in the minimum liver, but involves 3 leaves during than Datong District; 8.6 of mean transferred kitchen range numbers involve 4.6 of the numbers of sheets.5 animals of Uropoly acid-peptide pharmaceutical composition group have only 3 to take place to shift in the liver, and 1.0 of metastasis numbers involve 1.2 of the numbers of sheets.Yin Ben group data discrete degree is bigger, does not do statistical analysis, but can find out from above data, shifts all light than matched group in the liver after Uropoly acid-peptide pharmaceutical composition group is early stage and late period, nude mice hepatocarcinoma was excised.(seeing Table 23)

The early stage excision of liver weight in wet base two groups of indifferences (P＞0.05) are excised Uropoly acid-peptide pharmaceutical composition group late period and are obviously alleviated.

Early, that excise incisxal edge local recurrence Uropoly acid-peptide pharmaceutical composition group diameter of tumor late period is all little than matched group, but when excising more in early days with matched group statistically difference significance (P＜0.01) is arranged.Two groups of comparing differences did not have significance (P＞0.05) when excised late period.

3. lung hematogenous metastasis situation at a distance

Transfer case in the different treatment group of the table 24 hepatocarcinoma lung (x ± s)

Metastasis number lung weight in wet base/body weight/10000 in the hepatocarcinoma excision group example number lung

Period (individual/only)

Early stage contrast 5 2.8 ± 2.5 5.82 ± 1.91

Uropoly acid-peptide

Pharmaceutical composition 5 0.0 ± 0.0 5.89 ± 3.85

Contrast 5 63.8 ± 28.1 7.45 ± 0.87 late period

Uropoly acid-peptide

Pharmaceutical composition 5 2.0 ± 3.4 ^*6.18 ± 1.98

* compare P＜0.05 with corresponding matched group

Two lungs are total to 20 of serial section, the number sum that the branch on count kitchen range takes place under light microscopic.5 animals of 2 matched groups all see the lung metastasis, and early hepatocarcinoma excision Uropoly acid-peptide pharmaceutical composition group apneumia shifts and takes place, and the advanced liver cancer excision has only 3 animals that metastasis is arranged, and on corresponding two groups of comparative statistics significance is arranged all.Whether the lung weight in wet base treats all indifferences.

4. metastasis happening part

The lung tumor is inoculated observation in back 35 days, except that above-mentioned liver original position metastasis and lung metastasis kitchen range, still visible otch, mesentery, gonad, hepatic portal portion, inferior pole of kidney, hilus lienis, diaphram, pancreas upper limb shift, early, advanced liver cancer excision back uses the degree that the Uropoly acid-peptide pharmaceutical composition can suppress metastasis.The results are shown in Table 25.

Table 25 not on the same group metastasis involve internal organs (x ± s)

Hepatocarcinoma excision group in period example number involves internal organs (individual)

Early stage contrast 5 7.8 ± 0.5

Uropoly acid-peptide

Pharmaceutical composition 5 2.0 ± 2.2 ^* Contrast 5 8.3 ± 4.0 late period

Uropoly acid-peptide

Pharmaceutical composition 5 3.3 ± 4.2 ^*

* compare P＜0.05 with corresponding matched group

Discuss and conclusion

No matter malignant cell all is similar to undifferentiated embryonic cell in form, function and metabolism, differentiating inducer can make the biology of tumor cell and immunological characteristic transform to normal cell.What obtained better clinical practice at present is the treatment of all-trans retinoic acid to promyelocytic leukemia, and 85.4% patient can obtain fully to be alleviated.The research performance, cell surface adhesion molecule is expressed higher in the cell immature phase, along with cell maturation is expressed decline.The height of hepatocarcinoma shifts relevant with intercellular adhesion molecule-1 (ICAM-1) high expressed of cell surface.

The Uropoly acid-peptide pharmaceutical composition is a kind of cell-differentiation inducers, we wish its can inducing cell differentiation and maturation, make cancerous cell residual after the RESECTION OF LIVER CANCER or the cell reversal of canceration tendency arranged; Also wish therefore to reduce the expression of cancerous cell surface adhesion molecule, its transfer ability is descended.

Experimental result shows; Row local tumor excision back, back takes place and uses the Uropoly acid-peptide pharmaceutical composition in the nude mice hepatoma Metastasis, shifts in the liver and reduces, and the liver weight in wet base reduces, and incisxal edge local recurrence tumor is also less, shifts in effectively suppressing and recurrence.The number of the internal organs that the lung metastasis number of reflection metastasis and transfer are involved also reduces, and therefore thinks that the Uropoly acid-peptide pharmaceutical composition can reduce the transfer and relapse of nude mice advanced liver cancer.The nude mice hepatoma Metastasis local hepatocarcinoma excision back row Uropoly acid-peptide medicine composite for curing that moves ahead, interior metastasis of liver and transfer are involved the internal organs number and are also reduced, shift in the apneumia and take place, prove that the transfer and relapse after it is to nude mice early hepatocarcinoma excision also has good prevention effect.

Embodiment 17. the drug-fast preliminary study of injection Uropoly acid-peptide pharmaceutical composition reversing tumor

Be subjected to the reagent thing: injection Uropoly acid-peptide pharmaceutical composition is produced by our company and is provided.Lot number: 980508.Vial plug aluminium lid sterile packaged, every bottle of 100ml.Solid content: 40mg/ml.Outward appearance is the translucent liquid of sepia.There are not precipitation and floccule phenomenon, good fluidity, non-foaming foam vibrates.The lucifuge room temperature preservation.

Directly or with normal saline suitably dilute application before the test.

Tumor cell line;

The durable medicine strain of human mouth phosphorus columnar epithelium cancerous cell (KB) VCR (KB _V200), preserve by Affiliated Hospital of Military Medical Science Institute oncomolecularbiology laboratory.

Human lung carcinoma cell (H23), pulmonary carcinoma ADR, CDDP persister (H1435) are presented by Taiwan.

Reagent:

Vincristine (VCR) Beijing Medical University trial (demonstration) plant produces.

Doxorubicin hydrochloride (ADR) Shenzhen ten thousand happy Pharmaceutical products.

Cisplatin (DDP) Qilu Pharmaceutical Factory product.

Verapamil (Ver) Jiangsu Lianyungang Pharmaceutical Factory product.

Thiazolyl blue (MTT), guanidinium isothiocyanate, RNasin, AMV reverse transcriptase all are Promega company product.

Taq archaeal dna polymerase Bao Sheng biotech firm product.

Test method and result

1. test method

The cell drug resistance inversion trophophase cell of taking the logarithm, cell concentration 3-5 * 10 are regulated in trypsinization ⁴/ ml, the 0.1ml/ hole is inoculated in 96 porocyte culture plates, cultivates ld, and experimental group is annotated respectively and is penetrated with Uropoly acid-peptide pharmaceutical composition 0.4,0.8,1.2mg/ml.The experiment contrast group adds Ver 6 μ g/ml.The effect group adds anticarcinogen separately.Parallel 3 holes.Continue to cultivate 3d, discard culture fluid, every hole adds the MTT 200 μ l of 0.4mg/ml, cultivates 4h, discards MTT, and every hole adds DMSO 150 μ l, after waiting to dissolve, in the Anthos2010 microplate reader, in 570nm place photometry absorption value.The experiment contrast group is a control wells singly to add Ver, and experimental group is a control wells singly to add injection Uropoly acid-peptide pharmaceutical composition, obtains half-inhibition concentration IC ₅₀

Design of primers MDR1 gene primer is taken from its cDNA sequence 5 ' (2596～2615bp); (2733～2725bp); Amplified fragments 167bp.The mrp gene primer is taken from its cDNA sequence 5 ' (4670～4691bp); 3 ' (4988～500bp); Amplification segment 336bp.GST-π gene primer is taken from its cDNA sequence 5 ' (863～882bp); 3 ' (1192～1213bp); Amplified fragments 350bp.(β-actin) gene primer is taken from its cDNA sequence 5 ' (346～367bp) to beta-actin; 3 ' (558～580bp); Amplification segment 234bp.Above-mentioned each primer is Shanghai Medical Univ's hepatopathy institute design, and it is synthetic that worker company is given birth in Shanghai.

Cell total rna extracts inoculating cell 3-5 * 10 ⁵/ bottle, adhere-wall culture 48 hours, to cell growth logarithmic (log) phase, experimental group is given injection Uropoly acid-peptide pharmaceutical composition to final concentration 2mg/ml, 4mg/ml.With matched group co-cultivation after 48 hours, trypsinization, after the PBS washing is centrifugal, adopt guanidinium isothiocyanate, phenol-chloroform one-step method to extract cell total rna.

The reverse transcription-pcr method is got total cellular score RNA 1 μ g, 5 * RT buffer, 4 μ l, 10 μ g/ml oligo (dT), 0.5mmol/LdNTP Mix, 65 pre-degeneration 5min, ice bath 3min adds RNasin 10u, AMV reverse transcriptase 10u, 42 reaction 60min, synthetic cDNA article one chain.Add 10xPCR buffer 2 μ l, MDR1, MRP, GST-π, β-each 10pmol/L of actin primer, Tap archaeal dna polymerase 1u at the above-mentioned cDNA product of 2 μ l, (overall system 20 μ l) carry out pcr amplification.Loop parameter is 95 degeneration 40s, 55 annealing 40s, and 72 extend 1min, 30 circulations, 72 mend flat 10min.

Amplified production 10 μ l, row 2% sepharose electrophoresis, ethidium bromide staining are got in the quantitative analysis of PCR product.Kodak DigitalScience gel imaging system is taken a picture, the content of each band of 1D software quantitative analysis, the change value of calculating MDR1, MRP, GST-π and β-actin.

2. result of the test

2.1 injection Uropoly acid-peptide medicine composition injection is responsive to tumor and the inhibitory action of mdr cell

The results are shown in table 26.Injection Uropoly acid-peptide pharmaceutical composition as can be known is to KB and KB _V200And the sensitivity of H23 and H1435 and drug resistance two class tumor cell lines, equal no significant difference on inhibiting sensitivity.

Table 26 injection Uropoly acid-peptide pharmaceutical composition is to the inhibiting sensitivity of all kinds of tumor cells

Cell strain type i C ₅₀(mg/ml)

KB wild type (non-drug resistance) 2.62

KB _V200VCR drug resistance 2.03

Low (the non-drug resistance) 1.34 of expressing of H23 HER2/neu

H1435 HER2/neu high expressed (drug resistance) 1.38

2.2 the collaborative chemotherapeutic of injection Uropoly acid-peptide pharmaceutical composition is to the influence of drug resistance inversion effect

We are with calcium channel blocker verapamil (Ver), as effective matched group in the experiment.The results are shown in table 27.The Ver of non-as can be known toxic concentration 6 μ g/ml and VCR use in conjunction can effectively reduce KB _V300The IC of cell ₅₀Value is reduced to 0.083 μ mol/L from 4.38 μ mol/L, and the reversing drug resistance multiple is 52 times.And the injection Uropoly acid-peptide pharmaceutical composition of 0.4mg/ml and VCR synergism can strengthen VCR equally to KB _V200The toxicity of mdr cell makes the KB that tolerates VCR _V300The IC of cell ₅₀Value is reduced to 0.266 μ mol/L from 4.38 μ mol/L, and the reversing drug resistance multiple is 16 times.Compare P value＜0.01 with independent VCR effect group.0.8mg/ml and 1.2mg/ml (IC ₂₀, IC ₃₀) injection Uropoly acid-peptide pharmaceutical composition can effectively reverse KB _V200To the tolerance of VCR, Jie's reverse degree is not as 0.4mg/ml (IC ₅₀) the dosage group.

Table 27 injection Uropoly acid-peptide pharmaceutical composition and VCR coupling are to KB _V200Chemical sproof reverse effect

Group injection Uropoly acid-peptide pharmaceutical composition Ver IC ₅₀(μ mol/L ^☆)

mg/ml μg/ml (x±s)

VCR 4.38±3.97

VCR+ injection Uropoly acid-peptide

Pharmaceutical composition 0.4 0.26 ± 0.14 ^*

0.8 0.70±0.44 ^**

1.2 0.64 ± 0.13 ^*VCR+Ver 6 0.08 ± 0.52 ^*☆ refers to IC ₅₀Shi Suoxu VCR concentration, ^*P＜0.01 ^*, compare with independent VCR group

2.3 injection Uropoly acid-peptide pharmaceutical composition is to the influence of MDR1, MRP, the durable medicine related gene expression of GST-π

2.3.1 KB and KB _V200Cell MDR1, MRP, GST-π gene expression

Behind the injection Uropoly acid-peptide pharmaceutical composition effect KB cell 48h of 4mg/ml, all induce MDR1, MRP, GST-π gene weak expression.KB _V200Cell is the gene high expression cell strain, and along with the increase of injection Uropoly acid-peptide pharmaceutical composition dosage, MDR1 expression of gene amount has increase trend, but difference is less.All do not induce MRP and GST-π expression of gene.

2.3.2 H23 and H1435 cell MDR1, MRP, GST-π gene expression H23 and H1435 cell are not all having MRP and GST-π expression of gene before the administration, H23 cell H1435 expression of gene is after injection Uropoly acid-peptide pharmaceutical composition is induced and disappear, and is little to GST-π gene expression influence.Do not see the mrp gene expression before and after the administration.H1435 cell MDR1 and GST-π gene expression amount all increase with injection Uropoly acid-peptide pharmaceutical composition dosage and descend.Do not induce the expression of mrp gene.

Discuss and conclusion

The molecular basis of multi-drug resistance of the tumor is many-sided.Since the long term of antitumor drug, and the inducing cell Expression of Related Genes is unusual with regulation and control, thus cause that the protein relevant with drug resistance changes at structure, function and expression, causes drug resistance.The mechanism that drug resistance produces mainly contains: (1) P-glycoprotein (P-gp) pumps theory, reduces drug accumulation in the cell, expresses relevant excessively with many drug resistant genes (MDR1) and multidrug-associated protein (MRP).(2) by detoxification system in the cell, promote drug metabolism or reduce drug toxicity in the cell, relevant with glutathione S-transferase (GSTs) expression.Therefore, MDR1, MRP and GST-π play an important role in drug resistance.Multi-drug resistance of the tumor reverses, and studying more in recent years is by increasing the cytotoxic effect that medicine accumulating in the MDR cell strengthens chemotherapeutics at P-gp.This experiment is to have the injection Uropoly acid-peptide pharmaceutical composition medicine of antitumor action, at its reverse multiple drug resistance of tumor of research.

We reverse effective matched group, the effect of parallel observations injection Uropoly acid-peptide pharmaceutical composition in drug resistance inversion reaches.The medical herbs PRELIMINARY RESULTS shows that 0.4mg/ml injection Uropoly acid-peptide pharmaceutical composition can increase VCR effectively to KB _V200The toxicity of mdr cell with the VCR synergy, makes KB _V200The IC of cell ₅₀Value is reduced to 0.26 μ mol/L from 4.38 μ mol/L, and the reversing drug resistance multiple is 16 times.KB _V200Be drug resistance (MDR is relevant) cell, its drug resistance mechanism mainly is because the P-glycoprotein is crossed expresses due to the increasing of causing that medicine effluxes ^[1]Our experimental result shows that injection Uropoly acid-peptide pharmaceutical composition does not cause drug resistance KB _V200MDR1 gene generation significant change in the cell does not induce MRP and GST-π gene expression yet.Therefore, only explain that from the angle of MDR1 gene overexpression tumor cell MDR phenomenon is unilateral.The prompting of our experimental result, the multidrug resistance of injection Uropoly acid-peptide pharmaceutical composition reversion MDR mediation may not be the function that relies on P-gp, but participates in other reversing drug resistance approach and bring into play its effect.

Our experiment is also observed, and injection Uropoly acid-peptide pharmaceutical composition has substantial connection to reversion MDR drug-resistant effect and required drug level, when drug level at IC ₅₀When being 0.4mg/ml, the reversing drug resistance effect is the strongest, is better than the high dose concentration of injection Uropoly acid-peptide pharmaceutical composition.The phenomenon that this injection Uropoly acid-peptide pharmaceutical composition dosage increases and the reverse degree reduces, probability is the interaction of injection Uropoly acid-peptide pharmaceutical composition and VCR medicine, has offset the valid density of VCR.

The experimental result of expressing from drug resistant gene shows, injection Uropoly acid-peptide pharmaceutical composition is to human lung carcinoma cell, no matter is that MDR1 and GST-π expression of gene amount increase along with injection Uropoly acid-peptide pharmaceutical composition dosage and weaken or disappear in responsive H23 and the drug resistance H1435 cell.All not inducing mrp gene expresses.This results suggest, injection Uropoly acid-peptide pharmaceutical composition also can have the drug-fast effect of reversing tumor to people's pulmonary carcinoma H1435 drug resistance.

Claims

1. a Uropoly acid-peptide composition is extracted by fresh urine, it is characterized in that wherein mainly containing hippuric acid, phenylacetylglutamine, phenylacetic acid and four kinds of organic acid of heteroauxing, heterogeneity small-molecular peptides and inorganic salt.

2. Uropoly acid-peptide composition according to claim 1, it is characterized in that the content of hippuric acid wherein is that the content of 4.17-7.94mg/ml, phenylacetylglutamine is that the content of 4.87-10.86mg/ml, phenylacetic acid is that the content of 0.66-4.50mg/ml, heteroauxing is 0.11--0.28mg/ml, four kinds of organic acid total contents are 9.81-23.58mg/ml, and percentage composition is: 26.34-57.65.

3. Uropoly acid-peptide composition according to claim 1 is characterized in that pH value is 6.0-8.0.

4. Uropoly acid-peptide composition according to claim 1 is characterized in that residue on ignition is less than 2.0%w/v.

5. Uropoly acid-peptide composition according to claim 1 is characterized in that nitrogen content is not less than 2.0mg/ml.

6. Uropoly acid-peptide composition according to claim 1, it is characterized in that each ionic content is in the inorganic matter: Ca 10--18 μ g/ml, Mg 7--11 μ g/ml, Fe 0.1-1.2 μ g/ml, Zn 0.05-1.5 μ g/ml, Mn 0.02-0.10 μ g/ml, Cu≤0.05 μ g/ml, Cr 0.01-0.08 μ g/ml, Co≤0.1 μ g/ml, Na 3000--8000 μ g/ml, K60--120 μ g/ml, the total content of inorganic elements is 3077.24-8152.01 μ g/ml.

7. Uropoly acid-peptide composition according to claim 1 is characterized in that peptide wherein exists with the form of free amino acid and peptide ammino acid.

8. Uropoly acid-peptide composition according to claim 7, it is characterized in that free aminoacid content is 0.7-1.3mg/ml, hydrolysis total amino acids content is 8.5-11.4mg/ml, and to calculate the peptide ammino acid amount be 7.8-10.9mg/ml, it is 90.6-95.6% that peptide ammino acid accounts for hydrolysis total amino acids amount, total peptide content is about 20.7-26.7%, and small-molecular peptides is one of Uropoly acid-peptide composition master composition.

9. Uropoly acid-peptide composition according to claim 1 is characterized in that in the molecular weight determination spectrogram that three main peaks corresponding molecular weight are respectively 7000--9200,4000-5800, and 1000-2100, the molecular weight of contained polypeptide are all less than 10000 dalton.

10. Uropoly acid-peptide composition solution according to claim 1, it is characterized in that through using the HPLC exclusion chromatography, gel column Protein 60 separates and detects the peptide components of described Uropoly acid-peptide composition solution, get molecular weight 10,000 following heterogeneity small-molecular peptides components, the peptide peak number that obtains is 12-15, two tangible main peaks are wherein arranged, and the retention time of one of characteristic peak is 6.805---7.493, and percentage composition is 15.89--17.56% relatively; Another characteristic peak retention time is 7.722-8.824, and percentage composition is 18.68---19.98% relatively.

11. any one described Uropoly acid-peptide composition of claim 1-10 is used for the treatment of cancer and prevents purposes aspect the cancer return medicine in manufacturing.