CN109055509A - Method, composition and purposes based on microsatellite instability of the two generation sequencing technologies detection without check sample - Google Patents
Method, composition and purposes based on microsatellite instability of the two generation sequencing technologies detection without check sample Download PDFInfo
- Publication number
- CN109055509A CN109055509A CN201811050997.6A CN201811050997A CN109055509A CN 109055509 A CN109055509 A CN 109055509A CN 201811050997 A CN201811050997 A CN 201811050997A CN 109055509 A CN109055509 A CN 109055509A
- Authority
- CN
- China
- Prior art keywords
- amplimer
- biomarker
- sample
- sequence
- composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses method, composition and purposes based on microsatellite instability of the two generation sequencing technologies detection without check sample.The method of the present invention includes tissue samples are carried out building library and are sequenced using amplimer composition；Sample data is extracted from sequencing data, sequencing sequence needed for onestep extraction of going forward side by side；The length of the sequencing sequence is calculated, and counts the sequencing sequence number that each length is distributed, chooses calculated value of the most length of distribution sequencing sequence as biomarker；The average value and standard deviation of sequence length corresponding to amplimer in each biomarker are calculated in human blood database according to amplimer composition；Z value is calculated, and judges the stability of biomarker based on Z value order of magnitude, and then the stability of the judgement of stability tissue samples based on the biomarker.Method of the invention does not need check sample, the complexity for reducing costs and analyzing.
Description
Technical field
The invention belongs to genetic test fields, and in particular to detect the microsatellite without check sample based on two generation sequencing technologies
Unstable method.
Background technique
In protokaryon and eukaryotic gene groups, widely distributed many short and tandem sequence repeats DNA sequence dnas (1-6 base), i.e.,
Microsatellite sequence (MicroSatellite, MS).And during DNA replication dna, these sequences often occur small-scale base and lack
It loses, be inserted into or replace, unstability is presented.As microsatellite instability (MicroSatellite Instability,
MSI).MSI phenomenon was found in colorectal cancer in 1993 by Jacobs et al. for the first time, related with cancer generation, can be used for cancer
Disease detects (William R.Jacobs, et al, Science, 1993,260:816-818).Ronald J Hause in 2016
Et al. utilize the full exon sequencing technologies of genome, analyze 5930 genomes of cancer in 18, wherein 14 kinds of cancers are suffered from for discovery
MSI occurs in person's cancer cell, wherein carcinoma of endometrium MSI frequency is up to 30%, and gastric cancer and colon cancer are 19%
(Classification and characterization of microsatellite instability across
18cancer types.Hause RJ,Pritchard CC,Shendure J,Salipante SJ.Nat Med.
2016Nov；22(11):1342-1350.doi:10.1038/nm.4191).The frequency being detected according to MSI in colorectal cancer
It can be classified as three classes, Microsatellite stability (MSS), Microsatellite instability-low
(MSI-L) and Microsatellite instability-high (MSI-H) (Frequent inactivation of PTEN
by promoter hypermethylation in microsatellite instability-highsporadic
colorectal cancers.Goel A,Arnold CN,Niedzwiecki D, Carethers JM,Dowell JM,
Wasserman L,Compton C,Mayer RJ,Bertagnolli MM,Boland CR.Cancer Res.2004May 1；
64(9):3014-21).MSI detection is mentioned in NCCN colorectal cancer guide to be carried out in the patient of all colorectal cancer histories, can
Using the good marker as colorectal cancer prognosis；And the colorectal cancer II phase patient of MSI-H has preferable prognosis
(https://www.nccn.org/professionals/physician_gls/pdf/colon.pdf).FDA was in 2017
Have approved July immunochemotherapy drug nivolumab for metastatic colorectal carcinoma patient (https: //
www.cancer.gov/news-events/cancer-currents-blog/2017/nivolumab-fda-c
Olorectal), ipilimumab is had approved in July, 2018 to combine with nivolumab for treating 12 years old or more
MSI-H/mismatch repair deficient (dMMR) metastatic and rectal cancer patient (https: //
www.fda.gov/drugs/informationondrugs/approveddrugs/ucm613227.htm).It can be seen that straight in knot
MSI and its importance in clinical application are detected in intestinal cancer.
Method based on NGS detection MSI now with very much, main method can be classified as by comparing organize and control it is micro-
Length scale distributional difference (the Applicability of next generation sequencing of satellite sequence
technology in microsatellite instability testing.Genes(Basel).2015 Feb 12；6
) or two kinds of (MSIsensor:microsatellite of polymorphic differences (1): 46-59.doi:10.3390/genes6010046
instability detection using paired tumor-normal sequence data.
Bioinformatics.2014Apr 1；30 (7): 1015-6.doi:10.1093/bioinformatics/btt755), although
The good results are evident, but is all based on tissue with compareing to be detected, for inorganization check sample detection so far simultaneously
There is no extraordinary method and result.
Summary of the invention
To solve at least partly technical problem in the prior art, the present invention, which is provided, to be detected based on two generation sequencing technologies without right
The method of this microsatellite instability (MSI) in the same old way.Method of the invention compensates for prior art vacancy, thus reduce experiment,
Sequencing and analysis cost.Specifically, the present invention includes the following contents.
The first aspect of the present invention provides a kind of based on microsatellite instability of the two generation sequencing technologies detection without check sample
Method comprising following steps:
(1) tissue samples are carried out building library using amplimer composition and obtain sample library, to the sample library into
Row sequencing obtains sequencing data, does not include wherein check sample in the step；
(2) sample data is extracted from the sequencing data using the special sequence label of the sample, and according to institute
State the corresponding sequencing sequence of biomarker that amplimer composition extracts each MSI from the sample data；
(3) length of the sequencing sequence of each biomarker is calculated, and counts the sequencing sequence number that each length is distributed, is selected
Take the calculated value that the most length of sequencing sequence is distributed in each biomarker as the biomarker；
(4) it is calculated in each biomarker and is expanded in human blood database according to the amplimer composition
The average value and standard deviation of the most sequence length of sequencing sequence corresponding to primer；
(5) Z value is calculated using formula (I), if | Z value | >=3, then it is assumed that the biomarker is unstable, if | Z value
| < 3, then it is assumed that the biomarker is stablized, if there is 2 or more biomarkers are unstable, then it is assumed that the tissue samples
It is high frequency instability mode, i.e. MSI-H type, if there is 1 biomarker below is unstable, then it is assumed that the tissue samples are
Stable type, i.e. MSS type, wherein formula (I): Z value=(calculated value-average value)/standard deviation.
Method according to the present invention based on microsatellite instability of the two generation sequencing technologies detection without check sample, it is excellent
Selection of land, each primer specificity in the amplimer composition are bound at least partly sequence of the biomarker of MSI,
Described in biomarker come from selected from by KIT, MSH2, BIRC3, SLC7A8, ZNF2, MAP4K3, REEP5, DEFB105A,
DEFB105B、ACVR2A、 RNF43、DOCK3、GTF2IP1、LOC100093631、ARHGEF12、NOMO1、PIP5K1A、
At least one of the group of KIF14 (dist.=4,175bp) and DDX59 (dist.=19,111bp) composition gene.
Method according to the present invention based on microsatellite instability of the two generation sequencing technologies detection without check sample, it is excellent
Selection of land, the amplimer composition include the first amplimer to, the second amplimer to, third amplimer to, the 4th
Amplimer to and the 5th amplimer pair, wherein each amplimer is to 5 kinds for being specifically bound to MSI respectively different
At least partly sequence of biomarker.
Method according to the present invention based on microsatellite instability of the two generation sequencing technologies detection without check sample, it is excellent
Selection of land, the amplimer composition include sequence shown in SEQ ID NO:1-10.
Method according to the present invention based on microsatellite instability of the two generation sequencing technologies detection without check sample, it is excellent
Selection of land, step (1) build library by including the process of first round amplification and the second wheel amplification, and wherein first round amplification is with 50ng/ μ
The l DNA below from the tissue samples is template, using 98 DEG C of 30s, 98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 20s, 72 DEG C
2min, 4 DEG C of ∞, totally 20 circulation amplification program, second wheel amplification using first round amplified production as template, using 98 DEG C of 30s,
98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 20s, 72 DEG C of 2min, 4 DEG C of ∞, totally 20 circulation amplification program.
Method according to the present invention based on microsatellite instability of the two generation sequencing technologies detection without check sample, it is excellent
Selection of land, sequencing described in step (1) are the sequencing of two generations.
Method according to the present invention based on microsatellite instability of the two generation sequencing technologies detection without check sample, it is excellent
Selection of land, the tissue samples are potential cancer tissue, do not include blood or its ingredient.
Method according to the present invention based on microsatellite instability of the two generation sequencing technologies detection without check sample, it is excellent
Selection of land, the step of adding special sequence label into gained sample library after step (1) builds library.
The second aspect of the present invention provides a kind of for detecting the microsatellite without check sample not based on two generation sequencing technologies
Stable composition comprising obtain the amplimer composition in sample library, sample for build library to tissue samples
Special sequence label, for the reagent of primer extend and amplified reaction.
The third aspect of the present invention provides composition described in second aspect of the present invention in preparation for being sequenced based on two generations
Technology detects the purposes in the detection agent of the microsatellite instability without check sample.
Method of the invention does not need the blood control sample that conventional detection microsatellite instability (MSI) is necessarily required to not only
This, and the step of saving the experiment, sequencing and analysis of check sample, thus the complexity for reducing costs and analyzing.
Detailed description of the invention
Fig. 1 reads the testing result that micro- kit organizes sample1 for 3730.
Fig. 2 reads micro- kit to the testing result of sample1 blood for 3730.Being compared by Fig. 1 and Fig. 2 can be with BAT25 is not
Stablize, BAT26 is unstable, and MONO27 stablizes, and NR21 is unstable, and NR24 stablizes.
Specific embodiment
The existing various exemplary embodiment that the present invention will be described in detail, the detailed description are not considered as to limit of the invention
System, and it is understood as the more detailed description to certain aspects of the invention, characteristic and embodiment.
It should be understood that it is to describe special embodiment that heretofore described term, which is only, it is not intended to limit this hair
It is bright.In addition, for the numberical range in the present invention, it is thus understood that specifically disclose the range upper and lower bound and they it
Between each median.Median and any other statement value in any statement value or stated ranges or in the range
Lesser range is also included in the present invention each of between interior median.These small range of upper and lower bounds can be independent
Ground includes or excludes in range.
Unless otherwise stated, all technical and scientific terms used herein has the routine in field of the present invention
The normally understood identical meanings of technical staff.Although the present invention only describes preferred method and material, of the invention
Implement or also can be used and similar or equivalent any method and material described herein in testing.The institute mentioned in this specification
There is document to be incorporated by reference into, to disclosure and description method relevant to the document and/or material.It is incorporated to any
When document conflicts, it is subject to the content of this specification.Unless otherwise stated, " % " is the percentage based on weight.
" microsatellite instability " of the present invention is sometimes referred to as " MSI ", refers to DNA microsatellite repetitive sequence length
Change the gene mutation being characterized, is a seed type of genomic instability, can lead to kinds of tumors, such as colorectal cancer.
" no check sample " the of the present invention reference material that refers to during detecting microsatellite instability that no setting is required,
Reference substance or reference substance also include pair from Different Individual including reference material, reference substance or reference substance from same individual
According to object, reference substance or reference substance.This is significantly different with method in the prior art.Usually with white thin in blood in existing method
The DNA extracted in born of the same parents is as reference material.Method of the invention avoids passing through operation or biopsy extraction obtains normal tissue conduct
Control, reduces patient suffering.
[method based on microsatellite instability of the two generation sequencing technologies detection without check sample]
The first aspect of the present invention provides a kind of based on microsatellite instability of the two generation sequencing technologies detection without check sample
Method sometimes referred to as " method of the invention " at least include the following steps (1)-(5).
Step (1)
Step (1) of the invention includes building library step and sequencing steps.Specifically, step (1) is including the use of amplimer
Composition carries out building library to tissue samples obtains sample library, further includes being sequenced to obtain sequencing data to sample library.It needs
It is noted that not needing check sample in the step.
Of the invention builds the process that library includes first round amplification and the second wheel amplification.Present invention discover that by respectively carrying out
Two-wheeled amplification is very beneficial for obtaining the sample library for being suitble to rear thread sequencing, improves detection accuracy.Preferably, of the invention
One DNA for having taken turns self-organizing sample since amplification includes is template, using 98 DEG C of 30s, 98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 20s, 72
DEG C 2min, 4 DEG C of ∞, the programs of totally 20 circulations are expanded.The concentration of template is 50ng/ μ l hereinafter, excellent in first round amplification
40ng/ μ l is selected hereinafter, more preferably 20ng/ μ l or less.If excessive concentration, it is unfavorable for the progress of two-wheeled amplification.Of the invention
Second wheel amplification includes using first round amplified production as template, using 98 DEG C of 30s, 98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 20s, 72
DEG C 2min, 4 DEG C of ∞, the step of programs amplification of totally 20 circulations.Wherein the template of the second wheel amplification is (that is, first round amplification produces
Object) amount can be whole first round amplified productions, it is possible to use part therein.
Of the invention builds after the completion of the step of library, preferably includes the step of adding special sequence label to gained sample library.
Any sequence known in the art can be used in special sequence label.It is preferable to use the barcode (index) 6 that uses when sequencing or
The base sequence of 8bp.The addition of special sequence label is used to distinguish different sample libraries.
Sequencing of the invention is carried out by two generation sequencing technologies.It can use two generation sequencing technologies and carry out both-end sequencing or list
End sequencing.Two generations sequencing can be used instrument or platform, such as Illumina MiniSeq, NextSeq known in the art etc. into
Row.The length for the sequencing data being sequenced by two generations is generally 50-500bp, preferably 80-450bp, more preferably
100-400bp, further preferably 150-300bp.
The tissue samples of step (1) of the invention are any tissue from individual.Its any position that may be from body.
Preferably potential cancer tissue, it is further preferred that tissue samples of the invention do not include blood or the ingredient for carrying out autoblood, such as blood
Cell in slurry or its blood.
The amplimer composition of step (1) of the invention includes the group for obtaining a variety of different primers in sample library
It closes, is different from sequencing primer when sequencing.Amplimer composition of the invention includes for expanding particular organisms marker
Or part thereof sequence multipair primer pair.That is, each primer specificity of amplimer composition of the invention is bound to the life of MSI
At least partly sequence of object marker.Preferably, biomarker come from selected from by KIT, MSH2, BIRC3, SLC7A8, ZNF2,
MAP4K3、 REEP5、DEFB105A、DEFB105B、ACVR2A、RNF43、DOCK3、GTF2IP1、 LOC100093631、
The group of ARHGEF12, NOMO1, PIP5K1A, KIF14 (dist.=4,175bp) and DDX59 (dist.=19,111bp) composition
At least one of gene.It is highly preferred that BAT26 of the biomarker selected from BAT25 mutation, MSH2 gene by KIT gene
Mutation, the NR27 mutation of BIRC3 gene, the NR21 mutation of SLC7A8 gene, the NR24 mutation of ZNF2 gene, MAP4K3 gene
MONO-27 mutation, REEP5 gene D5S346 mutation, DEFB105A or DEFB105B gene (A) 9 mutation, ACVR2A
The mutation of (A) 8 of gene, the mutation of (C) 7 of RNF43 gene, the mutation of (C) 7 of DOCK3 gene, GTF2IP1 or LOC100093631
The mutation of (T) 13 of gene, the mutation of (T) 8 (C) 5 of ARHGEF12 gene, the mutation of (A) 9 of NOMO1 gene, PIP5K1A gene
(T) 9 (C) 6 mutation, KIF14 (dist.=4,175bp) gene (T) 8 mutation and DDX59 (dist.=19,111bp) base
At least one of the group of the mutation composition of (T) 8 of cause.
In certain embodiments, amplimer composition of the invention include the first amplimer to, second amplification draw
Object to, third amplimer to, the 4th amplimer to and the 5th amplimer pair, wherein each amplimer is to special respectively
The opposite sex is bound at least partly sequence of this 5 kinds of different biomarkers of BAT25, BAT26, MONO27, NR21 and NR24.
It is highly preferred that amplimer composition of the invention includes the primer of sequence shown in following SEQ ID NO:1-10.
BAT25 primer:
Primer 1:TCTGCATTTTAACTATGGCTC (SEQ ID NO:1)
Primer 2: CTCGCCTCCAAGAATGTAAGT (SEQ ID NO:2)
BAT26 primer:
Primer 1:CTGCGGTAATCAAGTTTTTAG (SEQ ID NO:3)
Primer 2: AACCATTCAACATTTTTAACCC (SEQ ID NO:4)
MONO27 primer:
Primer 1:GAAATGGTGGGAACCCAG (SEQ ID NO:5)
Primer 2: GGTGGATCAAATTTCACTTGG (SEQ ID NO:6)
NR21 primer:
Primer 1:GAGTCGCTGGCACAGTTCTA (SEQ ID NO:7)
Primer 2: CTGGTCACTCGCGTTTACAA (SEQ ID NO:8)
NR24 primer:
Primer 1:ATTGTGCCATTGCATTCCAA (SEQ ID NO:9)
Primer 2: GTGTCTTGCTGAATTTTACCTCCTGAC (SEQ ID NO:10)
Above-mentioned SEQ ID NO:1-10 shows the sequence of different primers, while the present invention is also mentioned with computer-reader form
The sequence of above-mentioned SEQ ID NO:1-10 is supplied.In the sequence illustrated herein situation different from sequence shown in computer-reader form
Under, it is subject to sequence content illustrated herein.
Step (2)
The step of step (2) of the invention is sequencing sequence needed for extracting from sequencing data.Specifically, including the use of sample
This special sequence label extracts sample data from sequencing data, and is mentioned from sample data according to amplimer composition
Take out the corresponding sequencing sequence of biomarker of each MSI.
As described above, special sequence label is the sequence for sample data to be marked.Pass through special sequence label
General sequencing data can be distinguished with sample data.After extracting sample data using special sequence label, then
The corresponding sequencing sequence of each biomarker is further extracted according to each amplimer in amplimer composition.That is, by
The sequencing sequence at least part sequence as each biomarker that amplimer obtains amplification, usually in 100-
Between 300bp, between preferably 150-250bp.
For example, amplimer include the first amplimer to, the second amplimer to, third amplimer to, the 4th
Amplimer to and the 5th amplimer pair, and the first amplimer is at least partly sequence for being specifically bound to BAT25
In the case of, by the first amplimer to can extract by the first amplimer to the obtained sequencing sequence of amplification.Similarly,
By the second amplimer to the sequencing sequence expanded by the second amplimer can be extracted.
Step (3)
Step (3) of the invention calculates the step of calculated value of each biomarker.Specifically, it including calculates corresponding to each
The length of the sequencing sequence of biomarker, and the sequencing sequence number that each length is distributed is counted, it chooses in each biomarker
Distribute calculated value of the most length of sequencing sequence as the biomarker.
Step (4)
Step (4) of the invention includes that each biological marker is calculated in human blood database according to amplimer composition
The average value and standard deviation of sequence length corresponding to amplimer in object.Wherein human blood database is given data composition
Library.The combination for being currently known data can be used in it, can also be by collecting public data at present and the new data that is combined into
Library.In addition, each company or unit can also collect composition human blood database as needed and voluntarily.
Step (5)
Step (5) of the invention is to calculate Z value, and whether evaluate based on the absolute value of Z value biomarker stable
Step.Specifically, including the use of formula (I): Z value=(calculated value-average value)/standard deviation calculates Z value.If | Z value | >=3,
Think that the biomarker is unstable, if | Z value | < 3, then it is assumed that the biomarker is stablized.
Whether step (5) of the invention further comprises unstable stable to evaluate tissue samples according to biomarker
Step.Specifically, the stability of at least five biomarker from same tissue samples is evaluated according to above-mentioned steps.If
There are 2 or more biomarkers unstable, then it is assumed that the tissue samples are high frequency instability modes, i.e. MSI-H type.If there is 1
A biomarker below is unstable, then it is assumed that the tissue samples are stable types, i.e. MSS type.
[for the composition based on microsatellite instability of the two generation sequencing technologies detection without check sample]
The second aspect of the present invention is provided for detecting the microsatellite instability without check sample based on two generation sequencing technologies
Composition, the present invention sometimes letter make " composition of the invention ".Composition of the invention is included at least for tissue samples
Build library and obtains the amplimer composition in sample library, the special sequence label of sample and anti-for primer extend and amplification
The reagent answered.
The special sequence label of amplimer composition and sample of the invention is carried out in the first aspect of the present invention
Illustrate, for repeating part, details are not described herein.The following contents is the supplement carried out on the basis of first aspect disclosure
Explanation.
The existence form of amplimer combination of the invention is not particularly limited, and can be deposited with dry powder or solution form.The present invention
Primer composition can be the form of mixtures of whole primer compositions, be also possible to each primer individually existing form, also
It can be two or more part primer composition mixtures, exist in the form of a variety of different mixtures.
Reagent known in the art or component can be used in reagent for primer extend and amplified reaction of the invention.Example
Such as, in some embodiments, the reagent for primer extend and amplified reaction may include one or more following components: DNA
Polymerase (thermostable DNA polymerase etc.), polymerase chain reaction buffer, RT Buffer and deoxyribonucleoside three
Phosphoric acid (dNTP).Optionally, including the reagent for carrying out hybridization analysis.It may also include nucleotide analog and/or labeling section
Point, such as direct detectable part such as fluorogen (fluorescent dye) or radioactive isotope or indirect detectable part such as combine
Pair member's such as biotin, or non-solubility colorimetric or luminescence-producing reaction (luminometric reaction) can be catalyzed
Enzyme.In addition, composition of the invention can further comprise at least one container for nucleic acid electrophoresis detection reagent.Such examination
Agent includes directly detecting those of nucleic acid, as fluorescence is fitted into agent or silver staining reagent, or is tried for detect those of nucleic acid marked
Agent.
[purposes]
The third aspect of the present invention provides composition described in second aspect of the present invention in preparation for being sequenced based on two generations
Technology detect the microsatellite instability without check sample detection agent in purposes, the present invention sometimes referred to as " use of the invention
On the way ".
Detection agent of the invention can be provided in the form of kit.In the case where providing in a kit form, this hair
Bright kit may also include relevant to regulation manufacture, use or sale diagnostic kit in the form of as defined in government organs
Points for attention.The detail specifications of use, storage and troubleshooting can also be provided in kit.Kit is also optionally arranged
It is preferred in the device of the robot manipulation of high throughput setting what is be suitble to.
The component of kit of the invention can provide as dry powder.When reagent and/or component are provided as dry powder, powder can lead to
The suitable solvent of addition is crossed to restore to the original state.It is expected that the solvent may also be disposed in another container.Container would generally include at least
A kind of bottle, test tube, flask, bottle, syringe and/or other container means, wherein optional partially place solvent.Kit is also
It may include the second container means to contain sterile, pharmaceutically acceptable buffer and/or other solvents.
In kit exist be more than a kind of component in the case where, the kit would generally also comprising can it is individually placed in addition
Component second, third or other other containers.In addition, can in a reservoir include the combination of each various ingredients.
Kit of the invention may also include holding or maintain the component of DNA, such as the reagent of anti-nucleolysis.Such group
Divide to be the nuclease of the protection for example or without RNase or with anti-RNase.Any composition as described herein or reagent can be
Component in kit.
Embodiment 1
It chooses and reads micro- kit (patent No.: 2,011 1 0152226.X of ZL) verifying MSI result by 3730 known to 10
Single tissue samples.Totally 3 MSI-H high frequency instability modes, 7 MSS stable types.Analysis method through the invention detects
MSI.Specific step is as follows:
The present embodiment with sample1 illustrate (3730 read micro- kit verification result as depicted in figs. 1 and 2) be illustrated.
1. selection 5 detection microsatellite instability (MSI) biomarkers, respectively BAT25, BAT26, MONO27,
NR21 and NR24, and amplimer is designed to each marker, it is as follows: BAT25 primer:
Primer 1:TCTGCATTTTAACTATGGCTC
Primer 2: CTCGCCTCCAAGAATGTAAGT
BAT26 primer:
Primer 1:CTGCGGTAATCAAGTTTTTAG
Primer 2: AACCATTCAACATTTTTAACCC
MONO27 primer:
Primer 1:GAAATGGTGGGAACCCAG
Primer 2: GGTGGATCAAATTTCACTTGG
NR21 primer:
Primer 1:GAGTCGCTGGCACAGTTCTA
Primer 2: CTGGTCACTCGCGTTTACAA
NR24 primer:
Primer 1:ATTGTGCCATTGCATTCCAA
Primer 2: GTGTCTTGCTGAATTTTACCTCCTGAC
2. the primer according to designed by step 1 carries out conventional amplicon to single tissue samples sample1 and builds library；It will be mentioned
GDNA requires to be diluted to corresponding nano drop concentration according to kit, sample1 sample DNA be 20ng/ul and according to
Lower condition prepares 20ul system: phoenix buffer 5ul, Taq 0.1ul, dNTP 2ul, sample1 sample DNA 40ng,
Different amounts, the final concentration of 900nM of MONO27 and BAT26, the final concentration of NR24 are added according to site difference for forward and reverse primer
For 600nM, remaining site is 250nM；PCR amplification, amplification program are carried out using life amplification instrument are as follows: 98 DEG C of 30s, 98 DEG C
10s, 58 DEG C of 15s, 72 DEG C of 20s, 72 DEG C of 2min, 4 DEG C of ∞, totally 20 recycle；1.6 times of magnetic beads for purifying products, 20ul water elution
Afterwards, it takes 19ul as next round template, it is as follows to prepare the second wheel 30ul amplification system: phoenix buffer 6ul, Taq
0.15ul, dNTP 3ul, template 19ul, forward and reverse each 1ul of primer；PCR amplification, amplification program are carried out using life amplification instrument
Are as follows: 98 DEG C of 30s, 98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 20s, 72 DEG C of 2min, 4 DEG C of ∞, totally 20 recycle；1.6 times of magnetic beads for purifying produce
20ul water elution after object carries out Qubit and 2100 quality inspections.
3. the library of each biomarker is carried out pooling, to 5 biomarkers of sample1 sample
The library pooling adds 1 special sequence label, carries out both-end with Illumina Miseq sequenator and reads long 300bp sequencing.
4. the data of sample1 sample are splitted out from the total data that sequencing obtains according to special sequence label.
5. according to the primer sequence of 5 biomarkers in step 1 by 5 biologies in the sequencing data of sample1
The sequencing data of marker extracts.
6. calculating separately the length of 5 biomarker sequencing sequences, and count the sequencing sequence that each length is distributed
Number.
7. choosing the length representative biomarker that distribution sequencing sequence number is most in 5 biomarkers respectively
" calculated value ", so that " calculated value " that obtains BAT25 is 122；" calculated value " of BAT26 is 177；" calculated value " of MONO27
It is 169；" calculated value " of NR21 is 107；" calculated value " of NR24 is 133.
8. forward and reverse amplimer of 5 biomarkers according to designed by step 1 is in human blood sample database (oneself
Main accumulation) in calculate 5 biomarkers the most length of distribution sequencing sequence number average value and standard deviation, respectively
The average value of BAT25 is 123.9038462, standard deviation 0.533564241；The average value of BAT26 is 179.0666667, mark
Quasi- difference is 0.393122697；The average value of MONO27 is 171.5357143, standard deviation 2.088620995；NR21's is averaged
Value is 110.9642857, standard deviation 0.631427984；The average value of NR24 is 133.8653846, and standard deviation is
0.595039829。
9. utilizing " calculated value " and the corresponding biology obtained in step 8 of obtained 5 biomarkers in step 7
The average and standard deviation of the blood of marker calculates Z-score value (Z value), and the Z-score value for respectively obtaining BAT25 is-
3.568166693, BAT26 Z-score value is that the Z-score value of -5.25705, MONO27 is the Z- of -1.21406, NR21
Score value is that the Z-score value of -6.278286386, NR24 is -1.454330573.
10. biomarker stability criterion: if | Z-score | >=3, then it is assumed that the biomarker is unstable
It is fixed, if | Z-score | < 3, then it is assumed that the biomarker is stablized.Based on the standard, determine that BAT25, BAT26, NR21 are
Instability mode, MONO27, NR24 are stable type.It is consistent that the result with 3730 reads micro- kit verification result.
11. structure stability judgment criteria: if there is 2 or more biomarkers are unstable, then it is assumed that the tissue sample
Originally be unstable (MSI-H) type of high frequency, if there is 0 or 1 biomarker it is unstable, then it is assumed that the tissue samples are steady
Fixed (MSS) type.Based on the standard, then it is instability mode that sample1 sample, which has 4 markers, thus can determine that sample1 sample
This is unstable (MSI) type of high frequency.It is consistent that this with 3730 reads micro- kit verification result.
Embodiment 2-10
Other than tissue samples are become sample2-10 respectively, verified in the same manner as example 1.It is real
The verification result for applying a 2-10 is as shown in table 1.
The verification result table of 1 the method for the invention of table
| Sample | BAT25-Z | BAT26-Z | MONO27-Z | NR21-Z | NR24-Z | Judgement | 3730 |
| sample2 | -14.81329809 | -30.69440348 | -5.04433993 | 0.056561139 | -8.176569664 | +++-+ | MSI-H |
| sample3 | -1.693978127 | -0.16958234 | -0.735276668 | 0.056561139 | 0.2262292 | ----- | MSS |
| sample4 | 0.180210439 | -0.16958234 | 1.17986256 | 1.64027302 | 0.2262292 | ----- | MSS |
| sample5 | 0.180210439 | -0.16958234 | 0.222292946 | 0.056561139 | 1.906788973 | ----- | MSS |
| sample6 | 0.180210439 | -0.16958234 | 0.222292946 | 0.056561139 | 0.2262292 | ----- | MSS |
| sample7 | 0.180210439 | -0.16958234 | 0.222292946 | 0.056561139 | 0.2262292 | ----- | MSS |
| sample8 | -1.693978127 | -7.800787626 | -2.171631089 | -6.278286386 | -4.815450118 | -+-++ | MSI-H |
| sample9 | 2.054399005 | -0.16958234 | 0.222292946 | 1.64027302 | 0.2262292 | ----- | MSS |
| sample10 | 0.180210439 | -0.16958234 | 0.222292946 | 0.056561139 | 1.906788973 | ----- | MSS |
Note: "+" represents unstable, "-" representative stabilization, and grey parts indicate unstable marker in table.
Without departing substantially from the scope or spirit of the invention, the specific embodiment of description of the invention can be done more
Kind improvements and changes, this will be apparent to those skilled in the art.Other realities obtained by specification of the invention
Applying mode for technical personnel is apparent obtain.Present specification and embodiment are merely exemplary.
SEQUENCE LISTING
<110>first code Gene science (Beijing) limited liability company
<120>method, composition and purposes based on microsatellite instability of the two generation sequencing technologies detection without check sample
<130> 1803051CN
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213>artificial sequence
<400> 1
tctgcatttt aactatggct c 21
<210> 2
<211> 21
<212> DNA
<213>artificial sequence
<400> 2
ctcgcctcca agaatgtaag t 21
<210> 3
<211> 21
<212> DNA
<213>artificial sequence
<400> 3
ctgcggtaat caagttttta g 21
<210> 4
<211> 22
<212> DNA
<213>artificial sequence
<400> 4
aaccattcaa catttttaac cc 22
<210> 5
<211> 18
<212> DNA
<213>artificial sequence
<400> 5
gaaatggtgg gaacccag 18
<210> 6
<211> 21
<212> DNA
<213>artificial sequence
<400> 6
ggtggatcaa atttcacttg g 21
<210> 7
<211> 20
<212> DNA
<213>artificial sequence
<400> 7
gagtcgctgg cacagttcta 20
<210> 8
<211> 20
<212> DNA
<213>artificial sequence
<400> 8
ctggtcactc gcgtttacaa 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence
<400> 9
attgtgccat tgcattccaa 20
<210> 10
<211> 27
<212> DNA
<213>artificial sequence
<400> 10
gtgtcttgct gaattttacc tcctgac 27
Claims (10)
1. a kind of method based on microsatellite instability of the two generation sequencing technologies detection without check sample, which is characterized in that it is wrapped
Include following steps:
(1) tissue samples are carried out building library using amplimer composition and obtains sample library, the sample library is surveyed
Sequence obtains sequencing data, does not include wherein check sample in the step；
(2) sample data is extracted from the sequencing data using the special sequence label of the sample, and according to the expansion
Increase the corresponding sequencing sequence of biomarker that Primer composition extracts each MSI from the sample data；
(3) length of the sequencing sequence of each biomarker is calculated, and counts the sequencing sequence number that each length is distributed, is chosen each
Calculated value of the most length of sequencing sequence as the biomarker is distributed in biomarker；
(4) amplimer in each biomarker is calculated in human blood database according to the amplimer composition
The average value and standard deviation of the most sequence length of corresponding sequencing sequence；
(5) Z value is calculated using formula (I), if | Z value |>=3, then it is assumed that the biomarker is unstable, if | Z value |<3,
Then think that the biomarker is stablized, wherein formula (I): Z value=(calculated value-average value)/standard deviation；
If there is 2 or more biomarkers are unstable, then it is assumed that the tissue samples are high frequency instability mode, i.e. MSI-H
Type, if there is 1 biomarker below is unstable, then it is assumed that the tissue samples are stable types, i.e. MSS type.
2. the method according to claim 1 based on microsatellite instability of the two generation sequencing technologies detection without check sample,
It is characterized in that, each primer specificity in the amplimer composition is bound to the biomarker of MSI at least partly
Sequence, wherein the biomarker come from selected from by KIT, MSH2, BIRC3, SLC7A8, ZNF2, MAP4K3, REEP5,
DEFB105A、DEFB105B、ACVR2A、RNF43、DOCK3、GTF2IP1、LOC100093631、ARHGEF12、NOMO1、
At least one of the group of PIP5K1A, KIF14 (dist.=4,175bp) and DDX59 (dist.=19,111bp) composition base
Cause.
3. the method according to claim 2 based on microsatellite instability of the two generation sequencing technologies detection without check sample,
It is characterized in that, the amplimer composition includes the first amplimer to, the second amplimer to, third amplimer
To, the 4th amplimer to and the 5th amplimer pair, wherein each amplimer to being specifically bound to the 5 of MSI respectively
At least partly sequence of the different biomarker of kind.
4. the method according to claim 3 based on microsatellite instability of the two generation sequencing technologies detection without check sample,
It is characterized in that, the amplimer composition includes sequence shown in SEQ ID NO:1-10.
5. the method according to claim 4 based on microsatellite instability of the two generation sequencing technologies detection without check sample,
It is characterized in that, step (1) is by including that the process of first round amplification and the second wheel amplification builds library, wherein first round amplification with
The 50ng/ μ l DNA below from the tissue samples be template, using 98 DEG C of 30s, 98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 20s,
72 DEG C of 2min, 4 DEG C of ∞, the amplification program of totally 20 circulations, the second wheel are expanded using first round amplified production as template, using 98 DEG C
30s, 98 DEG C of 10s, 58 DEG C of 15s, 72 DEG C of 20s, 72 DEG C of 2min, 4 DEG C of ∞, totally 20 circulation amplification program.
6. the method according to claim 5 based on microsatellite instability of the two generation sequencing technologies detection without check sample,
It is characterized in that, sequencing described in step (1) is the sequencing of two generations.
7. the method according to claim 5 based on microsatellite instability of the two generation sequencing technologies detection without check sample,
It is characterized in that, the tissue samples are potential cancer tissue, it does not include blood or its ingredient.
8. the method according to claim 4 based on microsatellite instability of the two generation sequencing technologies detection without check sample,
It is characterized in that, the step of adding special sequence label into gained sample library after step (1) builds library.
9. a kind of for the composition based on microsatellite instability of the two generation sequencing technologies detection without check sample, feature exists
In, including for tissue samples build library obtain the amplimer composition in sample library, sample special sequence label,
Reagent for primer extend and amplified reaction.
10. composition according to claim 9 is in preparation for being detected based on two generation sequencing technologies without the micro- of check sample
Purposes in the unstable detection agent of satellite.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811050997.6A CN109055509B (en) | 2018-09-10 | 2018-09-10 | Method, composition and use for detecting microsatellite instability of non-control sample based on next generation sequencing technology |
| CN202110721218.6A CN113416769B (en) | 2018-09-10 | 2018-09-10 | Method, composition and use for detecting microsatellite instability of non-control sample based on next generation sequencing technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811050997.6A CN109055509B (en) | 2018-09-10 | 2018-09-10 | Method, composition and use for detecting microsatellite instability of non-control sample based on next generation sequencing technology |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110721218.6A Division CN113416769B (en) | 2018-09-10 | 2018-09-10 | Method, composition and use for detecting microsatellite instability of non-control sample based on next generation sequencing technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109055509A true CN109055509A (en) | 2018-12-21 |
| CN109055509B CN109055509B (en) | 2021-07-23 |
Family
ID=64760151
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811050997.6A Active CN109055509B (en) | 2018-09-10 | 2018-09-10 | Method, composition and use for detecting microsatellite instability of non-control sample based on next generation sequencing technology |
| CN202110721218.6A Active CN113416769B (en) | 2018-09-10 | 2018-09-10 | Method, composition and use for detecting microsatellite instability of non-control sample based on next generation sequencing technology |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110721218.6A Active CN113416769B (en) | 2018-09-10 | 2018-09-10 | Method, composition and use for detecting microsatellite instability of non-control sample based on next generation sequencing technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN109055509B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111223526A (en) * | 2019-11-15 | 2020-06-02 | 深圳裕策生物科技有限公司 | Microsatellite instability detection method and device based on next-generation sequencing blood sample |
| CN111863133A (en) * | 2019-12-30 | 2020-10-30 | 上海交通大学医学院附属瑞金医院 | Analysis method, kit and analysis system of high-throughput sequencing data |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102230004A (en) * | 2011-06-08 | 2011-11-02 | 北京阅微基因技术有限公司 | Tumor cell microsatellite instable state complex amplification system and detection kit |
| CN105256057A (en) * | 2015-11-19 | 2016-01-20 | 湖南宏雅基因技术有限公司 | Colon cancer microsatellite instability detection kit based on next generation sequencing platform |
| CN106755501A (en) * | 2017-01-25 | 2017-05-31 | 广州燃石医学检验所有限公司 | It is a kind of to be based on detection microsatellite locus stability and the method for genome change while the sequencing of two generations |
| CN107299139A (en) * | 2017-07-25 | 2017-10-27 | 北京鑫诺美迪基因检测技术有限公司 | A kind of composition and its application for being used to detect microsatellite instability |
| CN108070658A (en) * | 2017-12-13 | 2018-05-25 | 元码基因科技（北京）股份有限公司 | Detect the non-diagnostic method of MSI |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108315426A (en) * | 2018-04-12 | 2018-07-24 | 北京信诺佰世医学检验所有限公司 | Marker combination, primer sets and the kit of microsatellite sequence Detection of Stability |
-
2018
- 2018-09-10 CN CN201811050997.6A patent/CN109055509B/en active Active
- 2018-09-10 CN CN202110721218.6A patent/CN113416769B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102230004A (en) * | 2011-06-08 | 2011-11-02 | 北京阅微基因技术有限公司 | Tumor cell microsatellite instable state complex amplification system and detection kit |
| CN105256057A (en) * | 2015-11-19 | 2016-01-20 | 湖南宏雅基因技术有限公司 | Colon cancer microsatellite instability detection kit based on next generation sequencing platform |
| CN106755501A (en) * | 2017-01-25 | 2017-05-31 | 广州燃石医学检验所有限公司 | It is a kind of to be based on detection microsatellite locus stability and the method for genome change while the sequencing of two generations |
| CN107299139A (en) * | 2017-07-25 | 2017-10-27 | 北京鑫诺美迪基因检测技术有限公司 | A kind of composition and its application for being used to detect microsatellite instability |
| CN108070658A (en) * | 2017-12-13 | 2018-05-25 | 元码基因科技（北京）股份有限公司 | Detect the non-diagnostic method of MSI |
Non-Patent Citations (2)
| Title |
|---|
| BAGLIETTO L等: "Risk of lynch syndrome cancers for msh6 mutation carriers.", 《JOURNAL OF THE NATIONAL CANCER INSTITUTE》 * |
| LIZHEN ZHU等: "A Novel and Reliable Method to Detect Microsatellite Instability in Colorectal Cancer by Next-Generation Sequencing", 《THE JOURNAL OF MOLECULAR DIAGNOSTICS》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111223526A (en) * | 2019-11-15 | 2020-06-02 | 深圳裕策生物科技有限公司 | Microsatellite instability detection method and device based on next-generation sequencing blood sample |
| CN111223526B (en) * | 2019-11-15 | 2022-05-20 | 深圳裕策生物科技有限公司 | Microsatellite instability detection method and device based on next-generation sequencing blood sample |
| CN111863133A (en) * | 2019-12-30 | 2020-10-30 | 上海交通大学医学院附属瑞金医院 | Analysis method, kit and analysis system of high-throughput sequencing data |
| CN111863133B (en) * | 2019-12-30 | 2023-07-18 | 上海交通大学医学院附属瑞金医院 | Analysis method, kit and analysis system for high-throughput sequencing data |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109055509B (en) | 2021-07-23 |
| CN113416769B (en) | 2022-12-09 |
| CN113416769A (en) | 2021-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102703595B (en) | STR (short tandem repeat) sequence high-throughput detection method with base selective controllable extension and detection reagent thereof | |
| CN108300716A (en) | Joint component, its application and the method that targeting sequencing library structure is carried out based on asymmetric multiplex PCR | |
| CN108070658B (en) | Non-diagnostic method for detecting MSI | |
| CN114107513B (en) | Detection method and kit for bladder urothelial cancer diagnosis | |
| CN108949757B (en) | Primer composition, kit and method for detecting microsatellite instability based on next-generation sequencing platform | |
| CN107904317A (en) | Mankind's euchromosome STR polymorphic site composite amplification reagent kit and its application | |
| CN106521013B (en) | It is a kind of for it is micro, degradation sample STR kit and its application | |
| CN106498036A (en) | A kind of construction method in the Drug Discovery SNP variations library for high-flux sequence detection and its application | |
| CN107841566B (en) | Composite amplification system for rapidly mutating short tandem repeat sequence of Y chromosome, kit and application | |
| CN109055509A (en) | Method, composition and purposes based on microsatellite instability of the two generation sequencing technologies detection without check sample | |
| CN111690748A (en) | Probe set and kit for detecting instability of microsatellite by using high-throughput sequencing and detection method for instability of microsatellite | |
| CN105506156B (en) | Diagnose the molecular marker of osteosarcoma | |
| CN111748628B (en) | Primer and kit for detecting thyroid cancer prognosis related gene variation | |
| CN104031989B (en) | The test kit of the composite amplification of a kind of human gene group DNA 26 locus | |
| CN108753952A (en) | A kind of gene parting detecting reagent for 10 common mutations sites of mankind SLC25A13 genes | |
| KR101775953B1 (en) | Detection methods of mutation and the kits | |
| EP1650311A1 (en) | Compounds and methods for assessment of Microsatellite Instability (MSI) status | |
| CN107058579A (en) | Adenocarcinoma of lung related miRNA, composition and its application | |
| CN109477244A (en) | Bladder cancer detection is carried out using microsatellite analysis in the buccal swab of pairing and urine specimen | |
| CN111020710A (en) | ctDNA high-throughput detection of hematopoietic and lymphoid tissue tumors | |
| CN101509040B (en) | Reagent kit for inosculating status analysis after hemopoietic stem cell transplantation and uses thereof | |
| CN107365841A (en) | For detecting pcr amplification primer thing, kit and the detection method of MPL genes W515 mutation | |
| CN114196740A (en) | Digital amplification detection method, detection product and detection kit for simultaneously identifying multiple gene types | |
| CN109750098B (en) | ATP7B gene large fragment deletion detection kit and detection method | |
| CN107151707A (en) | A kind of kit for detecting lung cancer related gene hot spot mutation and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |