CN109091539B - Traditional Chinese medicine extract composition, preparation method and application thereof - Google Patents

Abstract

The invention discloses a traditional Chinese medicine extract composition, a preparation method and application thereof, wherein the traditional Chinese medicine extract composition mainly comprises a corydalis tuber extraction group and an angelica dahurica extract, the composition can be applied to preparation of medicines for reducing expression levels of three genes of Gal, Vip and Clec7a, active ingredients in the medicine composition are mainly protopine, alpha-allocryptopine, tetrahydrocorydaline, dehydrocorydaline, tetrahydroberberine, corydaline, byak-angelicin, imperatorin and isoimperatorin, the content of the active ingredients is obviously increased by reasonably controlling an extraction process, the content of each active ingredient is reasonably proportioned by controlling the content of the corydalis tuber and the angelica dahurica extract, the storage amount of the active ingredients of the medicines is improved, the medicine loss is reduced, and the treatment effect is improved.

Description

Traditional Chinese medicine extract composition, preparation method and application thereof

Technical Field

The invention relates to a traditional Chinese medicine extract composition. Specifically, the composition is prepared from extracts of rhizoma corydalis and radix angelicae dahuricae as raw materials. The invention also relates to a preparation method and application of the traditional Chinese medicine extract composition.

Background

Chronic pain is often described as "immortal cancer" by people, the global incidence rate is 20% -40%, the body, spirit, emotion and psychology of patients can be greatly damaged by pain for a long time, and serious patients can cause serious damage to body functions and even shock. Neuropathic Pain (NP) is a chronic pain syndrome caused by damage to the sensory nervous system, and is intractable pain based on pathological changes of the nerve, which is clinically manifested as hyperalgesia and allodynia. The incidence rate of neuropathic pain is high, the pathogenesis is complex, and the neuropathic pain is a medical problem in the world at present. At present, western medicines are used in clinical analgesic drugs in China, have a large proportion, mainly comprise morphine hydrochloride and dolantin central anesthetics, have definite effects, but have the defects of dependence, easy addiction, easy drug resistance, multiple adverse reactions and the like, so that the western medicines cannot be taken for a long time and need to be managed according to the anesthetics. Finding new drugs for treating neuropathic pain is always one of the difficult and hot problems to be overcome in the current research.

In recent years, neuroinflammation has received increasing attention in the development of neuropathic pain. After the nervous system is damaged, peripheral and central glial cells are rapidly activated to release a large amount of inflammatory factors, and endogenous immune cells are activated, thereby playing a vital role in the occurrence and development of neuropathic pain. Previous studies on neuropathic pain have focused on peripheral and central hyperalgesia neurons sensitization and the role of the associated pathways in their development. However, the pain management regimens currently used to inhibit abnormal neuronal activity do not achieve a sufficiently effective therapeutic effect. Allan et al reported on cells that macrophage production of IL-1 β, TNF- α and IL-6 are important immune regulatory mechanisms in the peripheral regulatory mechanisms that sustain pain. Therefore, attempts to suppress or mitigate the immune response, and reduce the synthesis and release of inflammatory cytokines, may lead to the desired analgesic effect. This may provide new ideas and ways for the treatment of neuropathic pain.

The corydalis tuber analgesic prescription is a clinical proved prescription, is recorded in the Chinese pharmacopoeia of the calendar since 1985, is listed in the national Chinese medicine protection variety and the national basic medicine catalogue, and has definite curative effect. The prescription consists of two traditional Chinese medicines of rhizoma corydalis and angelica dahurica which are processed by vinegar, wherein the rhizoma corydalis in the prescription is a monarch drug which can promote blood circulation, remove blood stasis and regulate qi to alleviate pain, and is known as an excellent analgesic drug by saying that the prescription is specially used for treating various pains in the whole body. The angelica dahurica is an assistant drug, can sooth liver and promote circulation, is compatible with the corydalis tuber which is a medicine for promoting qi circulation, activating blood circulation and relieving pain, and has the function of treating both principal and secondary aspects of diseases on pain caused by qi stagnation and blood stasis. At present, a lot of research units carry out a lot of work on the aspects of chemical components, pharmacokinetics, pharmacological action, quality control and the like of the corydalis tuber analgesic prescription, and the effective component group is obtained through qualitative/quantitative analysis of the components, in vivo process analysis and evaluation of the intestinal absorption liquid on the blood vessel activity, and the compatibility of corydalis tuber and angelica dahurica is found to influence the dissolution, absorption and the like of main chemical components. Researches show that the dissolution amount of tetrahydropalmatine is improved after the combination of corydalis tuber and angelica dahurica compared with that of a single medicine, the influence of the compatibility of corydalis tuber and angelica dahurica on the small intestine absorption of tetrahydropalmatine is examined, and the small intestine absorption of tetrahydropalmatine in the corydalis total alkaloid is found to be a remarkably increased trend within a certain proportion range. As a whole, all the components in the compound traditional Chinese medicine substance group cooperatively play the integral effects of multiple targets, multiple ways and multiple levels in various ways. So far, although a great deal of research reports on chemical components and pharmacology of 2 medicinal materials of corydalis tuber and angelica dahurica exist, a large space still exists for the deep research on the corydalis tuber analgesic prescription. Therefore, the induction, summarization and deep research on the substance basis and action mechanism of analgesic effect of rhizoma corydalis analgesic is carried out by applying the new technology and new method in the fields of modern chemistry and life science, the substance basis, action mechanism and clinical value of the analgesic effect of the rhizoma corydalis analgesic are further explained, and a theoretical basis is provided for the quality control and clinical reasonable application of the rhizoma corydalis analgesic.

The latest research finds that the corydalis tuber analgesic prescription has obvious curative effect on neuropathic pain, and the research considers that the corydalis tuber analgesic prescription is combined with western medicines to have obvious curative effect on treating the herpes zoster neuralgia. Researchers find that a new analgesic component, namely the dehydrocorydaline, is identified from the corydalis tuber, has a better analgesic effect on neuropathic pain, and morphine-like drug resistance does not occur, which is another important finding after the corydalis tuber relays tetrahydropalmatine in the traditional Chinese medicine corydalis tuber, and provides a new basis for treating the neuropathic pain by a corydalis tuber analgesic prescription.

However, few studies aiming at improving the extraction amount of the dehydrocorybulbine in the corydalis tuber have been reported at present, and although the dehydrocorybulbine has proved to have a good analgesic effect on neuropathic pain, the extraction efficiency of the component is low, and even the extraction rate and the yield of the component are not mentioned in the previous reports.

For example, chinese patent application 201110331597.4 discloses a Chinese medicinal extract, its preparation method and its application, wherein the composition comprises extracts obtained from rhizoma corydalis and radix Angelicae Dahuricae respectively. The composition can be used for treating and/or preventing various pains and depression caused by qi stagnation and blood stasis, but the application does not relate to the application of the composition prepared from the extracts of corydalis tuber and dahurian angelica root in preparing the medicines for reducing the expression levels of three genes of Gal, Vip and Clec7a, and does not disclose that the composition can treat neuropathic pain.

For another example, chinese patent application 2010102347009 discloses a rhizoma corydalis pain-relieving drop pill preparation and its preparation process, wherein the preparation comprises the following raw materials: the weight ratio of the vinegar processed rhizoma corydalis, the angelica dahurica, the clove oil and the angelica oil is 1: 0.01: 0.002-3: 1: 0.05: 0.01. Meanwhile, the invention also discloses a preparation process of the preparation. The preparation of the invention has the advantages of fast dissolution, fast absorption, fast effect, stable and lasting effect on relieving various pains, has the functions of regulating qi, activating blood and relieving pains, and can be used for treating stomachache, hypochondriac pain, headache, menstrual pain and other symptoms caused by qi stagnation and blood stasis. The traditional Chinese medicine composition disclosed in the application also does not disclose the application of the composition in preparing medicines for reducing the expression levels of three genes of Gal, Vip and Clec7a, and does not disclose the composition in treating neuropathic pain.

Aiming at the problems, the traditional Chinese medicine composition is provided, and can be applied to the preparation of medicines for reducing the expression levels of three genes, namely Gal, Vip and Clec7a, so that the effective treatment of neuropathic pain has important significance for scientific experiments and the research and development of innovative medicines.

Disclosure of Invention

In order to solve the above-mentioned technical problems, the present invention aims to provide an application of a traditional Chinese medicine extract composition in the preparation of a medicament for treating and preventing chronic pain, wherein the traditional Chinese medicine composition comprises a corydalis extract and an angelica dahurica extract;

the application is the application in preparing the medicine which can lead the expression level of three genes of Gal, Vip and Clec7a to be reduced;

the corydalis tuber extract comprises the following effective components in percentage by mass: 0.0008-0.0270% of protopine, 0.0002-0.0205% of alpha-allocryptopine, 0.020-0.069% of tetrahydropalmatine, 0.0001-0.001% of dehydrocorydaline, 0.0001-0.0096% of tetrahydroberberine and 0.0013-0.0908% of corydaline;

the angelica dahurica extract comprises the following effective components in percentage by mass: 0.001-0.010% of byak-angelicin, 0.039-0.094% of imperatorin and 0.017-0.045% of isoimperatorin.

The preparation method of the traditional Chinese medicine extract comprises the following steps:

the preparation method of the corydalis tuber extract comprises the following steps: subjecting rhizoma corydalis powder to microwave irradiation under vacuum condition, soaking with solution 1 without residue separation, heating and refluxing the residue and soaking solution, separating the residue, and collecting the solution as extractive solution 1; soaking the residue in the solution 1 again, heating and refluxing the residue and the soaking solution again, separating the residue, collecting the solution part as an extract 2, combining the extract 1 and the extract 2, filtering, concentrating the filtrate, purifying the filtrate with ion exchange resin to obtain a purified product 1, vacuum drying the purified product 1, pulverizing, and sieving to obtain rhizoma corydalis extract; the solution 1 is a mixed solution of ethanol and acetic acid.

The preparation method of the angelica dahurica extract comprises the following steps: irradiating radix Angelicae Dahuricae powder with microwave under vacuum, soaking with ethanol water solution, heating and refluxing the residue and soaking solution, separating the residue, and collecting the solution as extractive solution 3; soaking the residue in ethanol water solution again, heating the residue and the soaking solution again for reflux, separating the residue, collecting the solution part as extract 4, mixing extract 3 and extract 4, filtering, concentrating the filtrate, purifying the filtrate with macroporous adsorbent resin to obtain purified product 2, vacuum drying the purified product 2, pulverizing, and sieving to obtain radix Angelicae Dahuricae extract.

Wherein, in the preparation method of the corydalis tuber extract, the microwave irradiation time is 10-20 minutes; the adding weight of the solution 1 is 1-4 times of that of the corydalis tuber powder; the volume ratio of ethanol to acetic acid in the solution 1 is 10: 7-9; the first soaking time is 20-50 minutes; the soaking time is 10-30 minutes; the first heating reflux time is 1-3 hours; the weight of the added solution 1 after the re-refluxing is 1-2 times of that of the corydalis tuber powder; the reheating reflux time is 1-2 hours.

In the preparation method of the angelica dahurica extract, the microwave irradiation time is 10-20 minutes; the adding weight of the ethanol water solution is 3-5 times of that of the angelica dahurica powder; the volume percentage of the ethanol in the ethanol water solution is 40-80%; the first soaking time is 30-50 minutes; the re-soaking time is 20-30 minutes; the first heating reflux time is 2-4 hours; the weight of the ethanol water solution added in the reheating reflux is 3-5 times of the radix angelicae powder; the reheating reflux time is 1-3 hours.

Further, the preparation method of the traditional Chinese medicine composition comprises the following steps:

the preparation method of the corydalis tuber extract comprises the following steps: carrying out microwave irradiation on the corydalis tuber powder for 10-20 minutes under the vacuum condition, and then carrying out microwave irradiation on the corydalis tuber powder by using a volume ratio of 10: 7-9 of mixed solution of ethanol and acetic acid, soaking for 12-24 hours without separating dregs, heating and refluxing the dregs and the soak solution for 2-5 hours, separating dregs, and collecting the solution part as an extracting solution 1; then adding 1-2 times of the weight of the dregs of a decoction in a volume ratio of 10: 7-9 of mixed solution of ethanol and acetic acid, soaking for 5-8 hours, heating and refluxing the decoction dregs and the soak solution for 1-3 hours again, collecting an extracting solution 2, combining the extracting solution 1 and the extracting solution 2, filtering, concentrating the filtrate, purifying the filtrate by using ion exchange resin to obtain a purified product 1, drying the purified product 1 in vacuum, crushing and sieving to obtain a corydalis tuber extract; the solution 1 is a mixed solution of ethanol and acetic acid.

The preparation method of the angelica dahurica extract comprises the following steps: performing microwave irradiation on the radix angelicae powder for 10-20 minutes under a vacuum condition, then soaking the radix angelicae powder in an ethanol water solution which is 3-5 times the weight of the radix angelicae powder and has a volume percentage of 40-80% for 12-24 hours, carrying out no medicine residue separation, heating and refluxing medicine residues and a soaking solution for 2-4 hours, separating the medicine residues, and collecting a solution part as an extracting solution 3; and adding ethanol aqueous solution which is 3-5 times of the weight of the medicine residues and 40-80% of the volume percentage, soaking for 5-8 hours, heating and refluxing the medicine residues and the soaking solution for 1-3 hours again, separating the medicine residues, collecting a solution part as an extracting solution 4, combining the extracting solution 3 and the extracting solution 4, filtering, concentrating the filtrate, purifying the filtrate by adopting macroporous adsorption resin to obtain a purified product 2, drying the purified product 2 in vacuum, crushing and sieving to obtain the angelica dahurica extract.

The frequency of the microwave irradiation is 300-500 MHz; preferably 350-450 MHz; further preferably 400 MHz.

The corydalis tuber and angelica dahurica extract in the traditional Chinese medicine extract composition are mixed according to the weight parts of 10-120: 5-60. Preferably 20 to 100: 15-55; more preferably 30 to 80: 20-40.

The traditional Chinese medicine extract composition can also comprise any pharmaceutically acceptable carrier, and the carrier comprises one or more of diluent, excipient, filler, wetting agent, disintegrating agent, flavoring agent, adhesive and the like.

The medicine for preventing chronic pain can be prepared into any pharmaceutically acceptable dosage form, and the dosage form is injection, infusion solution, mixture, tablet, hard capsule, soft capsule, pill, dripping pill or granule.

The chronic pain is neuropathic pain.

The chronic pain is one or more of Diabetic Peripheral Neuropathy (DPN), chronic lumbar muscle strain, sciatic nerve pain, chronic pelvic pain, postherpetic neuralgia (PHN), trigeminal neuralgia, glossopharyngeal neuralgia, postoperative neuropathy, posttraumatic neuropathy, cervical, thoracic or lumbosacral radiculopathy, multiple neuropathy caused by chemotherapy, phantom limb pain, carpal tunnel syndrome, poststroke neuralgia, post-spinal cord injury pain, multiple sclerosis related pain, Parkinson disease related pain, post-ischemic myelopathy, compressive myelopathy, HIV myelopathy, post-radiation myelopathy, cancer infiltration pain and bone cancer pain.

The traditional Chinese medicine extract composition is prepared by following the traditional proved formula-rhizoma corydalis pain relieving formula and determining the effective components in the rhizoma corydalis and the radix angelicae dahuricae by using modern science and technology, and the unexpectedly found that the traditional Chinese medicine composition prepared by controlling the mass ratio of the effective components in the two medicines has better effect on treating and preventing chronic pain, especially neuropathic pain compared with the traditional formula preparation.

Compared with the prior art, the invention has the beneficial effects that:

(1) the invention changes the traditional extraction process, firstly carries out microwave irradiation on the crude drugs of the corydalis tuber and the angelica dahurica in the process of extracting the drug, and unexpectedly finds that the dissolution rate of the effective components of the corydalis tuber extracted by microwave irradiation and reflux of ethanol-acetic acid mixed solution is obviously increased, thereby obviously improving the treatment effect of the drug composition.

(2) In the implementation process, the invention unexpectedly discovers that the effective components are reasonably proportioned by controlling the content of the extracts of the corydalis tuber and the angelica dahurica, the storage amount of the effective components of the medicine is improved, the medicine loss is reduced, and the treatment effect is improved.

(3) The traditional Chinese medicine composition prepared by the application has a good analgesic effect on neuropathic pain, does not generate drug resistance, and is especially applied to preparation of drugs for reducing expression levels of three genes, namely Gal, Vip and Clec7 a.

(4) The preparation method of the traditional Chinese medicine composition provided by the invention has the advantages of short production period, simple production process, convenience in operation, no need of special equipment and suitability for industrial mass production.

Drawings

FIG. 1 is a comparison of different experimental groups on the threshold value of mechanical pain on the affected side;

FIG. 2 comparison of contralateral mechanical pain thresholds for different experimental groups;

FIG. 3 effect of different experimental groups on the lateral thermal pain threshold;

figure 4 effect of different experimental groups on contralateral thermal pain threshold.

Wherein, compared to Sham group, denotes P <0.05, denotes P < 0.01; compared to CCI group, # denotes P <0.05, # denotes P < 0.01;

the arrow with day after surgery indicates the start of dosing, and the arrow with day 14 after surgery indicates the stop of dosing;

FIG. 5 is a comparative SDS-PAGE image of the target gene Clec7 a;

wherein SC represents bone marrow; DRG denotes dorsal root ganglia.

FIG. 6A graph comparing immunofluorescence of Clec7a gene expression on contralateral and affected sides in spinal cord dorsal horn negative experimental group (CCI), experimental group (CCI + YZP) and Sham experimental group (Sham).

FIG. 7 comparison of immunofluorescence of negative experimental group (CCI), experimental group (CCI + YZP) and Sham experimental group (Sham) for Clec7a gene expression on contralateral and affected sides.

Detailed Description

The following examples are provided to further illustrate the composition of the present invention. The following examples are merely illustrative of the invention and are not to be construed as limiting thereof.

Unless otherwise specified, the experimental procedures in the following examples are conventional procedures well known to those skilled in the art; the reagents and test materials are commercially available.

The corydalis tuber and the angelica dahurica used in the following embodiments are in accordance with the related regulations under each medicinal material item in the text of the first edition of pharmacopoeia of the people's republic of China in 2005. Through identification, the names of the medicinal materials are consistent with those of real objects, and the quality of the medicinal materials is consistent with pharmacopeia standards.

1. Preparation of the Chinese medicinal extract composition of the present invention

1.1 materials

Rhizoma corydalis is purchased from Wanqiang Chinese medicinal materials sales Limited company in Anguo, lot number 1410018165; radix Angelicae Dahuricae is purchased from Wanqiang Chinese medicinal materials marketing limited company, Anguo, under the batch number of 1410011142.

NaOH (analytical grade); absolute ethanol (analytically pure); ammonia (analytically pure); hydrochloric acid (analytically pure); purified water (Hangzhou child haha group ltd); 732 type cation exchange resin (Shanghai Huizhu resin Co., Ltd.); d101-1 type macroporous resins (Amishi Samsung resin science and technology Co., Ltd.).

1.2 extract preparation example

Example 1

Corydalis Tuber extract 1

Taking 500g of rhizoma corydalis, and placing the rhizoma corydalis in a microwave irradiation box for irradiating for 15 minutes; soaking in 3 times of mixed solution of ethanol and acetic acid (volume ratio of 10: 7.5) for 15 hr, heating and refluxing for 3 hr, collecting extractive solution, adding 2 times of mixed solution of ethanol and acetic acid (volume ratio of 10: 7.5), soaking for 5 hr, heating and refluxing for 1.5 hr, collecting extractive solution, mixing extractive solutions, filtering, concentrating filtrate, and wet packing with 732 type cation exchange resin at a diameter-height ratio of 1: and 10, sampling, wherein the sampling amount is that the volume ratio of the corydalis tuber medicinal material to the resin is 1:1 (g/mL), and removing impurities by using 5BV of purified water at the elution speed of 1 mL/min. Eluting with 5BV 70% ethanol containing ammonia water at an elution rate of 1mL/min, recovering solvent, drying under reduced pressure to obtain extract, pulverizing, and sieving to obtain rhizoma corydalis extract 1.

Angelica dahurica extract 1

Taking 500g of radix angelicae powder, and placing the radix angelicae powder into a microwave irradiation box for irradiation for 20 minutes; adding 4 times of 60% ethanol water solution, soaking for 15 hours, heating and refluxing for 4 hours, collecting the extract, adding 3 times of 60% ethanol water solution, soaking for 6 hours, heating and refluxing for 2 hours, collecting the extract, combining the two extracts, filtering, concentrating the filtrate, packing the filtrate in a D101-1 type macroporous resin wet method, loading, standing and adsorbing for 30 minutes, removing impurities by using 10% ethanol with 3BV at the flow rate of 1mL/min, removing the impurity liquid, eluting by using 30% ethanol solution with 0.5% NaOH with 3BV, collecting the eluent, adjusting the pH to 3-4 by using dilute hydrochloric acid, drying in vacuum, washing by using absolute ethanol, recovering the solvent, drying under reduced pressure to obtain an extract, crushing, sieving to obtain the angelica extract 1.

Example 2

Corydalis Tuber extract 2

Taking 500g of rhizoma corydalis, and placing the rhizoma corydalis into a microwave irradiation box to irradiate for 15 minutes at the irradiation frequency of 400 MHz; soaking with 4 times of mixed solution of ethanol and acetic acid (volume ratio of 10: 8) for 20 hr, heating and refluxing for 4 hr, collecting extractive solution, adding 1.5 times of mixed solution of ethanol and acetic acid (volume ratio of 10: 8) and soaking for 7 hr, heating and refluxing for 2 hr, collecting extractive solution, mixing extractive solutions, filtering, concentrating filtrate, and wet packing with 732 type cation exchange resin column with diameter-height ratio of about 1: and 10, sampling, wherein the volume ratio of the corydalis tuber medicinal material to the resin is 1:1 (g/mL), and removing impurities by using 3BV of purified water at the elution speed of 0.8 mL/min. Eluting with 70% ethanol containing ammonia water of 3BV at an elution rate of 1mL/min, recovering solvent, drying under reduced pressure to obtain extract, pulverizing, and sieving to obtain rhizoma corydalis extract 2.

Radix Angelicae Dahuricae extract 2

Taking 500g of radix angelicae powder, and placing the radix angelicae powder into a microwave irradiation box for irradiation for 18 minutes at the irradiation frequency of 420 MHz; adding 5 times of 50% ethanol aqueous solution, soaking for 12 hours, heating and refluxing for 3 hours, collecting the extract, adding 4 times of 60% ethanol aqueous solution, soaking for 7 hours, heating and refluxing for 2.5 hours, collecting the extract, combining the two extracts, filtering, concentrating the filtrate, packing the filtrate into a column by adopting a D101-1 type macroporous resin wet method, loading, standing and adsorbing for 30 minutes, removing impurities by using 10% ethanol with 3BV at the flow rate of 0.8mL/min, discarding the impurity solution, eluting by using 30% ethanol solution with 0.5% NaOH with 3BV, collecting the eluent, adjusting the pH to 3-4 by using dilute hydrochloric acid, vacuum drying, washing by using absolute ethanol, recovering the solvent, drying under reduced pressure to obtain an extract, crushing, and sieving to obtain the angelica dahurica extract 1.

Example 3

Corydalis Tuber extract 3

Taking 500g of rhizoma corydalis, and placing the rhizoma corydalis into a microwave irradiation box to irradiate for 20 minutes at the irradiation frequency of 400 MHz; soaking with 5 times of mixed solution of ethanol and acetic acid (volume ratio of 10: 9) for 18 hr, heating and refluxing for 3 hr, collecting extractive solution, adding 2 times of mixed solution of ethanol and acetic acid (volume ratio of 10: 9) and soaking for 8 hr, heating and refluxing for 3 hr, collecting extractive solution, mixing extractive solutions, filtering, concentrating filtrate, wet packing with 732 type cation exchange resin column with diameter-height ratio of about 1: 10, loading, wherein the loading amount is that the volume ratio of the corydalis tuber medicinal material to the resin is 1:1 (g/mL), purified with 3BV of purified water at an elution rate of 0.8 mL/min. Eluting with 70% ethanol containing ammonia water of 3BV at an elution rate of 1mL/min, recovering solvent, drying under reduced pressure to obtain extract, pulverizing, and sieving to obtain rhizoma corydalis extract 2.

Angelica dahurica extract 3

Taking 500g of radix angelicae powder, and placing the radix angelicae powder into a microwave irradiation box to irradiate for 15 minutes at the irradiation frequency of 450 MHz; adding 4 times of 70% ethanol aqueous solution, soaking for 15 hours, heating and refluxing for 4 hours, collecting an extracting solution, adding 3 times of 80% ethanol aqueous solution, soaking for 5 hours, heating and refluxing for 3 hours, collecting an extracting solution, combining the extracting solutions, filtering, concentrating a filtrate, performing wet column packing by using D101-1 type macroporous resin, loading, standing and adsorbing for 30 minutes, removing impurities by using 10% ethanol with the volume ratio of 3BV and the flow rate of 0.8mL/min, removing the impurity liquid, eluting by using 30% ethanol solution with the volume ratio of 0.5% NaOH with the volume ratio of 3BV, collecting an eluent, adjusting the pH value to 3-4 by using dilute hydrochloric acid, performing vacuum drying, washing by using absolute ethyl alcohol, recovering a solvent, performing reduced pressure drying to obtain an extract, crushing, and sieving to obtain the angelica dahurica extract 1.

1.3 preparation example of Chinese medicine extract composition

Composition A preparation examples

Taking the corydalis tuber extract 1 and the angelica dahurica extract 1, wherein the weight ratio of the corydalis tuber extract 1 to the angelica dahurica extract 1 is 10: 60 mixing the two extracts, adding pharmaceutically acceptable carrier, and granulating to obtain composition A.

Wherein the content of each active ingredient in the pharmaceutical composition A is as follows: 0.0150% of protopine, 0.0125% of alpha-allocryptopine, 0.039% of tetrahydropalmatine, 0.0007% of dehydrocorydaline, 0.0056% of tetrahydroberberine, 0.0623% of corydaline, 0.0072% of byak-angelicin, 0.066% of imperatorin and 0.034% of isoimperatorin.

Composition B preparation examples

Mixing the above rhizoma corydalis extract 2 and radix Angelicae Dahuricae extract 2 at a weight ratio of 120: 5, adding pharmaceutically acceptable vehicle, and granulating to obtain composition B.

Wherein the content of each active ingredient in the pharmaceutical composition B is as follows: 0.0210% of protopine, 0.0152% of alpha-allocryptopine, 0.042% of tetrahydropalmatine, 0.0005% of dehydrocorydaline, 0.0068% of tetrahydroberberine, 0.0580% of corydaline, 0.0023% of byak-angelicin, 0.048% of imperatorin and 0.026% of isoimperatorin.

Composition C preparation examples

Taking the corydalis tuber extract 3 and the angelica dahurica extract 3, wherein the weight ratio of the corydalis tuber extract 3 to the angelica dahurica extract 3 is 80: 40 mixing the two extracts, adding pharmaceutically acceptable carrier, and granulating to obtain composition C.

Wherein the content of each active ingredient in the pharmaceutical composition C is as follows: 0.0208% of protopine, 0.0132% of alpha-allocryptopine, 0.053% of tetrahydropalmatine, 0.0003% of dehydrocorydaline, 0.0052% of tetrahydroberberine, 0.0865% of corydaline, 0.0096% of byak, 0.052% of imperatorin and 0.032% of isoimperatorin.

Test example 1 application of the Chinese medicinal composition in the preparation of a medicament for treating chronic pain

1. Laboratory animal

Male SD rats (160-180 g) purchased from Experimental animals technology, Inc., Vitongli, Beijing. The experimental animals are raised in an independent environment with 12h/12h day and night alternation, the room temperature is maintained at 23 +/-1 ℃, the humidity is 55-65%, the animals can freely eat and drink water, and the experiment is started after the animals are adapted to the environment for 2 days. All procedures for animal treatment were in compliance with the ethical committee of the international association for pain research, and all experiments were approved by the association for animal protection.

2. Preparation of the model

CCI model: the rats were anesthetized by intraperitoneal injection of pentobarbital (50 mg/kg), the hair in the middle of the left hind leg was removed, and the lateral decubitus position was taken to expose the left lateral leg. At 1/2 in the middle of the left femur, the left femur was first sterilized with iodine, then deiodinated with 75% alcohol, and a 1cm incision was made 0.5cm posterior to the long axis of the femur, and the muscles were bluntly dissected, leaving the thick sciatic nerve exposed in the center of the opening, and the surrounding mucosa and tissue were carefully dissected with a glass needle to free the smooth sciatic nerve trunk around 1 cm. Uniformly ligating 4 catgut lines on sciatic nerve trunk with interval of 1mm, and fixing with positive and negative buttons, wherein the ligation strength is preferably slight vibration of thigh muscle or slight vibration of left foot. The left foot was then carefully pulled to return the ligated sciatic nerve to its original position, the skin was sutured and disinfected with 75% alcohol.

Sham (Sham) group: the procedure was the same as in CCI group except that sciatic nerve was not ligated.

3. Test method

Male SD rats were grouped, 20 rats per group:

(1) negative control group: CCI group, CCI model rats, given 0.9% saline;

(2) positive control group: in CCI model rats, gabapentin (gab) as a positive drug is administered at a concentration of 100mg/kg body weight in 0.9% physiological saline;

(3) experimental groups: the CCI + YZP group, CCI model rats, were administered the pharmaceutical compositions (A-C) prepared in examples 1-3 of the present invention at a concentration of 0.99g/kg body weight in 0.9% physiological saline;

(4) the sham operation group: sham group, rats were given 0.9% saline.

All groups were administered by gavage at 1.0ml/100 g.

Changes in mechanical and thermal allodynia induced by CCI were examined over 14 days of continuous dosing and one week of discontinuation. On the day of surgery, the animals were immediately gavaged after waking, and were continuously administered for 14 days, and left and right side foot mechanical and thermal pain thresholds were measured on day 3 before surgery, day 1 after surgery, and day 1, 3, 5, 7, 10, 14, 16, 18, and 21 after surgery.

4. Behavioural test

4.1 mechanical allodynia test

In a quiet constant temperature and humidity environment, a rat is placed in a transparent organic glass box with the size of 20cm multiplied by 12cm, the bottom of the rat is a hollow metal grid with the size of 1cm multiplied by 1cm, the rat can normally move in the glass box, and the measurement can be started after the rat is adapted to be quiet for about 15 min. The middle surface of the plantar of the hind limb of the rat is vertically stimulated by an electronic von Frey pain tester for 2-5 seconds, if the rat has the phenomena of foot contraction, foot lifting or foot licking, the value of the intensity displayed on a computer is recorded as a Mechanical foot contraction reflex threshold (MWT), and each rat is stimulated at intervals of 30 seconds by repeating 6-8 times. Data and operators were recorded as different persons and guaranteed to be operated as one person in a 21-day trial.

4.2 detection of thermal hyperalgesia

In a quiet constant temperature and humidity environment, rats were placed in a 20cm x 12cm clear perspex box with a smooth clear glass plate at the bottom to ensure that no fecal matter on the glass plate interferes with the experimental results during the measurement. The rat can move normally in the glass box, and the measurement can be started after the rat adapts to the rest for about 15 min. The thermal radiation stimulator is used for vertically irradiating the hind limb sole of the rat slightly behind the hind limb sole. When the rat has the phenomena of foot contraction, foot lifting or foot licking, the incubation period of the heat-shrinkable foot is taken. In order to prevent the soles of the rats from being scalded, the upper limit value is set to be 20 seconds, namely if the rats still do not lift, shake or move the feet for more than 20 seconds, the thermal radiation instrument is automatically switched, and the PWL value is recorded to be 20 seconds. Irradiating each foot for 5 times at intervals of 5-6 min. The intensity of the heat radiation was set to cause the normal rats to contract feet within 9-14 seconds and the same intensity of the heat stimulus was maintained throughout the experiment.

5. Results of the experiment

5.1 mechanical allodynia detection

As can be seen from the attached figure 1, the action trend of the traditional Chinese medicine composition A prepared in the embodiment 1 of the application on the mechanical pain threshold of CCI animals is that the threshold is firstly reduced and then increased and maintained at a certain level, and the threshold is reduced after the medicine is stopped. 0.99g/kg of A starts to take effect on the fifth day after operation and maintains the drug effect during the administration period, the effect on the mechanical pain threshold value is weakened after the drug is stopped, and the analgesic effect disappears on the seventh day after the drug is stopped, while as can be seen from figure 2, A has almost no influence on the mechanical pain threshold value on the opposite side of the operation.

After the positive medicine gabapentin is administrated, the threshold value is gradually increased on the fifth day and has a significant difference compared with the negative control group, and the medicine effect starts to be stable on the seventh day after operation and is maintained during the administration period. Once the drug is stopped, the threshold value is gradually reduced, and gab does not have any influence on the normal animal or the contralateral undamaged sole mechanical pain threshold value from the fourth day after the drug is stopped (figure 1 and figure 2).

5.2 detection of thermal hyperalgesia

Within one week after the operation, the positive gab and the traditional Chinese medicine composition A prepared in the embodiment 1 have no obvious difference on the thermal pain threshold induced by CCI compared with the CCI model, the pain threshold starts to gradually rise from three days, the thermal pain threshold can be obviously improved from the tenth day to the administration period, the drug effect is gradually lost after the drug is stopped and stably maintained for two days (figure 3), and the gab for gastric lavage and the A have no obvious difference on the thermal pain threshold of the operation (figure 4).

6. Conclusion

Aiming at a CCI model group, after the positive medicine gabapentin and the traditional Chinese medicine composition A prepared in the embodiment 1 of the invention are administrated, the pain threshold value is obviously increased, and the pain threshold value and the traditional Chinese medicine composition A show a relatively consistent action trend, namely the pain threshold value of animals is steadily increased from the third day of administration, the pain threshold value is reduced after the administration is stopped, but the medicine effect is still better within at least two days after the administration is stopped. However, the comparison shows that the analgesic effect of the traditional Chinese medicine composition A prepared in the embodiment 1 of the invention is slowly weakened and shows a trend of being stronger than that of a positive medicine after the medicine is stopped, which indicates that the traditional Chinese medicine composition A prepared in the embodiment 1 of the invention has the characteristics of mild and lasting treatment.

Experimental example 2 mechanism of action of the Chinese medicinal composition in preparing a medicament for treating chronic pain

The traditional Chinese medicine composition C prepared in the embodiment 3 of the application can influence the expression level of genes in dorsal root ganglia of a chronic stress injury model, particularly three gene expression levels of Gal, Vip and Clec7 a.

7 genes (Gal, Vip, Clec7a, Cckbr, Cryba2, Ccr2 and Mmp 12) which are directly related to pain or have potential relation and are up-regulated and down-regulated by a model are selected firstly as candidate targets for researching neuropathic pain induced by chronic compression injury of sciatic nerve by preparing a traditional Chinese medicine composition C in example 3 of the application.

1. Animal experiments

SPF grade male SD rats weighing 180-. SD rats can drink water and eat food freely, and the experiment can be started after the animals adapt to the environment for 3 days. The whole experiment is carried out under the conditions of constant temperature (23 +/-1 ℃) and constant humidity (50-65%).

2. Preparation of the model

The same as pharmacodynamic test method.

3. Selection of dorsal root ganglion and spinal cord

The method comprises the steps of lying a rat after abdominal anesthesia, cutting a backbone of a thoracic rib section, dissociating and pulling out spinal nerves L4-L6 on an affected side, cutting an expanded part of the spinal nerves L4-L6 by using a knife, immediately rinsing the rat, blowing out a spinal cord from the spine by using an injector, cutting the expanded affected side part by about 0.5cm by using a small knife, immediately putting the rat into a cryopreservation tube, paying attention to the fact that the cap of the cryopreservation tube cannot be screwed too tight, avoiding bursting during taking out, and putting the rat into liquid nitrogen for long-term storage.

4. Extraction of RNA: conventional methods in the art.

5. Designing a PCR primer: conventional methods in the art.

TABLE 1 PCR primer sequences

Serial number	Primer name	Sequence (5 '-3')
			1	Q-Gal-F	CAGCGTTATCCTGCTAGCCT
2	Q-Gal-R	GGTTGTCAATGGCATGTGGG
			3	Q-Vip-F	TTGCAGAATGCCTTAGCGGA
4	Q-Vip-R	TTGCTTTCTAAGGCGGGTGT
			5	Q-Clec7a-F	TTCGGCACTCGAAACATCCA
6	Q-Clec7a-R	AGGGAGCCACCTTCTCATCT
			7	Q-Cckbr-F	GCGGAAACGTGCTCATCATC
8	Q-Cckbr-R	GGGCTATGGCCACGAGATTT
			9	Q-Cryba2-F	TGGGTTCCCTCAAAGTCAGC
10	Q-Cryba2-R	TGTAGGTACGGAACTCCCCA
			11	Q-Ccr2-F	TCAGGAATCCTCCACACCCT
12	Q-Ccr2-R	CTGCATGGCCTGGTCTAAGT
			13	Q-Mmp12-F	CAATTTCTTCCATGTGGCCAAC
14	Q-Mmp12-R	CCTGCCTCACATCGTACCTC

6. Reverse transcription: conventional methods in the art.

7. Real-time fluorescent quantitative PCR (FQ-PCR) amplification: conventional methods in the art.

8. And (4) analyzing results: the expression quantity ratio R = 2-delta Ct method is adopted for calculation.

9. Results of the experiment

DRG total RNA of each group of rats is extracted, the concentration of the total RNA is all 220-380 ng/mL, and the OD260/OD280 value is all 1.8-2.0, which indicates that the purity of the RNA is qualified and can be used for subsequent experiments.

10. Analysis of FQ-PCR results

From the FQ-PCR experiment results table 2, it can be seen that, in the P <0.05 level, three targets, namely Gal, Vip and Clec7a, are significantly increased in the gene expression level, and the decrease in the experimental group is statistically significant, whereas the four target genes, namely Ccr2, Cryba2, Mmp12 and Cckbr, are significantly upregulated in the negative control group, and the gene expression in the experimental group is significantly decreased, but compared with the sham group, the significant increase in the negative control group is statistically significant, and compared with the negative control group, the experimental group has no statistical significance in the P <0.05 level.

TABLE 2 comparison of the sham-operated group, the negative control group and the experimental group, the difference of gene expression level and T detection

Target gene	Negative control group/sham operation group	Experimental group/sham operation group	Negative control/experimental group	T test (negative control VS sham operation group)	T test (VS negative control group of experimental group)
						Gal	60.728	28.647	2.120	0.0008	0.0494
Vip	128.901	97.549	1.321	0.0003	0.0384
						Cckbr	38.766	26.260	1.476	0.0003	0.0774
Clec7a	6.909	4.499	1.536	0.0001	0.0446
						Ccr2	3.248	2.575	1.262	0.0008	0.3802
Cryba2	7.385	5.579	1.324	0.0002	0.0669
						Mmp12	45.241	36.084	1.254	0.0001	0.3985

However, the above description is only a preferred embodiment of the present invention, and should not be taken as limiting the scope of the invention, which is intended to cover all the modifications and equivalents of the claims and the specification. In addition, the abstract and the title are provided to assist the patent document searching and are not intended to limit the scope of the invention.

Claims (5)

1. A traditional Chinese medicine extract composition for treating neuropathic pain induced by chronic compression injury of sciatic nerve is prepared from a corydalis tuber extract and an angelica dahurica extract, and is characterized in that: taking the rhizoma corydalis extract and the radix angelicae extract, wherein the weight ratio of the rhizoma corydalis extract to the radix angelicae extract is 10: 60 mixing the two extracts, adding pharmaceutically acceptable carrier, and granulating;

the preparation method of the corydalis tuber extract comprises the following steps: taking 500g of rhizoma corydalis, and placing the rhizoma corydalis in a microwave irradiation box for irradiating for 15 minutes; soaking the raw materials in a mixed solution of ethanol and acetic acid with a volume ratio of 3 times of 10:7.5 for 15 hours, heating and refluxing for 3 hours, collecting an extracting solution, then adding a mixed solution of ethanol and acetic acid with a volume ratio of 2 times of 10:7.5, soaking for 5 hours, heating and refluxing for 1.5 hours, collecting the extracting solution, combining the extracting solutions, filtering, concentrating the filtrate, and packing the filtrate into a column by adopting a 732 type cation exchange resin wet method, wherein the diameter-height ratio is about 1: 10, sampling, wherein the sampling amount is that the volume ratio of the corydalis tuber medicinal material to the resin is 1:1g/mL, and removing impurities by using 5BV of purified water at the elution speed of 1 mL/min; eluting with 5BV 70% ethanol containing ammonia water at an elution rate of 1mL/min, recovering solvent, drying under reduced pressure to obtain extract, pulverizing, and sieving to obtain rhizoma corydalis extract;

the preparation method of the angelica dahurica extract comprises the following steps: taking 500g of radix angelicae powder, and placing the radix angelicae powder into a microwave irradiation box for irradiation for 20 minutes; adding 4 times of 60% ethanol water solution, soaking for 15 hours, heating and refluxing for 4 hours, collecting an extracting solution, adding 3 times of 60% ethanol water solution, soaking for 6 hours, heating and refluxing for 2 hours, collecting an extracting solution, combining the extracting solutions, filtering, concentrating a filtrate, performing wet column packing by using a D101-1 type macroporous resin, loading, standing and adsorbing for 30 minutes, removing impurities by using 10% ethanol with 3BV at the flow rate of 1mL/min, removing the impurity solution, eluting by using 30% ethanol solution with 0.5% NaOH with 3BV, collecting an eluent, adjusting the pH to 3-4 by using dilute hydrochloric acid, performing vacuum drying, washing by using absolute ethanol, recovering a solvent, performing reduced pressure drying to obtain an extract, crushing, and sieving to obtain an angelica dahurica extract;

the composition comprises the following active ingredients in percentage by weight: 0.0150% of protopine, 0.0125% of alpha-allocryptopine, 0.039% of tetrahydropalmatine, 0.0007% of dehydrocorydaline, 0.0056% of tetrahydroberberine, 0.0623% of corydaline, 0.0072% of byak-angelicin, 0.066% of imperatorin and 0.034% of isoimperatorin.

2. A traditional Chinese medicine extract composition for treating neuropathic pain induced by chronic compression injury of sciatic nerve is prepared from a corydalis tuber extract and an angelica dahurica extract, and is characterized in that: taking the corydalis tuber extract and the angelica dahurica extract, and mixing the corydalis tuber extract and the angelica dahurica extract according to the weight ratio of 120: 5 mixing the two extracts, adding pharmaceutically acceptable carrier, and granulating;

the preparation method of the corydalis tuber extract comprises the following steps: taking 500g of rhizoma corydalis, and placing the rhizoma corydalis into a microwave irradiation box to irradiate for 15 minutes at the irradiation frequency of 400 MHz; soaking in a mixed solution of ethanol and acetic acid with a volume ratio of 4 times of 10:8 for 20 hours, heating and refluxing for 4 hours, collecting an extracting solution, then adding a mixed solution of ethanol and acetic acid with a volume ratio of 1.5 times of 10:8 for soaking for 7 hours, heating and refluxing for 2 hours, collecting an extracting solution, combining the extracting solutions, filtering, concentrating a filtrate, and performing wet column packing by using 732 type cation exchange resin with a diameter-height ratio of about 1: 10, sampling, wherein the sampling amount is that the volume ratio of the corydalis tuber medicinal material to the resin is 1:1g/mL, and removing impurities by using 3BV of purified water at the elution speed of 0.8 mL/min; eluting with 70% ethanol containing ammonia water of 3BV at an elution speed of 1mL/min, recovering solvent, drying under reduced pressure to obtain extract, pulverizing, and sieving to obtain rhizoma corydalis extract;

the preparation method of the angelica dahurica extract comprises the following steps: taking 500g of radix angelicae powder, and placing the radix angelicae powder into a microwave irradiation box for irradiation for 18 minutes at the irradiation frequency of 420 MHz; adding 5 times of 50% ethanol aqueous solution, soaking for 12 hours, heating and refluxing for 3 hours, collecting an extracting solution, adding 4 times of 60% ethanol aqueous solution, soaking for 7 hours, heating and refluxing for 2.5 hours, collecting an extracting solution, combining the extracting solutions, filtering, concentrating a filtrate, performing wet column packing by adopting D101-1 type macroporous resin, loading, standing and adsorbing for 30 minutes, removing impurities by using 10% ethanol with 3BV at the flow rate of 0.8mL/min, removing the impurity liquid, eluting by using 30% ethanol solution with 0.5% NaOH with 3BV, collecting an eluent, adjusting the pH to 3-4 by using dilute hydrochloric acid, performing vacuum drying, washing by using absolute ethanol, recovering a solvent, performing reduced pressure drying to obtain an extract, crushing, and sieving to obtain an angelica dahurica extract;

the composition comprises the following active ingredients in percentage by weight: 0.0210% of protopine, 0.0152% of alpha-allocryptopine, 0.042% of tetrahydropalmatine, 0.0005% of dehydrocorydaline, 0.0068% of tetrahydroberberine, 0.0580% of corydaline, 0.0023% of byak-angelicin, 0.048% of imperatorin and 0.026% of isoimperatorin.

3. A traditional Chinese medicine extract composition for treating neuropathic pain induced by chronic compression injury of sciatic nerve is prepared from a corydalis tuber extract and an angelica dahurica extract, and is characterized in that: taking the corydalis tuber extract and the angelica dahurica extract, and mixing the corydalis tuber extract and the angelica dahurica extract according to the weight ratio of 80: 40 mixing the two extracts, adding pharmaceutically acceptable carrier, and granulating;

the preparation method of the corydalis tuber extract comprises the following steps: taking 500g of rhizoma corydalis, and placing the rhizoma corydalis into a microwave irradiation box to irradiate for 20 minutes at the irradiation frequency of 400 MHz; soaking in 5 times of mixed solution of ethanol and acetic acid with the volume ratio of 10:9 for 18 hours, heating and refluxing for 3 hours, collecting the extract, then adding 2 times of mixed solution of ethanol and acetic acid with the volume ratio of 10:9 for soaking for 8 hours, heating and refluxing for 3 hours, collecting the extract, combining the two extracts, filtering, concentrating the filtrate, and packing the filtrate into a column by adopting a 732 type cation exchange resin wet method, wherein the diameter-height ratio is about 1: 10, loading, wherein the loading amount is that the volume ratio of the corydalis tuber medicinal material to the resin is 1:1g/mL, and removing impurities by using 3BV of purified water at the elution speed of 0.8 mL/min; eluting with 70% ethanol containing ammonia water of 3BV at an elution speed of 1mL/min, recovering solvent, drying under reduced pressure to obtain extract, pulverizing, and sieving to obtain rhizoma corydalis extract;

the preparation method of the angelica dahurica extract comprises the following steps: taking 500g of radix angelicae powder, and placing the radix angelicae powder into a microwave irradiation box to irradiate for 15 minutes at the irradiation frequency of 450 MHz; adding 4 times of 70% ethanol aqueous solution, soaking for 15 hours, heating and refluxing for 4 hours, collecting an extracting solution, adding 3 times of 80% ethanol aqueous solution, soaking for 5 hours, heating and refluxing for 3 hours, collecting an extracting solution, combining the extracting solutions, filtering, concentrating a filtrate, performing wet column packing by using D101-1 type macroporous resin, loading, standing and adsorbing for 30 minutes, removing impurities by using 10% ethanol with 3BV at the flow rate of 0.8mL/min, removing the impurity liquid, eluting by using 30% ethanol solution with 0.5% NaOH in 3BV, collecting an eluent, adjusting the pH to 3-4 by using dilute hydrochloric acid, performing vacuum drying, washing by using absolute ethanol, recovering the solvent, performing reduced pressure drying to obtain an extract, crushing, and sieving to obtain an angelica dahurica extract;

the composition comprises the following active ingredients in percentage by weight: 0.0208% of protopine, 0.0132% of alpha-allocryptopine, 0.053% of tetrahydropalmatine, 0.0003% of dehydrocorydaline, 0.0052% of tetrahydroberberine, 0.0865% of corydaline, 0.0096% of byak, 0.052% of imperatorin and 0.032% of isoimperatorin.

4. The traditional Chinese medicine extract composition according to any one of claims 1 to 3, wherein: the carrier is one or more of a filling agent, a wetting agent, a disintegrating agent, a flavoring agent and an adhesive.

5. The use of a herbal extract composition according to any one of claims 1 to 3 in the preparation of a medicament for down-regulating the expression levels of three genes Gal, Vip and Clec7a in the treatment of neuropathic pain induced by chronic compressive injury to the sciatic nerve.

Images