CN109055545A - Predict the method and DNA methylation marker of weightless amyotrophia muscles of leg dimension downside risk - Google Patents
Predict the method and DNA methylation marker of weightless amyotrophia muscles of leg dimension downside risk Download PDFInfo
- Publication number
- CN109055545A CN109055545A CN201811146120.7A CN201811146120A CN109055545A CN 109055545 A CN109055545 A CN 109055545A CN 201811146120 A CN201811146120 A CN 201811146120A CN 109055545 A CN109055545 A CN 109055545A
- Authority
- CN
- China
- Prior art keywords
- methylation
- analysis
- reagent
- muscles
- dimension
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides the DNA methylation marker for predicting weightless amyotrophia muscles of leg dimension downside risk, including following one or more genes, site annotation information are shown in Table 3.The present invention also provides corresponding detection methods.The present invention passes through the excavation to haemocyte DNA methylation level and muscles of leg dimension, it was found that horizontal by detection haemocyte DNA methylation, it can be realized the prediction to human body muscles of leg dimension decline individual difference after weightlessness, to which screening is more resistant to the individual of below-G conditions, or for carrying out scientific research to human calf's flesh dimension variation situation.The DNA methylation site set for having forecast function to human body muscles of leg dimension downside risk after weightlessness is provided in the present invention.
Description
Technical field
The invention belongs to physiology technical fields, and the physiological change after being related to weightlessness condition for a period of time specifically relates to
And predict the method and DNA methylation marker of weightless amyotrophia muscles of leg dimension downside risk.
Background technique
Weightlessness muscular atrophy is caused human muscle's degeneration variation under the conditions of weightlessness, is spacefarer in middle length
One of important health risk faced is needed under phase below-G conditions environment.With the continuous development that manned space flight is explored, spacefarer exists
The rail time is longer, and influence of the muscular atrophy to human health and in-orbit work capacity is increasingly prominent.Under the below-G conditions of space, people
The muscle group that body uses when moving is different from ground gravity environmental condition.Because under below-G conditions stance not by gravity shadow
Ring, using the muscle of Calf muscle, quadriceps muscle of thigh and back and neck as the anti-gravity muscle of representative can gradually atrophy, it is main to show
For the girth diameter reduction, muscle quality reduction, muscle contraction strength decline etc. of leg.NASA is studies have shown that continue 5 to 11 days spaces
Flight environment of vehicle can lead to up to 20% loss of muscle mass.The loss of muscle means the potential decline of muscle strength of body,
This will have an adverse effect to the in-orbit work capacity and mobility of human body, show as general weakness when big load operation, flesh
Meat pain etc..In order to reduce the amyotrophic degree in space, spacefarer needs to arrange the additional time by strength exercise, even
It is protected by way of ancillary drug.By taking all previous international space station aerial mission as an example, spacefarer need to arrange daily 0.5 to
It takes exercise within 2 hours, to reduce weightlessness to amyotrophic influence.In addition, caused flesh after long term space flight
Meat atrophy also adapts to restore to bring challenges again to the gravity behind spacefarer's return ground.
Muscles of leg dimension is can intuitively to reflect one of the index of human calf's amyotrophia degree.Because of the letter of its measurement method
Easy property is widely used in the research of weightlessness amyotrophia degree.Muscles of leg dimension declines the loss for meaning Calf muscle quality
And amyotrophia.
In consideration of it, with muscles of leg dimension, decline human muscle withers after being subjected to same weightlessness/simulated weightlessness conditions and influencing
The difference of contracting degree, which can reflect human body, leads to the individual difference of amyotrophia to below-G conditions.Towards manned space flight task, as can
Muscles of leg dimension downside risk before execution task to occupant or subject under simulated weightlessness conditions is predicted, is being flown
Task identifies weightless amyotrophia high risk occupant early period, selects to optimization occupant, provides early stage health protection intervention for occupant
And muscles of leg dimension downside risk is studied, all there is significant application value.
Summary of the invention
In order to solve the problems in the existing technology, Head down tilt bed rest human experimentation model, sieve are spent in use -6 of the present invention
Select and identify can predict weightlessness after human body muscles of leg dimension downside risk epigenetics index set.
The present invention provides the DNA methylation marker for predicting weightless amyotrophia muscles of leg dimension downside risk, including following
One or more genes, site annotation information are shown in Table 3.
These are identified by gene symbol (the 11st column) and at least one chromosomal foci (the 8th, 9,10 column) in table
The preferred methylated nucleotide position of gene.These genes are further identified by probe id (column 1), special in these genes
It is not the identification site CpG in their controlling element (in chromosomal foci).
Hereditary bibliography herein is typically referenced to genome human hg38.In table, probe id refers in array
The sequence indicated on platform, each for inquiring the specific site CpG, chromosome (chr), start site (start) and
End locus (end) can uniquely identify first position nt of each probe.
The present invention provides the method for predicting weightless amyotrophia muscles of leg dimension downside risk, the method not examining with disease
For the purpose of disconnected and treatment, include the following steps: the DNA methylation for determining muscles of leg dimension risk genes site in Samples subjects
Level, and the methylation level of the gene loci is compared with control sample, to predict that subject is small in below-G conditions
Leg flesh dimension downside risk；
Wherein one or more genes of the muscles of leg dimension risk genes in claim 1；
The control sample is selected from the sample of below-G conditions lower shank flesh dimension fall < 7.8%；
The method of the determining DNA methylation level can be determining by any method known in the art, the method
Methylating including full-length genome, screening is analyzed, the methylation profiles of chip platform are analyzed, methylation status of PTEN promoter analysis, flight
The analysis of Mass Spectrometer Method (Sequenome), sulphite treated gene order-checking, joint bisulfites restriction enzyme
Analysis, methylation-specific endonuclease digestion and quantitative polyase chain reaction Conjoint Analysis, methylation sensitive high-resolution are molten
Solution curve analysis or pyrosequencing determination method.
The DNA methylation assay reagent that the present invention provides gene described in claim 1 predicts weightless amyotrophia shank in preparation
Application in flesh dimension downside risk diagnostic products, the diagnostic products include one or more genes in detection claim 1
DNA methylation assay reagent, the reagent by the methylation level of gene described in claim 1 in detection Samples subjects,
To judge whether subject has downside risk in below-G conditions lower shank flesh dimension；
Preferably, the reagent is to methylate to screen the methylation figure of analysis, chip platform based on full-length genome
Spectrum analysis, methylation status of PTEN promoter analysis, flight mass spectrum detection (sequenome), sulphite treated gene order-checking
Analysis, joint bisulfites restriction endonuclease analysis, methylation-specific endonuclease digestion and quantitative polyase chain reaction
Conjoint Analysis, methylation sensitive high-resolution melting curve analysis or pyrosequencing test and analyze required reagent.
As another preferred embodiment, the methylation level of the gene is in the upstream of the open reading frame of marker gene
What region, especially promoter region determined；Or one of following:
(a) nucleic acid defined in the chromosomal foci as shown in claim 1；
(b) comprising the site CpG of nucleic acid a；
(c) nucleic acid (a) being no more than with above-mentioned nucleic acid a distance in 1000 nucleotide.
As another preferred embodiment, the reagent including specific amplification include methylation sites including claim 1
Described in gene primer；
Preferably, the diagnostic products are kit, chip or microarray dataset.
The present invention provides one group of nucleic acid primer and/or hybridization probe, to one or more gene described in claim 1
Potential methylation region be specific；
Preferably, the primer and/or hybridization probe are specific for amplification marker gene open reading frame
Methylate upstream region, especially promoter region；Or methylation is one of following:
(a) nucleic acid defined in the chromosomal foci as shown in claim 1；
(b) comprising the site CpG of nucleic acid a；
(c) nucleic acid (a) being no more than with above-mentioned nucleic acid a distance in 1000 nucleotide.
Primer and/or probe are used to target a potential first in the DNA molecular of the one or more genes selected in table 3
Base region.
The present invention provides a kind of kit, and the kit includes one group of nucleic acid primer as claimed in claim 6 or hybridization
Probe further includes methylation-specific restriction enzyme and/or takes off the reagent of amine for bisulfites nucleotide.
The present invention provides a kind of diagnostic products for predicting weightless amyotrophia muscles of leg dimension downside risk, the diagnostic products
Reagent including being able to detect the level of gene methylation described in claim 1；
Preferably, the reagent of gene methylation level described in the detection claim 1 includes being used for full base
Because group methylation screening analysis a reagent, for based on chip methylation profiles analysis reagent, be used for methylation-specific
The reagent of PCR analysis is surveyed for the reagent of flight mass spectrum detection (sequenome), for sulphite treated genome
The reagent of sequence analysis, is used for methylation-specific restriction endonuclease at the reagent for combining bisulfites restriction endonuclease analysis
The reagent of digestion and quantitative polyase chain reaction Conjoint Analysis, for the examination of methylation sensitive high-resolution melting curve analysis
Agent or the reagent tested and analyzed for pyrosequencing.
As another preferred embodiment, the reagent including specific amplification include methylation sites including claim 1
Described in genetic fragment primer；
As another preferred embodiment, the diagnostic products are kit, chip or microarray dataset.
The present invention provides the method for predicting that weightless amyotrophia muscles of leg dimension decrease beyond 8%, and the method is not with disease
Diagnosing and treating for the purpose of, steps are as follows:
(1) DNA methylation for measuring DNA methylation site is horizontal；
(2) building of two disaggregated model of logistic regression is carried out, and substitutes into following formula:
Wherein, X=intercept coefficient+DNA methylation site DNA methylation level × independent variable coefficient, Y are muscles of leg dimension
Spend downside risk score；Such as Y < 0.5, then it is determined as that muscles of leg dimension decrease beyond 8%.
The present invention passes through detection haemocyte by the excavation to haemocyte DNA methylation level and muscles of leg dimension, discovery
DNA methylation is horizontal, can be realized the prediction to human body muscles of leg dimension decline individual difference after weightlessness, so that screening is more resistance to
By the individual of below-G conditions, or for carrying out scientific research to human calf's flesh dimension variation situation.
The DNA methylation site for having forecast function to human body muscles of leg dimension downside risk after weightlessness is provided in the present invention
Set.This is found to be human muscle's atrophy caused by system announcement below-G conditions influence and provides new clue, is worth deeply
Research.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified city
It sells.
The present invention provides the DNA methylation marks for the human body muscles of leg dimension after weightlessness can be predicted decreaseing beyond 8% risk
Will object list (gene location annotation information and estimated performance are shown in Table 3), and provide a kind of prediction it is weightless after human body muscles of leg tie up
Spend the method for decreaseing beyond 8% risk.In a specific embodiment, pass through the methyl for the marker cg03754165 that methylates
Change horizontal, human body muscles of leg dimension declines individual difference after evaluation is weightless, identification muscles of leg dimension decrease beyond 8% it is tested
Person, and then screen the individual more resistant to below-G conditions.
Although the present invention, which is regardless of, is limited to any theory, inventor thinks methylation marker levels and weightlessness in table 3
Under the conditions of there are correlativities between muscles of leg dimension downside risk.
In a specific embodiment in the present invention, muscles of leg dimension downside risk score Y, DNA methylation level
The relationship of cg03754165 meets
Wherein, X=2508+cg03754165 × (- 7697), the cg03754165 in formula are the DNA in specific gene site
Methylation level.Such as Y < 0.5, then it is determined as that muscles of leg dimension decrease beyond 8%.
Embodiment 1
1, -6 degree Head down tilt bed rest simulated weightlessness model
(1) volunteer
Testing volunteer is 15 healthy non-smoking males, special secondary school and the above schooling of special secondary school.Age was at 22 years old to 34
Between year (M=26.62, SD=4.21), height (M=170.31, SD=4.02) between 160cm to 174cm, weight 53~
72Kg (M=62.81, SD=5.90).It without special medical history, eyesight or corrects defects of vision normal, is dextro manuality, non athlete.Institute
Some test volunteers fill in informed consent form before receiving experiment.
(2) experiment condition
15 volunteers downward -6 degree state of holding head, continuous life 45 days on -6 degree bed for lying on.It is held in experimentation
Continuation of insurance holds body axial -6 and spends the downward state in head.
(3) experimental arrangement
Bed rest experiment starts first 1 day, acquires 15 subject's blood cell samples by EDTA anticoagulant tube, freezes in -80 DEG C
Refrigerator remains subsequent DNA methylation chip detection；1 day and bed the 45th before bed test by each subject of tape measuring
It muscles of leg dimension, measuring point select muscles of leg dimension longest position on the right side of each subject, every time in test, to every by
Examination person is measured three times, takes measurement average value as final detection result.
2, data acquire overall situation
It is as shown in table 1 that data acquire situation.
1 data of table acquire situation table
3, muscles of leg dimension detection method and quality control
By each subject of tape measuring before bed test 1 day and the 45th day muscles of leg dimension of lying in bed, measuring point
Muscles of leg dimension longest position on the right side of each subject is selected, every time in test, every subject is measured three times, takes measurement
Average value is as final detection result.
The variation tendency of subject's muscles of leg dimension index is as shown in table 2 before and after 45 days -6 degree Head down tilt bed rests.To every
Subject analyzes its muscles of leg dimension with respect to amplitude of variation.15 subject's muscles of leg dimensions are on a declining curve.Wherein, 6
Subject's muscles of leg dimension relative drop amplitude is maximum (8.4%-10.2%), 6 then relatively small (3.5%- of subject
7.7%).Subject is divided into muscles of leg dimension decline high risk group (H group, fall > 8% amount to 6 subjects)
With low-risk group (fall < 7.8% amounts to 6 subjects), other 3 subjects remove in subsequent analysis, carry out
Subsequent characteristics assessment and modeling work.
The variation tendency of 2 muscles of leg dimension of table
4, DNA methylation express spectra detects
It is detected using Illumina Human 450k DNA methylation chip.
In view of biochip technology relative maturity, and there is the commercial technologies service platform of operation maturation in the country, using outer
The mode of association's test completes Illumina Human 450k DNA methylation chip testing.Main technologies include:
(1) genome DNA is extracted.It is extracted using commercial kit QIAamp DNA Mini Kit kit total
DNA。
(2) DNA quality inspection.Using NanoDrop and Agrose Gel quality detecting method, pass through A260/280 signal, A260/230
The quality inspections parameters such as signal, DNA total amount (μ g) extract the quality control of DNA.
(3) bisulfite conversion is handled using Zymo EZ DNA Methylation Kit kit.
(4) WGA mode expand, fragmentation, using Illumina chip scanner, with GenomeStudio software control.
(5) chip hybridization, elution, extension, imaging, using GenomeStudio software.
(6) data are analyzed.
Above-mentioned experimental implementation is carried out by the standard practice instructions of related kit and company.
5, DNA methylation chip of expression spectrum data prediction
Using the Illumina Human 450k DNA methylation Chip data output file * .idat of standard
In file, data analysis is carried out using R language platform (v3.4.4) and Rstudio tool (v1.1.442).Pre-process institute's recruitment
Tool includes: minfi (v1.24.0), ChAMP (v2.9.10).By filtering following probe: (1) detecting p value and be greater than 0.01；
(2) be more than 5% sample middle probe bead-count number less than 3；(3) probe of non-CG beginning；(4) site SNPs starts
Probe；(5) probe in multiple gene locations is annotated；(6) probe of the annotation on X and Y chromosome, finally obtains 412345
Probe, 15 subjects DNA methylation express modal data, be used for subsequent analysis.
6, Head down tilt bed rest simulated weightlessness conditions lower lumbar spine bone loss risk profile methylation sites screen
(1) aspect of model screening 1 --- standard deviation filtering
Standard deviation 15 subjects is calculated between each probe, probe is ranked up by standard deviation, is filtered out
The probe that benchmark methylation level differs greatly in subject population.Screening threshold value is set as sd > 0.02, thus filters out
117872 probes are used for subsequent analysis.
(2) aspect of model screening 2 --- differential expression screening
To 117872 methylation probes, between muscles of leg dimension decline high risk group (H group) and low-risk group (L group) into
Row t check analysis.It is threshold value with p-value < 0.05, the probe of methylation level significant difference between screening group.Thus it filters out
1530 probes are used for subsequent analysis.
(3) building of unit point prediction model and performance evaluation of logic-based regression model
Using Logic Regression Models, disaggregated model building is carried out respectively with each site in above-mentioned 1530 probes.Using staying
One verification method evaluates the performance of each site model, 95% confidence interval of output model AUC, AUC, Odds-Ratio value, model
The parameter informations such as precision Accuracy.It is threshold value with p-value < 0.05, filters out 402 first with higher forecasting performance
Base site.Wherein 277 site annotations are on known (table 3).
Table 3 there is the methylation characteristic site of predictive ability to gather below-G conditions lower shank flesh dimension downside risk
Function enrichment analysis is done for gene where above-mentioned 270 probes filtered out using Logic Regression Models.In table 4
Analysis is the results show that have the methylation sites place gene of predictive ability most to below-G conditions lower shank flesh dimension downside risk
Significant enrichment is in Hippo signaling pathway (p-value=6.53E-03), Inositol phosphate
The signal paths such as metabolism (p-value=7.88E-03).
The function of gene is enriched with result where 4 below-G conditions lower shank flesh dimension downside risk of table predicts methylation sites
(4) muscles of leg dimension downside risk prediction model example before and after simulated weightlessness
It is input with methylation sites cg03754165 in table 3.Probe cg03754165 homologue sequence and corresponding
Location information is following (italic overstriking font shows that sequence includes probe location upstream and downstream 25bp nucleic acid sequence), with reference to genome
For human hg38:
> chr2:60586112-60586163 (cg03754165)
AGTCCACTAATCATTCATTACCAGTCGGCTAGGGGCTCAGAGGGTGACACCA
Muscles of leg dimension, which is declined high risk group (H group, fall > 8% amount to 6 subjects) labeled bracketing symbol, is
" 0 ", low-risk group (fall < 7.8% amounts to 6 subjects) labeled bracketing symbol is " 1 ".Use R language platform
(v3.4.4) and kit caret (v6.0.80) carries out constructing the building of two disaggregated models by logistic regression, to 45 top margin of a page low levels
Bed simulated weightlessness conditions lower shank flesh dimension decline high risk group and low-risk group crowd predict.Prediction model coefficient is such as
Table 5.
5 prediction model coefficient of table
| ? | Coefficient |
| Cg03754165 (independent variable) | -7697 |
| Intercept | 2508 |
Calculation formula used is as follows:
Wherein, X=2508+cg03754165 × (- 7697), the cg03754165 in formula are the DNA in specific gene site
Methylation level.Such as Y < 0.5, then it is determined as that muscles of leg dimension decrease beyond 8%.
By staying a verifying to analyze, prediction model AUC=1 (p-value=2.4e-04), other model performance parameters
See Table 6 for details for output.The result shows that the prediction model can concentrate bone density high risk/low-risk crowd progress accurate pre- to data
It surveys.
6 prediction model performance parameter of table
Finally, it should be noted that the foregoing is only a preferred embodiment of the present invention, it is not intended to restrict the invention,
Although the present invention is described in detail referring to the foregoing embodiments, for those skilled in the art, still may be used
To modify the technical solutions described in the foregoing embodiments or equivalent replacement of some of the technical features.
All within the spirits and principles of the present invention, any modification, equivalent replacement, improvement and so on should be included in of the invention
Within protection scope.
Claims (10)
1. predicting the DNA methylation marker of weightless amyotrophia muscles of leg dimension downside risk, including following one or more bases
Cause, site annotation information are as follows:
2. the method for predicting weightless amyotrophia muscles of leg dimension downside risk, the method is not using the diagnosing and treating of disease as mesh
, it is characterised in that: include the following steps: the DNA methylation for determining muscles of leg dimension risk genes site in Samples subjects
Level, and the methylation level of the gene loci is compared with control sample, to predict that subject is small in below-G conditions
Leg flesh dimension downside risk；
Wherein one or more genes of the muscles of leg dimension risk genes in claim 1；
The control sample is selected from the sample of below-G conditions lower shank flesh dimension fall < 7.8%；
Preferably, the method for the determining DNA methylation level includes full-length genome methylation screening analysis, chip platform
Methylation profiles analysis, methylation status of PTEN promoter analysis, flight mass spectrum detection (Sequenome), sulphite treated base
Because of a group sequencing analysis, joint bisulfites restriction endonuclease analysis, methylation-specific endonuclease digestion and quantitative polymerization
Enzyme chain reaction Conjoint Analysis, methylation sensitive high-resolution melting curve analysis or pyrosequencing determination method.
3. the DNA methylation assay reagent of gene described in claim 1 predicts weightless amyotrophia muscles of leg dimension canyon wind in preparation
Application in dangerous diagnostic products, it is characterised in that: the diagnostic products include one or more genes in detection claim 1
DNA methylation assay reagent, the reagent are come by the methylation level of gene described in claim 1 in detection Samples subjects
Judge whether subject has downside risk in below-G conditions lower shank flesh dimension；
Preferably, the reagent is methylated based on full-length genome screening analysis, the methylation profiles analysis of chip platform, first
The analysis of base specific PCR, flight mass spectrum detection (sequenome), the analysis of sulphite treated gene order-checking, joint
Bisulfites restriction endonuclease analysis, methylation-specific endonuclease digestion and quantitative polyase chain reaction Conjoint Analysis,
Methylation sensitive high-resolution melting curve analysis or pyrosequencing test and analyze required reagent.
4. application according to claim 3, it is characterised in that: the methylation level of the gene is opening in marker gene
Put what the upstream region of reading frame, especially promoter region determined；Or one of following:
(a) nucleic acid defined in the chromosomal foci as shown in claim 1；
(b) comprising the site CpG of nucleic acid a；
(c) nucleic acid (a) being no more than with above-mentioned nucleic acid a distance in 1000 nucleotide.
5. application according to claim 3 or 4, it is characterised in that: the reagent includes that specific amplification includes methylation
The primer of gene described in claim 1 including site；
Preferably, the diagnostic products are kit, chip or microarray dataset.
6. one group of nucleic acid primer and/or hybridization probe, the potential methylation to one or more gene described in claim 1
Region is specific；
Preferably, the primer and/or hybridization probe are specific in the methylation of amplification marker gene open reading frame
Swim region, especially promoter region；Or methylation is one of following:
(a) nucleic acid defined in the chromosomal foci as shown in claim 1；
(b) comprising the site CpG of nucleic acid a；
(c) nucleic acid (a) being no more than with above-mentioned nucleic acid a distance in 1000 nucleotide.
7. a kind of kit, it is characterised in that: the kit includes that one group of nucleic acid primer as claimed in claim 6 or hybridization are visited
Needle further includes methylation-specific restriction enzyme and/or takes off the reagent of amine for bisulfites nucleotide.
8. a kind of diagnostic products for predicting weightless amyotrophia muscles of leg dimension downside risk, it is characterised in that: the diagnostic products
Reagent including being able to detect the level of gene methylation described in claim 1；
Preferably, the reagent of gene methylation level described in the detection claim 1 includes being used for full-length genome methyl
Change screening analysis reagent, for based on chip methylation profiles analysis reagent, for methylation status of PTEN promoter analysis
Reagent, for the reagent of flight mass spectrum detection (sequenome), for the examination of sulphite treated gene order-checking analysis
Agent, the reagent for combining bisulfites restriction endonuclease analysis are used for methylation-specific endonuclease digestion and quantify
The reagent of polymerase chain reaction Conjoint Analysis, for methylation sensitive high-resolution melting curve analysis reagent or for coke
The reagent that phosphoric acid PCR sequencing PCR tests and analyzes.
9. diagnostic products according to claim 8, it is characterised in that: the reagent includes that specific amplification includes methylation
The primer of genetic fragment described in claim 1 including site；
Preferably, the diagnostic products are kit, chip or microarray dataset.
10. predicting the method that weightless amyotrophia muscles of leg dimension decrease beyond 8%, the method is not with the diagnosing and treating of disease
For the purpose of, it is characterised in that: steps are as follows:
(1) DNA methylation for measuring DNA methylation site is horizontal；
(2) building of two disaggregated model of logistic regression is carried out, and substitutes into following formula:
Wherein, X=intercept coefficient+DNA methylation site DNA methylation level × independent variable coefficient, Y are under muscles of leg dimension
Risk score drops；Such as Y < 0.5, then it is determined as that muscles of leg dimension decrease beyond 8%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811146120.7A CN109055545A (en) | 2018-09-29 | 2018-09-29 | Predict the method and DNA methylation marker of weightless amyotrophia muscles of leg dimension downside risk |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811146120.7A CN109055545A (en) | 2018-09-29 | 2018-09-29 | Predict the method and DNA methylation marker of weightless amyotrophia muscles of leg dimension downside risk |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109055545A true CN109055545A (en) | 2018-12-21 |
Family
ID=64766810
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811146120.7A Pending CN109055545A (en) | 2018-09-29 | 2018-09-29 | Predict the method and DNA methylation marker of weightless amyotrophia muscles of leg dimension downside risk |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109055545A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080286787A1 (en) * | 2005-11-23 | 2008-11-20 | University Of Southern California | High Throughput Method of DNA Methylation Haplotyping |
| CN104762398A (en) * | 2015-04-17 | 2015-07-08 | 代苒 | Method for detecting spinal muscular atrophy virulence gene |
| CN106011248A (en) * | 2016-06-02 | 2016-10-12 | 中国航天员科研训练中心 | Method for detecting amyotrophy and kit |
| CN108359732A (en) * | 2017-01-25 | 2018-08-03 | 株式会社大熊制药 | Biomarker for predicting training response |
| CN109234378A (en) * | 2018-09-27 | 2019-01-18 | 中国航天员科研训练中心 | Predict the method and DNA methylation marker of weightless bone loss osteocalcin OC downside risk |
-
2018
- 2018-09-29 CN CN201811146120.7A patent/CN109055545A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080286787A1 (en) * | 2005-11-23 | 2008-11-20 | University Of Southern California | High Throughput Method of DNA Methylation Haplotyping |
| CN104762398A (en) * | 2015-04-17 | 2015-07-08 | 代苒 | Method for detecting spinal muscular atrophy virulence gene |
| CN106011248A (en) * | 2016-06-02 | 2016-10-12 | 中国航天员科研训练中心 | Method for detecting amyotrophy and kit |
| CN108359732A (en) * | 2017-01-25 | 2018-08-03 | 株式会社大熊制药 | Biomarker for predicting training response |
| CN109234378A (en) * | 2018-09-27 | 2019-01-18 | 中国航天员科研训练中心 | Predict the method and DNA methylation marker of weightless bone loss osteocalcin OC downside risk |
Non-Patent Citations (2)
| Title |
|---|
| JIN L等: "Genome-wide DNA methylation changes in skeletal muscle between young and middle-aged pigs", 《BMC GENOMICS》 * |
| 杜佳音: "康复训练对痉挛型瘫痪大鼠快慢肌中BDNF及甲基化影响", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6577005B2 (en) | Method for identifying quantitative cellular composition in biological samples | |
| Agbor-Enoh et al. | Applying rigor and reproducibility standards to assay donor-derived cell-free DNA as a non-invasive method for detection of acute rejection and graft injury after heart transplantation | |
| Jones et al. | Laboratory practice guidelines for detecting and reporting BCR-ABL drug resistance mutations in chronic myelogenous leukemia and acute lymphoblastic leukemia: a report of the Association for Molecular Pathology | |
| Gill et al. | An evaluation of potential allelic association between the STRs vWA and D12S391: implications in criminal casework and applications to short pedigrees | |
| CN105574361A (en) | Method for detecting variation of copy numbers of genomes | |
| Minton et al. | Mutation surveyor: software for DNA sequence analysis | |
| WO2010020252A1 (en) | Methods for determining a breeding value based on a plurality of genetic markers | |
| Anton et al. | Spermatozoa as biomarkers for the assessment of human male infertility and genotoxicity | |
| KR20210119282A (en) | Methods and systems for monitoring long-term health and disease | |
| Scott Jr et al. | Assessing the reproductive competence of individual embryos: a proposal for the validation of new “-omics” technologies | |
| KR20160020400A (en) | Method for prediction of fetal monogenic genetic variations using maternal cell-free dna | |
| EP2492353B1 (en) | Biomarkers for predicting therapeutic effect in hyposensitization therapy | |
| KR102111820B1 (en) | Dynamic network biomarker detection device, detection method, and detection program | |
| CN117079723B (en) | Biomarker and diagnostic model related to amyotrophic lateral sclerosis and application of biomarker and diagnostic model | |
| Chen et al. | Genome‐wide linkage analysis of quantitative biomarker traits of osteoarthritis in a large, multigenerational extended family | |
| JP4664280B2 (en) | Method for characterization of biomolecular samples | |
| CN109055545A (en) | Predict the method and DNA methylation marker of weightless amyotrophia muscles of leg dimension downside risk | |
| CN104540966A (en) | Diagnosis of rheumatoid arthritis by microRNA | |
| CN109234378A (en) | Predict the method and DNA methylation marker of weightless bone loss osteocalcin OC downside risk | |
| CN109055542A (en) | Predict the method and DNA methylation marker of weightless bone loss lumbar spine bmd downside risk | |
| CN109055543A (en) | Predict the method and DNA methylation marker of weightless bone loss hip joint bone density downside risk | |
| Stephens et al. | Calculation and implementation of sample-wide stochastic thresholds for forensic genetic analysis of STRs and SNPs for massively parallel sequencing platforms | |
| CN109234379A (en) | Predict the method and DNA methylation marker of weightless bone loss Tartrate resistant acid phosphatase TRAP Upside Risk | |
| CN112786103A (en) | Method and device for analyzing feasibility of target sequencing Panel for estimating tumor mutation load | |
| CN109055546A (en) | Predict the method and DNA methylation marker of weightless bone loss cortisol Cortisol Upside Risk |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20181221 |
|
| WD01 | Invention patent application deemed withdrawn after publication |