CN109055322A - Recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI- and its construction method and application - Google Patents

Recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI- and its construction method and application Download PDF

Info

Publication number
CN109055322A
CN109055322A CN201810948406.0A CN201810948406A CN109055322A CN 109055322 A CN109055322 A CN 109055322A CN 201810948406 A CN201810948406 A CN 201810948406A CN 109055322 A CN109055322 A CN 109055322A
Authority
CN
China
Prior art keywords
rprv
cell
virus
egfp
porcine pseudorabies
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810948406.0A
Other languages
Chinese (zh)
Inventor
陈红英
杨明凡
张宇
韩昊莹
徐朋丽
郑慧华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan Agricultural University
Original Assignee
Henan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan Agricultural University filed Critical Henan Agricultural University
Priority to CN201810948406.0A priority Critical patent/CN109055322A/en
Publication of CN109055322A publication Critical patent/CN109055322A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A61P31/22—Antivirals for DNA viruses for herpes viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16721—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16734—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/16011—Herpesviridae
    • C12N2710/16711—Varicellovirus, e.g. human herpesvirus 3, Varicella Zoster, pseudorabies
    • C12N2710/16751—Methods of production or purification of viral material

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to recombinant porcine pseudorabies poison rPRV HN2012-TK‑/gE‑/gI‑And its construction method and application, belong to virus formulation technical field.Recombinant porcine pseudorabies poison rPRVHN2012-TK provided by the invention‑/gE‑/gI‑Deposit number is CCTCCNO:V201748.Viral safety and immune efficacy provided by the invention are very high, can be efficiently applied to during the vaccine preparation of current PRV prevalence prevention and control.

Description

Recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI- and its construction method And application
Technical field
The present invention relates to virus formulation technical fields, and in particular to recombinant porcine pseudorabies poison rPRV HN2012-TK-/ gE-/gI-And its construction method and application.
Background technique
Pseudoabies (Pseudorabies, PR), i.e. Ao Yezishi disease (Aujeszky ' s disease), cause of disease are pseudo- Hydrophobin (Pseudorabies virus, PRV), a variety of domestic animals such as ox, sheep, pig and wild animal can suffer from the disease.PR Cardinal symptom be fever, surprise itch, encephalomyelitis, nerve and propagating system obstacle, be a kind of acute infectious disease, and at present still Without develop can successful treatment PR drug, can only clinically using inoculation such as PRV Bartha-K61 attenuated vaccine come pair PR carries out prevention and control.But after 2011, it had been immunized in the multiple provinces in China in the swinery of pseudo- rabies vaccine and new round PR has occurred Epidemic situation is very popular.Then many researchs also confirm the Bartha-K61 attenuated vaccine strain being often inoculated in the market to current successively Popular PRV variant cannot provide fully effective protection, this wheel is made with the PR epidemic situation that PRV prevalence variant causes The pig breeding industry in China faces huge risk, therefore a kind of effective vaccine that can be directed to current popular variant is suddenly to be developed.
Summary of the invention
The purpose of the present invention is to provide recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI-And its building side Method and application.Viral safety and immune efficacy provided by the invention are very high, can be efficiently applied to current PRV prevalence prevention and control work During the vaccine preparation of work.
The present invention provides recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI-, deposit number CCTCC NO:V201748.
The present invention also provides construction methods viral described in above-mentioned technical proposal, comprising the following steps:
1) two lateral order of TK gene of herpetoviridae herpesvirus suis I type porcine pseudorabies virus PRV/HN2012 is expanded respectively Column are cloned into pUC-19 carrier, obtain the first transferring plasmid pUC-TKLR, then EGFP gene expression cassette is cloned into transferring plasmid On pUC-TKLR, the second transferring plasmid pUC-TKLRE is obtained；The position of the EGFP gene expression cassette clone is in TK gene two sides The centre of sequence；
2) by recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-Be inoculated in cell, adsorb 1~2h after, obtain through Recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-The cell of infection, the second transferring plasmid pUC- that step 1) is obtained TKLRE is transfected in through recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-In the cell of infection, pass through Plaque-purified acquisition Express the intermediary virus rPRV HN2012-gE of fluorescin-/gI-/TK--EGFP+；
3) the intermediary virus rPRV HN2012-gE for obtaining step 2)-/gI-/TK--EGFP+It is inoculated in cell, adsorbs After 1~2h, obtain through intermediary virus rPRV HN2012-gE-/gI-/TK--EGFP+The cell of infection obtains the step 1) The first transferring plasmid pUC-TKLR transfect in through intermediary virus rPRV HN2012-gE-/gI-/TK--EGFP+The cell of infection In, by Plaque-purified removal EGFP gene expression cassette, obtain recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI-；
The deposit number of the herpetoviridae herpesvirus suis I type porcine pseudorabies virus PRV/HN2012 is CCTCC NO:V201314；
The recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-Deposit number be CCTCC NO:V201749.
Preferably, the length of nucleotides of step 1) TK gene two sides sequence independently is 750~1500bp.
Preferably, the nucleotide sequence of step 1) the EGFP gene expression cassette is by following genetic fragment successively arrangement group At: CMV, MCS, EGFP and SV40 PolyA tail.
Preferably, step 2) and step 3) inoculation cell include ST cell.
Preferably, the ST cell is when culture to cell fusion 70%, for being inoculated with.
Preferably, step 2) the Plaque-purified number is 4~7 times, and all viruses are observed under the conditions of blue light Plaque shows that purifying is complete when being in green fluorescence.
Preferably, step 3) the Plaque-purified number is 4~7 times, and all viruses are observed under the conditions of blue light Plaque shows that purifying is complete when green fluorescence not being presented.
The present invention also provides recombinant porcine pseudorabies poison rPRV HN2012-TK described in above-mentioned technical proposal-/gE-/gI- Or the recombinant porcine pseudorabies poison rPRV HN2012-TK that preparation method described in above-mentioned technical proposal is prepared-/gE-/gI-? Prepare the application in porcine pseudorabies virus vaccine.
The present invention provides recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI-.Recombination disease provided by the invention Poison is highly-safe, and immune efficacy is good.Test result shows rPRV HN2012-TK-/gE-/gI-Immune group mouse is in test process In without there is any adverse reaction, virus weakening situation is ideal；Result of indirect ELISA shows rPRV HN2012-TK-/gE-/ gI-Immune group produces the PRV antibody compared with high titre in immunologic process, and neutralizing antibody level also demonstrates that the deleted virus is protected Good immunogenicity is held, furthermore the measurement result of peripheral T lymphocyte subsets of mice also indicates that the deleted virus is effective Ground stimulates mouse body to generate cellular immunity；The Cerebral pathology slice of mouse also illustrates that low virulent strain also hinders to a certain extent Invasion of the velogen strain to nerve fiber, have played certain protective effect.In short, rPRV HN2012-TK of the present invention-/gE-/ gI-Three gene delection viruses be to non-target animals mouse it is safe, can effectively and rapidly generate PRV specific antibody after immune, And can effectively active cell be immunized, it is one plant of vaccine strain being hopeful applied to current PRV prevalence prevention and control.
Detailed description of the invention
Fig. 1 is the transferring plasmid constructing technology route map that the embodiment of the present invention 1 provides；
Fig. 2 is the pG plasmid gene structure chart that the embodiment of the present invention 1 provides；
Fig. 3 is the amplification screenshot for the homology arm that the embodiment of the present invention 1 provides；
Fig. 4 is the digestion qualification figure of recombinant plasmid pMD-TKL, pMD-TKR that the embodiment of the present invention 1 provides；
Fig. 5 is the digestion qualification figure for the transferring plasmid that the embodiment of the present invention 1 provides；
Fig. 6 is the digestion qualification figure for the pG plasmid that the embodiment of the present invention 1 provides；
Fig. 7 is the bacterium solution PCR qualification figure that the embodiment of the present invention 1 provides；
Fig. 8 is the plaque photo observed under the different illumination that the embodiment of the present invention 2 provides；
Fig. 9 is the TK lack part PCR qualification result figure that the embodiment of the present invention 2 provides；
Figure 10 is the plaque photo observed under the different illumination that the embodiment of the present invention 2 provides；
Figure 11 is the TK lack part PCR qualification result figure that the embodiment of the present invention 2 provides；
Figure 12 is the recombinant virus rPRV HN2012-TK that the embodiment of the present invention 2 provides-/gE-/gI-The identification knot of gB gene Fruit figure；
Figure 13 is the one step growth curve figure of deleted virus and parent's strain that the embodiment of the present invention 2 provides；
Figure 14 is the mouse PPV antibody test result figure that the embodiment of the present invention 3 provides；
Figure 15 is horizontal (log2) result figure of PRV neutralize antibody titers that the embodiment of the present invention 3 provides；
CD3 in the mouse peripheral blood that Figure 16 provides for the embodiment of the present invention 3+、CD4+、CD8+The measurement of T lymphocyte quantity Result figure；
Figure 17 is the survivorship curve figure for the mouse that the embodiment of the present invention 3 provides；
Figure 18 is the wound status result figure for the dead mouse that the embodiment of the present invention 3 provides；
Figure 19 is the microglia aggregation figure that the embodiment of the present invention 3 provides；
Figure 20 is that the Cerebral pathology for the mouse that the embodiment of the present invention 3 provides is sliced result figure.
Specific embodiment
The present invention provides recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI-, deposit number CCTCC NO:V201748.This strain is deposited in China typical culture collection center, and address is Wuhan City, Hubei Province Wuchang District Bayi Road No. 299, Wuhan University, the preservation time is on October 31st, 2017.The missing of TK gene can be substantially reduced PRV infecting potential, Transmissibility and virulence, but remain to that it is made to keep good immunogenicity.
The present invention also provides construction methods viral described in above-mentioned technical proposal, comprising the following steps:
1) two lateral order of TK gene of herpetoviridae herpesvirus suis I type porcine pseudorabies virus PRV/HN2012 is expanded respectively Column are cloned into pUC-19 carrier, obtain the first transferring plasmid pUC-TKLR, then EGFP gene expression cassette is cloned into transferring plasmid On pUC-TKLR, the second transferring plasmid pUC-TKLRE is obtained；The position of the EGFP gene expression cassette clone is in TK gene two sides The centre of sequence；
2) by recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-Be inoculated in cell, adsorb 1~2h after, obtain through Recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-The cell of infection, the second transferring plasmid pUC- that step 1) is obtained TKLRE is transfected in through recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-In the cell of infection, pass through Plaque-purified acquisition Express the intermediary virus rPRV HN2012-gE of fluorescin-/gI-/TK--EGFP+；
3) the intermediary virus rPRV HN2012-gE for obtaining step 2)-/gI-/TK--EGFP+It is inoculated in cell, adsorbs After 1~2h, obtain through intermediary virus rPRV HN2012-gE-/gI-/TK--EGFP+The cell of infection obtains the step 1) The first transferring plasmid pUC-TKLR transfect in through intermediary virus rPRV HN2012-gE-/gI-/TK--EGFP+The cell of infection In, by Plaque-purified removal EGFP gene expression cassette, obtain recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI-；
The deposit number of the herpetoviridae herpesvirus suis I type porcine pseudorabies virus PRV/HN2012 is CCTCC NO:V201314, this strain are deposited in China typical culture collection center, and address is Wuhan City, Hubei Province Wuchang District Bayi Road No. 299, Wuhan University, the preservation time is on May 28th, 2013.
The recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-Deposit number be CCTCC NO:V201749, this This strain is deposited in China typical culture collection center, and address is Wuhan City, Hubei Province Wuchang District Bayi Road 299, and Wuhan is big It learns, the preservation time is on October 31st, 2017.
The present invention expands the TK gene two of herpetoviridae herpesvirus suis I type porcine pseudorabies virus PRV/HN2012 respectively Lateral order column are cloned into pUC-19 carrier, obtain the first transferring plasmid pUC-TKLR, then EGFP gene expression cassette is cloned into transfer On plasmid pUC-TKLR, the second transferring plasmid pUC-TKLRE is obtained；The position of the EGFP gene expression cassette clone is in TK gene The centre of two sides sequence.In the present invention, the length of nucleotides of TK gene two sides sequence independently is 750~1500bp, More preferably 967~976bp, most preferably respectively 967bp and 976bp, (left and right recombination is homologous for TK gene of the present invention two sides sequence Arm) the setting of length range can guarantee going on smoothly for homologous recombination.TK gene of the present invention two sides sequence respectively as it is left, Right recombination homology arm, the building of the gene-deleted strain for subsequent TK gene.When the length of nucleotides point of TK gene two sides sequence Not Wei 967bp and 976bp when, preferred design two of the present invention is to specific primer TKL/F and TKL/R, TKR/F and TKR/R (such as table Shown in 1) for the left and right amplification for recombinating homology arm；The left recombination homology arm of the present invention preferably includes part UL24 gene and part TK gene, size 967bp, particular sequence are as follows: aagcttgccttatcatccccgctccccgccgccgcccggcccggccccgcgcgcgccgcgatcgcgatcaccgccgc ggcccggcgacgtactcggcgaggccgcgcacggtcgcggccatcgcgctcgcgttgccgcgcgtctgggtgcaggg caggcgcgtcacgtcgagcacgcgcatgctccgctgggccacaaacaccagcaggggcacgagcgtgatctcctcgc cgcccgggggcacggcggcggcgaggaggcgcgccgagtcgcgcagctggcacagcccctcgtgccgctgcccgcgc ttgctgggcgtgttgaggttccgggggaagcggcacgtcttgagctcgatgaggaagcacaggtgcgggcccgcccc cagccgcaccacgcacacgcagtcggggcggcgcaccccgaggttgacttcaaaggccagggtcaaggacgccttct taagcgtctctcggggaagcccgaagagactctcgccgtacgcggacgggtcgcgtcgcaggcgttcgtagaagcgg ttgtggcagcggatccccgcccggaagcgcgccgggatgcgcatcctccggatctacctcgacggcgcctacggcac cggcaagagcaccacggcccgggtgatggcgctcggcggggcgctgtacgtgcccgagccgatggcgtactggcgca ctctgttcgacacggacacggtggccggtatttacgatgcgcagacccggaagcagaacggcagcctgagcgaggag gacgcggccctcgtcacggcgcagcaccaggccgccttcgcgacgccgtacctgctgctgcacacgcgcctggtccc gctcttcgggcccgcggtcgagggcccgcccgagatgacggtcgtctttgaccgccacccggtggccgcgacggtgt gcttcccgctggcgcgcttcatcgtcggggacatcagctgcag(SEQ ID NO.1)；Right recombination homology arm preferably includes Part of TK gene and part UL22 gene, size 976bp, particular sequence are as follows: ctgcagtccaggacaccctcttcggcgcgtacaaggcgcccgagctctgcgaccggcgcgggcgcccgctcgaggtg cacgcgtgggcgatggacgcgctcgtggccaagctgctgccgctgcgcgtctccaccgtcgacctggggccctcgcc gcgcgtctgcgccgcggccgtggcggcgcaggcgcgcggcatggaggtgacggagtccgcgtacggcgaccacatcc ggcagtgcgtgtgcgccttcacgtcggagatgggggtgtgaccctcgcccctcccacccgcgccgcggccggatgga gaccgcgacggaggcaacgacgacggcgtgggagggggctcggggcgcgtataaagccatgtgtatgtcatcccaat aaagtttgccgtgcccgtcaccatgcccgcgtcgtccgtgcgcctcccgctgcgcctcctgaccctcgcgggcctcc tggccctcgcgggggccgccgccctcgcccgcggcgcgccgcagggtgggccgccctcgccgcaggggggtcccgcg cccaccgcggcgcccgcgcgcgggcccaccctgttcgtcctggacggcgacggctccgcgtggttcgtcttccagct cggcgggctgggggcgctcaacgacacgcgcatccgcgggcacctgctcggccggtacctcgtctcgtaccaggtgg tgcccccgcccgtctccgcgtggtactttgtgcagcgcccgcgcgagcgcccgcgcctctcggggccgccctcgggc gcggagctcgtggccttcgacgcgcccggcgtctggcgcacgtacaccacggcggcggtgtggcccgcggaggtggc cgtcctcgcggacgcggaggcgcgctgccccgcggccgtcttcaacgtgacgctgggcgaggccttcctcggcctgc gcgtcgcgctgcgctccttcctgccgctggaggtcatcatctccgcgaattc(SEQ ID NO.2).The present invention is to institute The amplification condition and identification method for stating left and right recombination homology arm do not have special restriction, using conventional method and condition to two sections Sequence is expanded and is identified.3 ' the ends of the left recombination homology arm primer TKL/R of the present invention and right recombination homology arm primer 5 ' the ends of TKR/F preferably use identical restriction enzyme site, the insertion for subsequent EGFP gene expression cassette.In the present invention, institute Stating restriction enzyme site is preferably Pst I.
Primer information needed for 1 homology arm of table expands
Note: F indicates upstream primer, and R indicates downstream primer
In the present invention, the nucleotide sequence of the EGFP gene expression cassette is successively arranged by following genetic fragment forms: CMV, MCS, EGFP and SV40 PolyA tail.The screening that EGFP gene expression cassette is applied to recombinant virus will greatly improve screening Accuracy, keep screening operation more convenient.The sequence size of EGFP gene expression cassette of the present invention is 1674bp, specific sequence It arranges as follows: ctgcaggattctgtggataaccgtattaccgccatgcattagttattaatagtaat caattacggggtca ttagttcataGcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacga cccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatggg tggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtc aatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatcta cgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgcggatagcggtttgactcac ggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaa tgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctgg tttagtgaaccgtcagatccgctagcgctaccggactcagatctcgagctcaagcttcgaattcgatccaccggtcg ccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaac ggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcac caccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcacctacggcgtgcagtgcttcagccgctacc ccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttc aaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaa gggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctata tcatggccgacaagcagaagaacggcatcgaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcag ctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcac ccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccggga tcactctcggcatggacgagctgtacaagtaaagcggccgcgactctagatcataatcagccataccacatttgtag aggttttacttgctttaaaaaacctcccacacctccccctgaacctgaaacataaaatgaatgcaattgttgttgtt aacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttc actgcattctagttgtggtttgtccaaactcatcaatgtatcttaaggcgtaaattgtctgcag(SEQ ID NO.3).In the present invention, the source of the EGFP gene expression cassette is preferably pseudorabies virus Deleted Transfer (PG), the present invention does not have special restriction to the source of the pseudorabies virus Deleted Transfer (PG), preferably adopts With the pseudorabies virus Deleted Transfer (PG) routinely reported, as built before Zhu in " pig gyrate virus II type The building of ORF2 and pig IL--2 genetic recombination porcine pseudorabies virus " a pseudorabies virus gene delection transfer disclosed herein Carrier (PG), pseudorabies virus Deleted Transfer (PG) of the present invention is by the great control and prevention of disease emphasis of Zhengzhou City pig Laboratory invention building.In the present invention, for the EGFP as marker gene, present invention preferably employs Pst I to carry out PG plasmid Digestion, in order to the building of subsequent second transferring plasmid.The building of first transferring plasmid and the second transferring plasmid of the present invention Flow chart is as shown in Figure 1.The position of EGFP gene expression cassette of the present invention clone's insertion in the centre of TK gene two sides sequence, In order to which subsequent second of homologous recombination reversely filters out the deleted virus without any foreign gene.It is homologous to obtain left and right recombination After arm and EGFP gene expression cassette, the present invention does not have special restriction to by the method in three sections of gene clonings to carrier, Using carrier construction method well known to those skilled in the art, such as digestion connection method.The sequence that the present invention connects digestion There is no a special restriction, preferably according to first left recombination homology arm, then right recombination homology arm, last EGFP gene expression cassette it is suitable Sequence.
The present invention is by recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-It is inoculated in cell, after adsorbing 1~2h, obtains To through recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-The cell of infection transfects the second transferring plasmid pUC-TKLRE In through recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-In the cell of infection, fluorescence egg is expressed by Plaque-purified acquisition White intermediary virus rPRV HN2012-gE-/gI-/TK--EGFP+.Compared to it is conventional by viruses adsorption and plasmid transfection simultaneously The method of progress, the present invention can greatly increase the effect of viral genome homologous recombination using the method first adsorbed, transfected afterwards Rate.In the present invention, inoculation preferably includes ST cell with cell.In the present invention, the ST cell waits cultivating to cell fusion When 70%, for being inoculated with.The present invention to the cultural method of cell, absorption, transfection other concrete operation methods do not have it is special It limits, using operating method well known to those skilled in the art.In the present invention, the time of the absorption is preferably 1.5h.Present invention preferably employs biodegradable nano particle transfection reagent XfectTM Transfection Reagent into Row transfection procedure.Xfect transfection reagent is prepared based on degradable nano particle, very low to cytotoxicity, transfection effect Rate is high, and the compatible serum in transfection process, easy to operate without using OPTI-MEM culture solution；In transfection process, cell Growth be in better state always, provide good environment for viral recombination.In the present invention, the plaque The number of purifying is 4~7 times, more preferably 5 times, is shown when observing all virus plaques under the conditions of blue light in green fluorescence Purifying is complete.The present invention does not have special restriction to the Plaque-purified concrete operations condition, using those skilled in the art Well known conventional plaque purification process method.
The present invention is by intermediary virus rPRV HN2012-gE-/gI-/TK--EGFP+It is inoculated in cell, after adsorbing 1~2h, It obtains through intermediary virus rPRV HN2012-gE-/gI-/TK--EGFP+The cell of infection turns the first transferring plasmid pUC-TKLR It contaminates in through intermediary virus rPRV HN2012-gE-/gI-/TK--EGFP+In the cell of infection, pass through Plaque-purified removal EGFP base Because of expression cassette, recombinant porcine pseudorabies poison rPRV HN2012-TK is obtained-/gE-/gI-.Compared to it is conventional by viruses adsorption and It is same can to greatly increase viral genome using the method first adsorbed, transfected afterwards by the method that plasmid transfection carries out simultaneously, the present invention The efficiency of source recombination.In the present invention, inoculation preferably includes ST cell with cell.In the present invention, the ST cell waits cultivating When to cell fusion 70%, for being inoculated with.The present invention to the source of cell, cultural method, absorption, transfection other concrete operations Method does not have special restriction, using conventional commercial ST cell well known to those skilled in the art and operating method, this hair The bright ST cell is preferably purchased from China Veterinary Drugs Supervisory Inst..In the present invention, the time of the absorption is preferably 1.5h.The present invention It is preferred that carrying out transfection procedure using biodegradable nano particle transfection reagent XfectTM Transfection Reagent. Xfect transfection reagent is prepared based on degradable nano particle, very low to cytotoxicity, and transfection efficiency is high, and is being turned Compatible serum, easy to operate without using OPTI-MEM culture solution during dye；In transfection process, the growth of cell is always In better state, the recombination for virus provides good environment.In the present invention, the Plaque-purified number It is 4~7 times, more preferably 5 times, is observed under the conditions of blue light and show to have purified when green fluorescence is not presented in all virus plaques Entirely.The present invention does not have special restriction to the Plaque-purified concrete operations condition, and use is well known to those skilled in the art Conventional plaque purification process method.
The present invention also provides recombinant porcine pseudorabies poison rPRV HN2012-TK described in above-mentioned technical proposal-/gE-/gI- Or the recombinant porcine pseudorabies poison rPRV HN2012-TK that preparation method described in above-mentioned technical proposal is prepared-/gE-/gI-? Prepare the application in porcine pseudorabies virus vaccine.
Combined with specific embodiments below to recombinant porcine pseudorabies poison rPRV HN2012-TK of the present invention-/gE-/ gI-And its construction method and application are further described in detail, technical solution of the present invention includes but is not limited to following implements Example.
Embodiment 1
The building process of transferring plasmid pUC-TKLR and pUC-TKLRE
1 method
1.1 virus multiplication cultures
By the good ST cell inoculation of growth conditions bottom area be 25cm2Culture bottle in, addition is appropriate thereto DMEM culture solution containing 10% fetal calf serum, is subsequently placed at 37 DEG C, 5%CO2Under conditions of cultivate.To single layer ST cell It is long to culture bottle area 80% when, cell is cleaned twice with D-Hank ' s liquid, by PRV/HN2012 cell strain and rPRV HN2012-gE-/gI-Cell strain is seeded to different cell bottles, 100 L/ bottles of μ, 37 DEG C of absorption with the DMEM without serum respectively After 1h, the adsorption liquid in culture bottle is discarded, then after being washed twice with D-Hank ' s, the DMEM that 3mL contains 2% serum is added in bottle As cell maintenance medium, condition of setting is 37 DEG C, 5%CO2Incubator in cultivate.When lesion occurs for 80% cell, put Enter freeze thawing 3 times harvests in -80 DEG C of refrigerators and saves.
1.2 transferring plasmid constructing technology route maps are as shown in Figure 1.
The building of 1.3 recombinant plasmid pMD-TKL and pMD-TKR
1.3.1 the design of primers and synthesis of left and right recombination homology arm
With reference to TJ plants of PRV (GenBank accession number: KJ789182) gene orders, two couples of specific primer TKL/F are designed The amplification of left and right recombination homology arm is respectively used to TKL/R, TKR/F and TKR/R (primer information is shown in Table 1), primer is raw by giving birth to work The synthesis of object engineering (Shanghai) limited liability company.Wherein L homology arm includes part UL24 gene and part of TK gene, it is contemplated that amplification Clip size is 967bp；R homologous includes part of TK gene and part UL22 gene, it is contemplated that amplified fragments size is 976bp.
1.3.2 the amplification of left and right recombination homology arm
Referring to saying for Sangon Biotech (Shanghai) Co., Ltd. UNIQ-10 pillar viral genome extraction agent box Bright book extracts PRV/HN2012 pnca gene group, the PCR amplification for transferring plasmid pUC-TKLR or so recombination homology arm. Using two couples of specific primers TKL/F and TKL/R, TKR/F and TKR/R, the sequence of TK gene delection part two sides is expanded respectively Homology arm is recombinated as left and right, building (be shown in Table 1) of the respective restriction enzyme site for subsequent plasmid is carried on homology arm.
The PCR response parameter of amplification is as follows: 95 DEG C of 5min；95℃50s；56℃45s；72 DEG C of 90s carry out 35 altogether and follow Ring；72 DEG C extend 10min eventually；4℃10min.After reaction, take 6 μ L PCR products with 1% Ago-Gel (containing 0.5mg/L EB the result of electrophoresis detection PCR) is carried out.
1.3.3 the recycling and connection of left and right recombination homology arm
The left and right recombination homology arm expanded in 1.3.2 step is recycled using DNA gel QIAquick Gel Extraction Kit, and to returning The target fragment of receipts carries out the measurement of concentration and purity.
The specific fragment being recovered to is connect with pMD18-T carrier, respectively constitutes pMD-TKL and pMD-TKR recombination matter Grain.The sample-adding process of connection need to be completed under condition of ice bath, and connection product is placed on 16 DEG C of law temperature joining slots after the completion of sample-adding In overnight, required linked system is as follows: 5 μ L, SolutionI4 μ L, pMD18-T Vector of DNA target fragment, 1 μ L, altogether 10 μ L systems.
1.3.4 left and right recombinates the conversion of homology arm and chooses spot
It takes 5 μ L connection products to be added in 50 μ L DH5 α competent cells respectively, recombinates matter for pMD-TKL and pMD-TKR The conversion of grain.Random picking is grown on LB containing ampicillin respectively+Several white colonies on solid culture plate, respectively connect Kind is in LB+In fluid nutrient medium, shaken overnight under the conditions of 37 DEG C, while locus coeruleus is set as negative control.
1.3.5 plasmid extraction, digestion identification and sequencing
1.3.4 step products are taken to carry out bacterium solution PCR identification, the same 1.3.2 of program.The bacterium solution of PCR test positive is used Small amount plasmid extraction kit extracts recombinant plasmid pMD-TKL and pMD-TKR.
The recombinant plasmid pMD-TKL and pMD-TKR of acquisition is subjected to digestion identification by double digestion, system used is as follows: 1 μ L 10 × Q.Cut G.Buffer, 1 μ L Q.Cut Hind III, 1 μ L Q.Cut Pst I, 2 μ L recombinant plasmid pMD-TKL or PMD-TKR adds deionized water to 10 μ L systems.
Sample-adding is completed after digesting 30min under 37 DEG C of water bath conditions of postposition, is carried out electrophoresis and is observed digestion result.By bacterium solution PCR Identify that double positive recombinant plasmids are sent to sequencing portion of Sangon Biotech (Shanghai) Co., Ltd. and carry out sequence survey with digestion It is fixed, it is compared after being sequenced correctly by NCBI Blast, to further determine that the correctness of left and right recombination homology arm clone.
The building and identification of 1.4 transferring plasmid pUC-TKLR
1.4.1 the endonuclease bamhi recycling of left and right recombination homology arm
Recombinant plasmid pMD-TKL and pMD-TKR are used into Q.Cut Hind III and Q.Cut Pst I, Q.Cut EcoR respectively I and Q.Cut Pst I carries out double digestion, and system is according to the digestion system in 1.3.5.Sample-adding is completed under 37 DEG C of water bath conditions of postposition Digest 30min.After endonuclease reaction, carried out using endonuclease bamhi of the DNA gel QIAquick Gel Extraction Kit to left and right recombination homology arm Glue recycling.
1.4.2 pUC19 carrier (III-Pst I of Hind) endonuclease bamhi recycles
5 μ L 10 × Q.Cut G.Buffer, 10 μ L Q.Cut Hind III, 10 μ L will be added in 50 μ L carrier for expression of eukaryon Q.Cut Pst I adds deionized water to 100 μ L systems, 37 DEG C of water bath conditions of postposition under digest 30min.Endonuclease reaction terminates Afterwards, glue recycling is carried out to target fragment using DNA gel QIAquick Gel Extraction Kit.
1.4.3 the connection, conversion and extraction of pUC-TKL plasmid
Left 7 μ L of recombination homology arm segment, the 1 μ L of pUC19 carrier (III-Pst I of Hind) segment for taking digestion to recycle, add 10×ligation buffer 1μL、T41 μ L of DNA ligase collectively forms 10 μ L reaction systems, and sample-adding completes 16 DEG C of postposition Link slot reaction overnight, constructs plasmid pUC-TKL.
Connection product is converted and chooses spot and shakes bacterium, bacterium solution PCR mirror is carried out to bacterium solution with specific primer TKL/F and TKL/R It is fixed, positive plasmid pUC-TKL will be extracted later is used for follow-up test.
1.4.4 plasmid pUC-TKL (I-Pst I of EcoR) endonuclease bamhi recycles
5 μ L 10 × Q.Cut G.Buffer, 10 μ L Q.Cut EcoR I, 10 μ L will be added in 50 μ L pUC-TKL plasmids Q.Cut Pst I adds deionized water to 100 μ L systems, 37 DEG C of water bath conditions of postposition under digest 30min.Endonuclease reaction terminates Afterwards, glue recycling is carried out to target fragment using DNA gel QIAquick Gel Extraction Kit.
1.4.5 the connection, conversion and extraction of transferring plasmid pUC-TKLR
Right 7 μ L of recombination homology arm segment, the 1 μ L of plasmid pUC-TKL (I-Pst I of EcoR) endonuclease bamhi for taking digestion to recycle, then 10 × ligation buffer, 1 μ L, T is added41 μ L of DNA ligase collectively forms 10 μ L reaction systems, and sample-adding completes postposition 16 DEG C of link slot reactions overnight, construct transferring plasmid pUC-TKLR.
Connection product is converted and chooses spot and shakes bacterium, bacterium solution PCR mirror is carried out to bacterium solution with specific primer TKR/F and TKR/R It is fixed.The positive bacterium solution identified is used into OMEGA E.Z.N.A.TMEndo-Free Plasmid Mini KitⅠD6948-01B Kit extracts transferring plasmid pUC-TKLR.The transferring plasmid pUC-TKLR of acquisition is subjected to digestion identification with Hind III, Pst I (digestion system is stored under the conditions of -20 DEG C referring to 1.3.5) for subsequent experimental use afterwards.
The building and identification of 1.5 transferring plasmid pUC-TKLRE
1.5.1 (I-Pst I of Pst) the endonuclease bamhi recycling in pG plasmid containing EGFP gene
PG plasmid is the pseudorabies virus gene delection transferring plasmid containing green fluorescence protein gene that the present invention constructs (result is shown in Fig. 2), wherein (I-Pst I of Pst) partially contain complete EGFP gene expression cassette, specifically include CMV, MCS, EGFP, SV40 PolyA coda gene segment, nearly 2000bp size.
5 μ L 10 × Q.Cut G.Buffer, 10 μ L Q.Cut Pst I will be added in 50 μ LpG plasmids, add deionized water extremely 100 μ L systems, 37 DEG C of water bath conditions of postposition under digest 30min.After endonuclease reaction, DNA gel QIAquick Gel Extraction Kit is used Glue recycling is carried out to the target fragment containing EGFP gene.
1.5.2 transferring plasmid pUC-TKLR (I-Pst I of Pst) endonuclease bamhi recycles
5 μ L 10 × Q.Cut G.Buffer, 10 μ L Q.Cut Pst I will be added in 50 μ L pUC-TKLR plasmids, adds Ionized water to 100 μ L systems, 37 DEG C of water bath conditions of postposition under digest 30min.After endonuclease reaction, returned using DNA gel It receives kit and glue recycling is carried out to target fragment.
1.5.3 the connection, conversion and extraction of transferring plasmid pUC-TKLRE
Fetch 7 μ L of (I-Pst I of Pst) endonuclease bamhi containing EGFP gene, plasmid pUC-TKLR (I-Pst I of Pst) enzyme of receipts It is sliced 1 μ L of section, adds 10 × ligation buffer, 1 μ L, T41 μ L of DNA ligase collectively forms 10 μ L reaction systems, Sample-adding completes 16 DEG C of link slot reactions of postposition overnight, constructs transferring plasmid pUC-TKLRE.
Connection product is converted and chooses spot and shakes bacterium, referring to GenBank No.CVU55762 sequence, designs specific primer (EGFP/F sequence is 5 '-CAGTGCTTCAGCCGCTACCC-3 ' (SEQ ID NO.8) by EGFP/F and EGFP/R；EGFP/R sequence Bacterium solution PCR identification, the purpose item of amplification are carried out to bacterium solution for 5 '-AGTTCACCTTGATGCCGTTC-3 ' (SEQ ID NO.9)) Strip length is 289bp, PCR response parameter are as follows: 95 DEG C of 5min；95℃45s；53℃45s；72 DEG C of 1min carry out 35 circulations altogether； 72 DEG C extend 10min eventually；4℃10min.OMEGA E.Z.N.A. is used laterTMEndo-Free Plasmid Mini KitⅠ D6948-01B kit extracts positive plasmid pUC-TKLRE and is used for follow-up test, and carries out digestion identification to it with Pst I.
2 results and analysis
The building of 2.1 recombinant plasmid pMD-TKL and pMD-TKR
2.1.1 the PCR amplification result of left and right recombination homology arm
With two couples of the specific primers TKL/F and TKL/R, TKR/F and TKR/R of synthesis respectively to left and right recombination homology arm into As a result row PCR amplification shows segment (the amplification screenshot of homology arm for having amplified a nearly 1000bp size respectively after electrophoresis As shown in Figure 3, wherein M1.DNA Marker DL2000+；1. left recombination homology arm (TKL)；2. right recombination homology arm (TKR)； 3. negative control), meet expected results.
2.1.2 the double digestion result of recombinant plasmid
Digestion is carried out to pMD-TKL plasmid with Hind III and Pst I, occurs 2 bands after electrophoresis, one is insertion Left recombination homology arm band, position is about 1000bp；Other one is pMD-18T carrier band, and position is about 2.7kb；With EcoR I Digestion is carried out to pMD-TKR plasmid with Pst I, occurs 2 bands after electrophoresis, 1 is the right recombination homology arm band being inserted into, Position is about 1000bp, and in addition 1 is pMD-18T carrier band, and position is about 2.7kb (recombinant plasmid pMD-TKL, pMD-TKR Digestion qualification figure is as shown in Figure 4, wherein M1.DNA Marker DL5000；III/Pst of Hind, I digestion of 1.pMD-TKL； I/Pst of EcoR, I digestion of 2.pMD-TKR).
2.1.3 the sequencing of left and right recombination homology arm
Bacterium solution PCR and the double positive recombinant plasmids of digestion identification are sent to Sangon Biotech (Shanghai) Co., Ltd. Sequencing portion carries out sequencing, be sequenced it is correct after is compared by NCBI Blast, left and right recombination homology arm and PRVTJ plants The homology of corresponding gene section may be up to 99.9%.
The digestion of 2.2 transferring plasmid pUC-TKLR is identified
The transferring plasmid pUC-TKLR of acquisition is subjected to digestion identification with Hind III, Pst I, electrophoresis result, which is shown, has occurred 2 Band, one is the left recombination homology arm being inserted into, and position is about 1000bp；Other one carries for right recombination homology arm and pUC-19 Body passes through the segment that I site EcoR is connected, and position is about 3700bp；As a result be consistent (the digestion qualification figure of transferring plasmid with expection As shown in Figure 5, wherein M1.DNA Marker DL5000；III/Pst of Hind, I digestion of 1.pUC-TKLR；2.pUC-TKLRE's I digestion of Pst).
The building and identification of 2.3 transferring plasmid pUC-TKLRE
2.3.1 the digestion result of plasmid pG
PG plasmid is subjected to digestion identification with Pst I, electrophoresis result shows 2 bands occurred, and one is containing EGFP gene (I-Pst I of Pst) segment, position is about 1700bp；Other one is carrier segments, and position is about 5400bp；As a result with expected phase (the digestion qualification figure of pG plasmid is as shown in Figure 6, wherein M1.DNA Marker DL5000 for symbol；I digestion of Pst of 1.pG).
2.3.2 bacterium solution PCR testing result
Bacterium solution is carried out to the bacterium solution containing recombinant plasmid pUC-TKLRE with the specific primer EGFP/F and EGFP/R of synthesis PCR identification, positive bacterium solution can show the segment (bacterium solution for amplifying a treaty 300bp size after PCR amplification through electrophoresis race glue PCR qualification figure is as shown in Figure 7, wherein M1.DNA Marker DL2000+；1-5.EGFP genetic fragment；6. negative control), symbol Close expected results.
2.3.3 the digestion identification of transferring plasmid pUC-TKLRE
The transferring plasmid pUC-TKLRE of acquisition is subjected to digestion identification with Pst I, electrophoresis result, which is shown, has there are 2 bands, One is (I-Pst I of the Pst) endonuclease bamhi containing EGFP gene being inserted into, and position is about 1700bp；Other one is left and right heavy Group homology arm with pUC-19 carrier passes through Hind III respectively, the segment that I site BamH is connected, and position is about 5200bp；As a result with It is expected that being consistent (such as Fig. 5).
The present invention is with rPRV HN2012-gE-/gI-Strain is devised as parent plant using EGFP gene as screening-gene Transferring plasmid pUC-TKLR and pUC-TKLRE is to realize the missing of TK gene.Wherein L homology arm includes part UL24 gene and portion Divide TK gene, it is contemplated that amplified fragments size is 967bp；R homologous includes part of TK gene and part UL22 gene, it is contemplated that amplification piece Duan great little is 976bp；The homology arm of appropriate length is the basis for guaranteeing homologous recombination and going on smoothly, and transferring plasmid or so recombination is same Source arm length can satisfy needs completely.
Embodiment 2
Recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI-Rescue and purifying
1 rPRV HN2012-TK-/gE-/gI-The construction method of three gene-deleted strains
1.1 intermediary virus rPRV HN2012-gE-/gI-/TK--EGFP+Building
1.1.1 the preparation of cell is transfected
The ST cell that the form that pancreatin has been digested is good, growth vigor is strong is cultivated with the DMEM containing 10% fetal calf serum Liquid piping and druming is dispersed into individual cells, and is inoculated in 6 porocyte culture plates, every hole 2mL cell mixture.The 6 orifice plates are sealed It is placed on 37 DEG C, 5%CO2It is incubated overnight in cell incubator.
1.1.2 transfection
It is inhaled when cell fusion 70% and abandons original culture medium, cleaned cell twice with D-Hank ' s liquid, be changed to without tire The DMEM culture solution of cow's serum, by rPRV HN2012-gE-/gI-The virus liquid of strain is inoculated in tissue culture plate respectively, connects poison Six porocyte culture plates afterwards are placed in 37 DEG C, 5%CO22h in cell incubator makes virus sufficiently be adsorbed onto cell surface.Then Cytopathy venom is discarded, cleans cell twice with the DMEM culture medium of serum-free, antibiotic-free, then be changed to containing 10% tire ox blood Clear DMEM culture solution.Referring to the XfectTM Transfection Reagent reagent of precious bioengineering (Dalian) Co., Ltd Specification transfects the transferring plasmid pUC-TKLRE of extraction in rPRV HN2012-gE-/gI-In the ST cell that strain was infected, matter Grain pUC-TKLRE and rPRV HN2012-gE-/gI-Homologous recombination occurs for genome, obtains recombinant virus rPRV HN2012- gE-/gI-/TK--EGFP+.Six orifice plates are placed into 37 DEG C, 5%CO2After cultivating 4h in cell incubator, removal contains transfection reagent Culture solution, be changed to the fresh DMEM culture solution containing 10% fetal calf serum of 2mL, place incubator and continue to cultivate.After about 48h Can freeze thawing collect transfection liquid, take supernatant to -80 DEG C of preservations after 3000rpm centrifugation 5min.
1.1.3 recombinant virus rPRV HN2012-gE-/gI-/TK--EGFP+It is Plaque-purified
10 times of doubling dilution is carried out to the viral supernatant liquid of harvest with serum-free and DMEM cell culture fluid without double antibody, 10 will diluted-2-10-7The virus liquid of gradient respectively takes 100 μ L to be seeded in six holes that single layer ST cell density reaches 90% respectively In each hole of tissue culture plate.Six orifice plates of virus inoculation are placed in 37 DEG C, 5%CO22h is cultivated in cell incubator.It will 1.3% low melting-point agarose melted is mixed with 2 × DMEM equal proportion containing 4% fetal calf serum；That inhales abandoning absorption end contains disease The culture medium of venom cleans cell twice with D-Hank ' s liquid, the low melting-point agarose that every hole covering 2mL is mixed, complete to its Full solidification is moved back as 37 DEG C, 5%CO2Continue to cultivate in cell incubator.At interval of 12h under fluorescence inverted microscope blue light (wavelength is between 420~490nm) observes and records the green fluorescence plaque production in each hole.It, will after about cultivating 48h Maximum green fluorescence plaque in maximum dilution multiple hole is marked under the conditions of blue light, and sterile working is moved to after the completion of label In platform, with the plaque that liquid-transfering gun picking has marked be placed in containing 200 μ L serum-frees, DMEM cell culture fluid without double antibody it is sterile In Eppendorf pipe and smashed to pieces, room temperature and -80 DEG C of multigelations three times, vortex vibration is carried out to it during each freeze thawing It swings.The mixed liquor inoculation ST cell of harvest is proliferated, and the positive-virus liquid of green fluorescence will can be observed under the conditions of blue light Harvest repeats above method and enters next round plaque purification.Purification process is repeated to all viruses observed under the conditions of blue light Green fluorescence (about needing to carry out 5 plaque purifications) can be presented in plaque, then shows to have purified completely, the viral nomenclature that will be obtained For rPRV HN2012-gE-/gI-/TK--EGFP+。
1.1.4 recombinant virus rPRVHN2012-gE-/gI--EGFP+PCR identification
Referring to saying for Sangon Biotech (Shanghai) Co., Ltd. UNIQ-10 pillar viral genome extraction agent box Bright book is to rPRV HN2012-gE-/gI-/TK--EGFP+Genome extracts.For in this test between the homology arm of left and right TK gene delection part, and with reference to a pair of of specific primer of PRVTJ plants of (GenBank accession number: KJ789182) sequence designs (TKQS/F sequence is 5 '-TCGTCGGGGACATCAGC-3 ' (SEQ ID NO.10) by TKQS/F and TKQS/R；TKQS/R sequence is 5 '-GACGGGCACGGCAAACT-3 ' (SEQ ID NO.11)) it is used for recombinant virus rPRV HN2012-gE-/gI-/TK--EGFP+PCR identification, it is contemplated that the purpose band length of amplification is about 2200bp, PCR response parameter are as follows: 95 DEG C of 5min；95℃50s；59 ℃45s；72 DEG C of 150s carry out 35 circulations altogether；72 DEG C extend 10min eventually；4℃10min.
1.2rPRV HN2012-TK-/gE-/gI-The construction method of three gene delection Strain
1.2.1 the preparation of cell is transfected
The ST cell that the form that pancreatin has been digested is good, growth vigor is strong is cultivated with the DMEM containing 10% fetal calf serum Liquid piping and druming is dispersed into individual cells, and is inoculated in 6 porocyte culture plates, every hole 2mL cell mixture.The 6 orifice plates are sealed It is placed on 37 DEG C, 5%CO2It is incubated overnight in cell incubator.
1.2.2 transfection
It is inhaled when cell fusion 70% and abandons original culture medium, cleaned cell twice with D-Hank ' s liquid, be changed to without tire The DMEM culture solution of cow's serum, by rPRV HN2012-gE-/gI-/TK--EGFP+The poison disease vaccination of strain is in tissue culture plate In, six porocyte culture plates after connecing poison are placed in 37 DEG C, 5%CO22h in cell incubator makes virus sufficiently be adsorbed onto cell table Face.Then discard cytopathy venom, clean cell twice with the DMEM culture medium of serum-free, antibiotic-free, then be changed to containing The DMEM culture solution of 10% fetal calf serum.Referring to the XfectTM Transfection of precious bioengineering (Dalian) Co., Ltd Reagent reagent specification transfects the transferring plasmid pUC-TKLR of extraction in rPRV HN2012-gE-/gI-/TK--EGFP+ In the ST cell that strain was infected, the transferring plasmid pUC-TKLRE of extraction is transfected in rPRV HN2012-gE-/gI-/TK--EGFP+In the ST cell that strain was infected, plasmid pUC-TKLR and rPRV HN2012-gE-/gI-/TK--EGFP+Genome occurs homologous heavy Group obtains recombinant virus rPRV HN2012-TK-/gE-/gI-.It will be cultivated in 37 DEG C of six orifice plates placement, 5%CO2 cell incubator After 4h, the culture solution containing transfection reagent is removed, the fresh DMEM culture solution containing 10% fetal calf serum of 2mL is changed to, placed Incubator continues to cultivate.After about 48h can freeze thawing collect transfection liquid, take supernatant to -80 DEG C of preservations after 3000rpm centrifugation 5min.
1.2.3 recombinant virus rPRV HN2012-TK-/gE-/gI-It is Plaque-purified
The step of according to 1.1.3, is diluted paving glue to the transfection liquid of acquisition to complete rPRV HN2012-TK-/gE-/ gI-Purifying.Each plaque purification pays attention to observing virus plaques form, selects being inverted in maximum dilution multiple hole in fluorescence and show It can't see the plaque of green fluorescence under the conditions of micro mirror blue light.Purification process is repeated to all viruses observed under the conditions of blue light Green fluorescence (about needing to carry out 5 plaque purifications) is not presented in plaque, then shows to have purified completely, the viral nomenclature that will be obtained For rPRV HN2012-TK-/gE-/gI-.
1.2.4 recombinant virus rPRV HN2012-TK-/gE-/gI-PCR identification
Referring to saying for Sangon Biotech (Shanghai) Co., Ltd. UNIQ-10 pillar viral genome extraction agent box Bright book is to recombinant virus rPRV HN2012-TK-/gE-/gI-Genome extracts.Drawn using the specificity designed in 1.1.4 Object TKQS/F and TKQS/R, to recombinant virus rPRV HN2012-TK-/gE-/gI-Carry out the identification of lack part, PCR reaction ginseng Number is referring to 1.1.4.The purpose band gone out to PCR amplification is recycled, is connected, converted and is chosen spot, later by positive bacterium solution It send to sequencing portion of Sangon Biotech (Shanghai) Co., Ltd. and is sequenced, to further determine whether successfully to rPRV HN2012-gE-/gI-Strain has carried out the further missing of TK gene.Later with reference to PRV TJ plants (GenBank accession number: KJ789182 (gB/F sequence is 5 '-TTGCAGTCTTCAGGTCGGTCTT-3 ' (SEQ ID to a pair of of the gB full genome primer) designed NO.12)；GB/R sequence is 5 '-TATTATCTGCGGGGAGGGGGCT-3 ' (SEQ ID NO.13)) to rPRV HN2012- TK-/gE-/gI-Carry out the detection of gB gene.
1.2.5 recombinant virus rPRV HN2012-TK-/gE-/gI-Growth characteristics
By deleted virus rPRV HN2012-TK-/gE-/gI-With rPRV HN2012-gE-/gI-, attenuated vaccine Bartha- K61 plants and parental virus PRV HN2012 plants respectively with 10 μ L (106.0TCID50/ 0.1mL) single layer in orifice plate of dose inoculation 24 ST cell, 37 DEG C, 5%CO2Under the conditions of adsorb 2h after discard virus liquid, be replaced with the DMEM maintaining liquid containing 2% fetal calf serum It is cultivated.Start to collect cell and its supernatant culture solution every 2h after virus inoculation 4h, and freezes repeatedly under the conditions of -80 DEG C TCID is carried out after melting 3 times50The measurement of value, the one step growth curve of virus is drawn out according to result, and is analyzed.
2 results and analysis
2.1 rPRV HN2012-gE-/gI-/TK--EGFP+The building of three gene-deleted strains
2.1.1 rPRV HN2012-gE-/gI-/TK--EGFP+Rescue result
rPRV HN2012-gE-/gI-Dual-gene lack viral genes group and transferring plasmid pUC-TKLRE carry out cotransfection It harvests transfection liquid after 48h, is serially diluted carry out plaque screening through 10 times after the freeze thawing transfection product.When purifying for the first time in every hole The plaque for expressing green fluorescence and the plaque for not expressing green fluorescence can be observed, and the plaque for not expressing green fluorescence is more than Express the plaque of green fluorescence.Maximum green fluorescence plaque (different illumination when purifying in picking maximum dilution multiple hole every time Under the plaque photo observed it is as shown in Figure 8, wherein Fig. 8 A: rPRV HN2012-gE under ordinary light-/gI-/TK--EGFP+It is formed Plaque；Fig. 8 B is rPRV HN2012-gE under blue light-/gI-/TK--EGFP+The plaque of formation), with the increase of purifying number Green fluorescence plaque gradually increases, until the plaque observed when the 5th purifying can express green fluorescence, i.e., successfully saves And it purifies and obtains the three gene-deleted strain rPRV HN2012-gE that can express green fluorescence-/gI-/TK--EGFP+。
2.1.2 recombinant virus rPRV HN2012-gE-/gI-/TK--EGFP+PCR qualification result
Extract rPRV HN2012-gE-/gI-/TK--EGFP+With rPRV HN2012-gE-/gI-Genome passes through specificity The lack part that primer TKQS/F and TKQS/R is shown in its left and right homology arm identifies, as the result is shown rPRV HN2012-gE-/ gI-/TK--EGFP+Genome amplification has gone out the segment of a treaty 2200bp size, does not lack the rPRV HN2012- of TK gene gE-/gI-Genome amplification gone out a treaty 725bp size segment (TK lack part PCR qualification result as shown in figure 9, its In, M1.DNA Marker DL5000；1.rPRV HN2012-gE-/gI-Missing qualification result；2.rPRV HN2012-gE-/ gI-/TK--EGFP+Missing qualification result), be consistent with expected results.
2.2rPRV HN2012-TK-/gE-/gI-The building of three gene-deleted strains
2.2.1 rPRV HN2012-TK-/gE-/gI-Rescue result
rPRV HN2012-gE-/gI-/TK--EGFP+Genome is received after carrying out cotransfection 48h with transferring plasmid pUC-TKLR Transfection liquid is obtained, plaque screening is carried out to 10 times of diluted transfection products.Observed in screening process can produce cytopathy but (the plaque photo observed under different illumination is as shown in Figure 10, wherein Figure 10 A: under ordinary light for the plaque of expression green fluorescence rPRV HN2012-TK-/gE-/gI-The plaque of formation；Figure 10 B: rPRV HN2012-TK under blue light-/gE-/gI-The erosion of formation Spot), it can be initially believed that it is the recombinant virus rPRV HN2012-TK for removing EGFP gene-/gE-/gI-.It selects every time maximum dilute The plaque that can't see green fluorescence under the conditions of fluorescence inverted microscope blue light in multiple hole is released, with the increase of purifying number Green fluorescence plaque is not expressed to gradually increase, until the plaque observed when the 5th purifying does not express green fluorescence, Function is saved and purifies the three gene-deleted strain rPRV HN2012-TK for obtaining removal EGFP gene-/gE-/gI-。
2.2.2 recombinant virus rPRV HN2012-TK-/gE-/gI-PCR qualification result
Extract rPRV HN2012-TK-/gE-/gI-Genome, by specific primer TKQS/F and TKQS/R to its left and right Lack part between homology arm identified, as the result is shown rPRV HN2012-gE-/gI-/TK-/EGFP+Strain has amplified one The segment of about 2200bp size, and rPRV HN2012-TK-/gE-/gI-Strain has amplified the segment (TK of a treaty 420bp size Lack part PCR qualification result is as shown in figure 11, wherein M1.DNA Marker DL5000+；1.rPRV HN2012-gE-/ gI-/TK-/EGFP+Missing qualification result；2.rPRV HN2012-TK-/gE-/gI-Missing qualification result), with expected results It is consistent.
Sequencing result shows, rPRV HN2012-TK-/gE-/gI-Three gene-deleted strains have successfully lacked the TK base of 311bp I site Pst is left because of segment, and in deleted areas, meets expected results.
2.2.3 recombinant virus rPRV HN2012-TK-/gE-/gI-GB identified for genes result
Pass through gB full genome primer pair recombinant virus rPRV HN2012-TK-/gE-/gI-GB gene identified, as a result Display has amplified segment (the recombinant virus rPRV HN2012-TK of about 3000bp size-/gE-/gI-The qualification result of gB gene As shown in figure 12, wherein M1.DNA Marker DL5000；1-2.rPRV HN2012-TK-/gE-/gI-GB identified for genes knot Fruit；3. negative control), it is consistent with expected results.
2.2.4 recombinant virus rPRV HN2012-TK-/gE-/gI-Growth characteristics result
The one step growth curve figure of deleted virus and parent's strain is as shown in figure 13, according to Figure 13 institute at measurement result drafting The one step growth curve shown, it will thus be seen that three gene delection strain rPRV HN2012-TK-/gE-/gI-, dual-gene deleted strain rPRV HN2012-gE-/gI-And Bartha-K61 plants of attenuated vaccine have and move with PRV/HN2012 plant of parental virus of growth Mechanics is closely similar.After infection cell during 10~14h, the growth rate that PRV/HN2012 plants of parental virus is exceedingly fast, and three Gene delection strain rPRV HN2012-TK-/gE-/gI-, dual-gene deleted strain rPRV HN2012-gE-/gI-And attenuated vaccine Bartha-K61 plants of value-added speed and virus titer is below parent plant.In addition, three gene delection strain rPRV HN2012- TK-/gE-/gI-, dual-gene deleted strain rPRV HN2012-gE-/gI-And Bartha-K61 plants of inoculation ST of attenuated vaccine are thin The plaque formed after born of the same parents does not have notable difference in parental virus PRV/HN2012 strain in form and size.
3 conclusions and discussion
By transferring plasmid pUC-TKLRE and pUC-TKLR respectively with the homologous recombination twice of PRV genome, table is first obtained Up to the rPRV HN2012-gE of green fluorescent protein-/gI-/TK--EGFP+Three gene-deleted strains, then obtained by reversely screening RPRV HN2012-TK without external source EGFP gene-/gE-/gI-Three gene-deleted strains.It identifies and is sequenced further combined with PCR, The rPRV HN2012-TK that we obtain-/gE-/gI-Three gene-deleted strains have successfully lacked 311bp segment, and in deleted areas Leave I site Pst.
The present invention is transfected twice, passes through transferring plasmid pUC-TKLR and rPRV HN2012-gE-/gI-/TK--EGFP+ The homologous recombination of genome is free of the plaque of fluorescin through reversed screening technique picking, and combines PCR identification technology, success Obtain the rPRV HN2012-TK without external source EGFP gene-/gE-/gI-Three gene-deleted strains lack to substantially increase this Lose the stability and biological safety of virus.
The building of good cell state, suitable transfection reagent and transferring plasmid will all directly influence when being transfected The height of viral recombination efficiency.
Embodiment 3
Three gene delection virus immunity effect are tentatively probed into
1 method
1.1 mouse immune
6 week old SPF female mices of 30 healthy growths are randomly divided into 3 groups, every group 10, test is specifically grouped and connects Kind situation is shown in Table 2, and route of inoculation is the injection of dorsal sc branch.Choose 20 progress before immune for the first time in mouse at random Tail vein blood is immunized after blood sampling by grouping respectively；Head exempts from after two weeks to carry out mouse immune for the second time.One exempts from later often Week carries out tail vein blood to mouse, separates extremely -20 DEG C of serum keeping after blood sampling every time and is used for subsequent experimental, after blood sampling is exempted to one 6th week.Mice clinical response situation is observed and recorded daily after immune.
Table 2 tests mouse grouping and Immunity
1.2 indirect immunosorbent assays (ELISA)
The present invention establishes porcine pseudorabies virus indirect ELISA detection method referring to the research that folding small is just arranged, to weekly Isolated mice serum carries out the detection of PRV antibody level, and the specific method is as follows:
(1) it is coated with that (the best package amount of antigen is 0.8 μ g/ with PRV/HN2012 strain antigen of the coating buffer to purifying ML), every hole adds 100 μ L in ELISA Plate, under the conditions of placing it in 4 DEG C overnight (the coating time should be greater than 12h).
(2) liquid in plank is got rid of only after staying overnight, is patted dry on blotting paper, and ELISA Plate is cleaned three with PBST solution It is secondary.
(3) every 270 μ L 1%BSA confining liquid of Kong Zhongjia carries out 2h closing under the conditions of being placed in 37 DEG C.
(4) liquid in plank is got rid of only after closing, is patted dry on blotting paper, and cleaned ELISA Plate with PBST solution Once.
(5) by negative serum, positive serum and every group of serum to be checked PBS solution mixed in equal amounts, each dilution 2 holes are repeated, every hole adds 100 μ L, and each sample repeats 2 holes, and every hole adds 100 μ L.
(6) liquid in plank is got rid of only after acting on, is patted dry on blotting paper, and cleaned ELISA Plate with PBST solution Four times.
(7) secondary antibody of sheep anti mouse horseradish peroxidase-labeled is diluted by 1:5000 with PBS, 100 μ L are added in every hole, will 1h under the conditions of ELISA Plate is placed in 37 DEG C.
(8) liquid in plank is got rid of only after being incubated for, is patted dry on blotting paper, and cleaned ELISA Plate with PBST solution Four times.
(9) it is every it is empty 100 μ LTMB are added, be protected from light colour developing 10min under the conditions of 37 DEG C.
(10) after being protected from light colour developing, 50 μ L terminate liquids are added to terminate reaction in every hole.
(11) it in the 3min of reaction terminating, sets measurement at microplate reader 450nm wavelength and records post analysis knot every empty OD value Fruit.
(12) criterion: the ELISA method yin and yang attribute critical value that this test is established is 0.382, i.e. sample OD450> 0.382 is judged to the positive, OD450< 0.382 is judged to feminine gender.
1.3 serum neutralization tests detect PRV antibody level
The mice serum acquired weekly is surveyed with virus neutralization tests (end-point method) fixed virus-diluted blood heat-clearing method (β method) Determine neutralize antibody titers, concrete operations are as follows:
(1) serum used in test is placed on 56 DEG C of conditions and carries out 30min water-bath inactivation.
(2) serum after inactivation is carried out 2 times with the DMEM culture solution without serum to be serially diluted, each dilution takes 50 μ L is added in 96 orifice bores, and four repetitions are arranged in each dilution.
(3) 50 μ L are contained into 200 TCID50The PRV/HN2012 strain virus liquid of/0.1mL, which adds, to be set in above-mentioned each hole, in this way Virus liquid after 50 μ L serum to be checked are sufficiently mixed in hole, containing 100 TCID50 in every hole.
(4) virus liquid and serum to be checked are sufficiently mixed be placed on 37 DEG C under the conditions of act on 1h；Mixed liquor is inoculated into after 1h It is covered in 96 orifice plates of single layer ST cell.
(5) after acting on 1h, mixed liquor in plate is removed, every hole is added DMEM cell culture of the 200 μ L containing 2% fetal calf serum and ties up Liquid is held, 37 DEG C, 5%CO are placed on2It is continuously cultivated in environment four days, observes and records cytopathy situation daily, counted with Karber Calculation method determines result.
(6) following control group should be also set in test:
1. virus control: need to be by 0.2,2,20 and 200TCID50The virus liquid of/0.1mL concentration and the minimum dilution of equivalent Serum to be checked be sufficiently mixed (after mixing each inoculation hole virus concentration be 0.1,1,10 and 100TCID50), sense moves to paving after making In 96 orifice plates for having single layer ST cell；When determining result, 0.1TCID50Cytopathy should not occur in viral fluid apertures, 100TCID50It should be bound to that cytopathy occurs.
2. serum toxicity control: pair of the minimum dilution of tested serum is only added in one group of setting in tissue culture cells It is free of toxic effects to histocyte for detecting serum according to group.
3. host compares: one group should be arranged in each reaction plate and contain only histiocytic blank control group, histocyte exists Health status should be remained in entire test.
4. positive and negative serum control: due neutralize antibody titers need to be presented in positive serum, and negative serum is without in And antibody titer.
Under conditions of above each control group is set up, the judgement of serum neutralize antibody titers to be checked can be just carried out.
The measurement of 1.4 peripheral T lymphocyte subsets of mice
Head exempts from the 6th week afterwards (i.e. two exempt from the 4th week afterwards) at random in 5 mouse of every group of extraction, and every mouse acquires the anti-of 300 μ L Blood coagulation carries out the measurement of T lymphocyte subsets, specific steps are as follows:
(1) AntiCD3 McAb of 1 μ L fluorescent marker is separately added into every part of serum+、CD4+、CD8+Monoclonal antibody is gently filled Divide after mixing, is incubated for 30min at room temperature.
(2) after being incubated for, 2mL hemolysin is added in each blood sample, gently after mixing, in room temperature condition Lower incubation 20min.
(3) 2000rpm is centrifuged 5min after being incubated for, and adds 2mL 2%FBS-PBS later, continues again with 2000rpm It is centrifuged 5min.
(4) 400 μ L PBS buffer solution constant volumes are eventually adding, CD3 is carried out to it using flow cytometer+、CD4+、CD8+T is thin The detection of born of the same parents' quantity.
1.5 protest test
One exempts from the 6th week afterwards (two exempt from the 4th week afterwards) to randomly select 5 mouse from every group, to every mouse with dorsal sc PRV/HN2012 plants of injection system are attacked poison, and attacking toxic dose is every 500 μ L (virus titer 10 of mouse6TCID50/ 0.1mL), continuous raising is observed for 4 weeks later, records and analyzes the immunoprotection situation of mouse, while drawing survivorship curve.
1.6 Cerebral pathologies slice
The mouse and C group for taking each group morbidity dead not dead mouse brain are sliced after paraffin embedding, observation pathology change Change.
2 results and analysis
2.1 safety
Mouse carries out after being immunized, DMEM (A group), Bartha-K61 (B group) and rPRV HN2012-TK-/gE-/gI-(C group) Immune group mouse does not occur ill symptoms, all survives.
2.2 indirect ELISAs detect PRV Antibody Results
The porcine pseudorabies virus indirect ELISA detection method established using the present invention is to each group mouse blood acquired weekly Clear to carry out PRV antibody test, measured data are depicted as line chart using GraphPad Prism 6.0 and calculate P value, small Mouse PPV antibody test result is as shown in figure 14.From figure we have observed that, for the first time be immunized 7d after Bartha-K61 (B group) and rPRV HN2012-TK-/gE-/gI-(C group) effectively stimulation mouse produces the antibody (P < 0.001) of anti-PRV；Later Bartha-K61 immune group (B group) and rPRV HN2012-TK-/gE-/gI-Immune group (C group) antibody level keeps stablizing and rise Height, in entirely test process rPRV HN2012-TK-/gE-/gI-Immune group (C group) antibody level is slightly above Bartha-K61 and exempts from Epidemic disease group (B group), but two groups of antibody level differences are not fairly obvious (P > 0.05).DMEM immune group in test does not stimulate small Mouse generates PRV antibody.
2.3 serum neutralization tests detect PRV Antibody Results
It carries out virus neutralization tests and the detection of PRV neutralizing antibody is carried out to each group mice serum acquired weekly, it is measured Data are depicted as line chart, PRV neutralize antibody titers level (log2) result such as Figure 15 institute using GraphPad Prism 6.0 Show.We have observed that, Bartha-K61 (B group) and rPRV HN2012-TK after 7d is immunized for the first time from figure-/gE-/gI-(C group) Effectively stimulation mouse produces the antibody of anti-PRV, but antibody titer is lower；When head exempts from rear 21d (two exempt from first week afterwards) Bartha-K61 (B group) and rPRV HN2012-TK-/gE-/gI-The antibody level of (C group) is all significantly improved, and continues Increase.Test result illustrates Bartha-K61 (B group) and rPRV HN2012-TK-/gE-/gI-(C group) is produced in stimulation mouse body The raw horizontal aspect of PRV neutralizing antibody has obvious effect, and DMEM immune group does not stimulate mouse to generate PRV neutralizing antibody.
The measurement of 2.4 peripheral T lymphocyte subsets of mice
The distribution situation of peripheral T lymphocyte subsets of mice is detected by Flow Cytometry, measured data make Histogram is depicted as with GraphPad Prism 6.0 and calculates P value, CD3 in mouse peripheral blood+、CD4+、CD8+T lymphocyte The measurement result of quantity is shown in Figure 16 (*: P < 0.05, * *: P < 0.01, * * *: P < 0.001).From figure we can observe that with DMEM immune control group (A group) is compared, Bartha-K61 (B group) and rPRV HN2012-TK-/gE-/gI-(C group) is immune The periphery blood T lymphocyte subclass CD3 of test group mouse+、CD4+And CD8+Quantity it is more, and rPRV HN2012-TK-/gE-/ gI-The T lymphocyte subclass CD3 of (C group) immune group+、CD4+And CD8+Quantity it is most.
2.5 protest test
DMEM immune group (A group) has two mouse to start occur itching scratching etc. at first after attacking PRV/HN2012 plants of 48h Typical PR disease symptom, subsequent other three mouse of the group start to fall ill successively, and it is small to attack DMEM immune group in malicious 72h (A group) Mouse is whole dead, and the time that mouse undergoes from morbidity to death is short, it is rapid to fall ill.Bartha-K61 immune group (B group) is being attacked There is a mouse to start occur itching the typical PR disease symptom such as scratching after PRV/HN2012 plants of 48h, attacks after malicious 60h, 72h again Respectively there is a mouse to start to fall ill, three morbidity mouse undergos death after the course of disease of 2~3d；Other two mouse were at 4 weeks It grows up healthy and sound in observation period, protective rate 40%.rPRV HN2012-TK-/gE-/gI-Immune group (C group) is attacking PRV There is a mouse to start occur itching the typical PR disease symptom such as scratching at first after HN2012 plants of 48h, occurs again after attacking malicious 72h One mouse starts to fall ill, and two morbidity mouse are also dead after the course of disease for undergoing 2~3d；The group 3 mouse of survival, protection Rate is 60%.According to the death condition of every group of mouse, the survivorship curve figure of mouse as shown in figure 17 is depicted.
The wound status result of dead mouse is as shown in figure 18.DMEM immune group (A group) morbidity dead mouse is rapid, skin Only a small amount of breakage (see Figure 18 A)；And Bartha-K61 immune group (B group) and rPRV HN2012-TK-/gE-/gI-Immune group Morbidity mouse in (C group) is dead because just occurring after the course of disease of 2~3d of experience, so mouse itches, to scratch dermatorrhagia very tight Weight produces large stretch of damage (see Figure 18 B).
2.6 Cerebral pathologies slice
It observes pathological section to show, visible small colloid around the brain tissue medium vessels of DMEM immune group (A group) death mouse Cell aggregation (Figure 19), inflammatory reaction is obvious, and the Cerebral pathology slice result of mouse is as shown in figure 20, while in cranial nerve cell It can be seen that eosinophilic inclusion (Figure 20 a) in a large amount of cores；Bartha-K61 immune group (B group) and rPRV HN2012-TK-/gE-/gI- Eosinophilic inclusion (Figure 20 b and Figure 20 c) in visible a small amount of core in the cranial nerve cell of immune group (C group) death mouse, and C group Eosinophilic inclusion (Figure 20 d) in core is had no in the cranial nerve cell of survival mice.
3 conclusions and discussion
We are on mouse model to the rPRV HN2012-TK of acquisition in embodiment 3-/gE-/gI-Deleted virus carries out The preliminary assessment of safety and immune efficacy.rPRV HN2012-TK-/gE-/gI-Immune group mouse is during the test without going out What incumbent adverse reaction, virus weakening situation are ideal.Result of indirect ELISA shows rPRV HN2012-TK-/gE-/gI-Immune group The PRV antibody compared with high titre is produced in immunologic process, neutralizing antibody level also demonstrates that the deleted virus maintains well Immunogenicity, furthermore the measurement result of peripheral T lymphocyte subsets of mice also indicates that the deleted virus effectively and stimulates and is small Mouse body generates cellular immunity.The Cerebral pathology slice of mouse also illustrates that low virulent strain also counteracts velogen strain to a certain extent Invasion to nerve fiber have played certain protective effect.
In short, rPRV HN2012-TK of the invention-/gE-/gI-Three gene delection viruses are safety to non-target animals mouse , PRV specific antibody can effectively and be rapidly generated after immune, and can effectively active cell be immunized, be one plant and be hopeful to answer Vaccine strain for current PRV prevalence prevention and control.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.
Sequence table
<110>Agricultural University Of He'nan
<120>recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI- and its construction method and application
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 967
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
aagcttgcct tatcatcccc gctccccgcc gccgcccggc ccggccccgc gcgcgccgcg 60
atcgcgatca ccgccgcggc ccggcgacgt actcggcgag gccgcgcacg gtcgcggcca 120
tcgcgctcgc gttgccgcgc gtctgggtgc agggcaggcg cgtcacgtcg agcacgcgca 180
tgctccgctg ggccacaaac accagcaggg gcacgagcgt gatctcctcg ccgcccgggg 240
gcacggcggc ggcgaggagg cgcgccgagt cgcgcagctg gcacagcccc tcgtgccgct 300
gcccgcgctt gctgggcgtg ttgaggttcc gggggaagcg gcacgtcttg agctcgatga 360
ggaagcacag gtgcgggccc gcccccagcc gcaccacgca cacgcagtcg gggcggcgca 420
ccccgaggtt gacttcaaag gccagggtca aggacgcctt cttaagcgtc tctcggggaa 480
gcccgaagag actctcgccg tacgcggacg ggtcgcgtcg caggcgttcg tagaagcggt 540
tgtggcagcg gatccccgcc cggaagcgcg ccgggatgcg catcctccgg atctacctcg 600
acggcgccta cggcaccggc aagagcacca cggcccgggt gatggcgctc ggcggggcgc 660
tgtacgtgcc cgagccgatg gcgtactggc gcactctgtt cgacacggac acggtggccg 720
gtatttacga tgcgcagacc cggaagcaga acggcagcct gagcgaggag gacgcggccc 780
tcgtcacggc gcagcaccag gccgccttcg cgacgccgta cctgctgctg cacacgcgcc 840
tggtcccgct cttcgggccc gcggtcgagg gcccgcccga gatgacggtc gtctttgacc 900
gccacccggt ggccgcgacg gtgtgcttcc cgctggcgcg cttcatcgtc ggggacatca 960
gctgcag 967
<210> 2
<211> 976
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
ctgcagtcca ggacaccctc ttcggcgcgt acaaggcgcc cgagctctgc gaccggcgcg 60
ggcgcccgct cgaggtgcac gcgtgggcga tggacgcgct cgtggccaag ctgctgccgc 120
tgcgcgtctc caccgtcgac ctggggccct cgccgcgcgt ctgcgccgcg gccgtggcgg 180
cgcaggcgcg cggcatggag gtgacggagt ccgcgtacgg cgaccacatc cggcagtgcg 240
tgtgcgcctt cacgtcggag atgggggtgt gaccctcgcc cctcccaccc gcgccgcggc 300
cggatggaga ccgcgacgga ggcaacgacg acggcgtggg agggggctcg gggcgcgtat 360
aaagccatgt gtatgtcatc ccaataaagt ttgccgtgcc cgtcaccatg cccgcgtcgt 420
ccgtgcgcct cccgctgcgc ctcctgaccc tcgcgggcct cctggccctc gcgggggccg 480
ccgccctcgc ccgcggcgcg ccgcagggtg ggccgccctc gccgcagggg ggtcccgcgc 540
ccaccgcggc gcccgcgcgc gggcccaccc tgttcgtcct ggacggcgac ggctccgcgt 600
ggttcgtctt ccagctcggc gggctggggg cgctcaacga cacgcgcatc cgcgggcacc 660
tgctcggccg gtacctcgtc tcgtaccagg tggtgccccc gcccgtctcc gcgtggtact 720
ttgtgcagcg cccgcgcgag cgcccgcgcc tctcggggcc gccctcgggc gcggagctcg 780
tggccttcga cgcgcccggc gtctggcgca cgtacaccac ggcggcggtg tggcccgcgg 840
aggtggccgt cctcgcggac gcggaggcgc gctgccccgc ggccgtcttc aacgtgacgc 900
tgggcgaggc cttcctcggc ctgcgcgtcg cgctgcgctc cttcctgccg ctggaggtca 960
tcatctccgc gaattc 976
<210> 3
<211> 1674
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ctgcaggatt ctgtggataa ccgtattacc gccatgcatt agttattaat agtaatcaat 60
tacggggtca ttagttcata gcccatatat ggagttccgc gttacataac ttacggtaaa 120
tggcccgcct ggctgaccgc ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt 180
tcccatagta acgccaatag ggactttcca ttgacgtcaa tgggtggagt atttacggta 240
aactgcccac ttggcagtac atcaagtgta tcatatgcca agtacgcccc ctattgacgt 300
caatgacggt aaatggcccg cctggcatta tgcccagtac atgaccttat gggactttcc 360
tacttggcag tacatctacg tattagtcat cgctattacc atggtgatgc ggttttggca 420
gtacatcaat gggcgcggat agcggtttga ctcacgggga tttccaagtc tccaccccat 480
tgacgtcaat gggagtttgt tttggcacca aaatcaacgg gactttccaa aatgtcgtaa 540
caactccgcc ccattgacgc aaatgggcgg taggcgtgta cggtgggagg tctatataag 600
cagagctggt ttagtgaacc gtcagatccg ctagcgctac cggactcaga tctcgagctc 660
aagcttcgaa ttcgatccac cggtcgccac catggtgagc aagggcgagg agctgttcac 720
cggggtggtg cccatcctgg tcgagctgga cggcgacgta aacggccaca agttcagcgt 780
gtccggcgag ggcgagggcg atgccaccta cggcaagctg accctgaagt tcatctgcac 840
caccggcaag ctgcccgtgc cctggcccac cctcgtgacc accttcacct acggcgtgca 900
gtgcttcagc cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc 960
cgaaggctac gtccaggagc gcaccatctt cttcaaggac gacggcaact acaagacccg 1020
cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc atcgagctga agggcatcga 1080
cttcaaggag gacggcaaca tcctggggca caagctggag tacaactaca acagccacaa 1140
cgtctatatc atggccgaca agcagaagaa cggcatcgag gtgaacttca agatccgcca 1200
caacatcgag gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg 1260
cgacggcccc gtgctgctgc ccgacaacca ctacctgagc acccagtccg ccctgagcaa 1320
agaccccaac gagaagcgcg atcacatggt cctgctggag ttcgtgaccg ccgccgggat 1380
cactctcggc atggacgagc tgtacaagta aagcggccgc gactctagat cataatcagc 1440
cataccacat ttgtagaggt tttacttgct ttaaaaaacc tcccacacct ccccctgaac 1500
ctgaaacata aaatgaatgc aattgttgtt gttaacttgt ttattgcagc ttataatggt 1560
tacaaataaa gcaatagcat cacaaatttc acaaataaag catttttttc actgcattct 1620
agttgtggtt tgtccaaact catcaatgta tcttaaggcg taaattgtct gcag 1674
<210> 4
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
aagcttgcct tatcatcccc gct 23
<210> 5
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ctgcagctga tgtccccgac gat 23
<210> 6
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ctgcagtcca ggacaccctc ttc 23
<210> 7
<211> 23
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gaattcgcgg agatgatgac ctc 23
<210> 8
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
cagtgcttca gccgctaccc 20
<210> 9
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
agttcacctt gatgccgttc 20
<210> 10
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 10
tcgtcgggga catcagc 17
<210> 11
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 11
gacgggcacg gcaaact 17
<210> 12
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 12
ttgcagtctt caggtcggtc tt 22
<210> 13
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 13
tattatctgc ggggaggggg ct 22

Claims (9)

1. recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI-, which is characterized in that deposit number CCTCCNO: V201748。
2. viral construction method described in claim 1, comprising the following steps:
1) the TK gene two sides sequence gram of herpetoviridae herpesvirus suis I type porcine pseudorabies virus PRV/HN2012 is expanded respectively It is grand to obtain the first transferring plasmid pUC-TKLR to pUC-19 carrier, then EGFP gene expression cassette is cloned into transferring plasmid pUC- On TKLR, the second transferring plasmid pUC-TKLRE is obtained；The position of the EGFP gene expression cassette clone is in TK gene two sides sequence Centre；
2) by recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-It is inoculated in cell, after adsorbing 1~2h, obtains through recombinating Porcine pseudorabies virus rPRV HN2012-gE-/gI-The cell of infection, the second transferring plasmid pUC-TKLRE that step 1) is obtained It transfects in through recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-In the cell of infection, expressed by Plaque-purified acquisition glimmering The intermediary virus rPRVHN2012-gE of photoprotein-/gI-/TK--EGFP+；
3) the intermediary virus rPRV HN2012-gE for obtaining step 2)-/gI-/TK--EGFP+It is inoculated in cell, adsorbs 1~2h Afterwards, it obtains through intermediary virus rPRV HN2012-gE-/gI-/TK--EGFP+The cell of infection, that the step 1) is obtained One transferring plasmid pUC-TKLR is transfected in through intermediary virus rPRVHN2012-gE-/gI-/TK--EGFP+In the cell of infection, lead to Plaque-purified removal EGFP gene expression cassette is crossed, recombinant porcine pseudorabies poison rPRV HN2012-TK is obtained-/gE-/gI-；
The deposit number of the herpetoviridae herpesvirus suis I type porcine pseudorabies virus PRV/HN2012 is CCTCCNO: V201314；
The recombinant porcine pseudorabies poison rPRV HN2012-gE-/gI-Deposit number be CCTCC NO:V201749.
3. construction method according to claim 2, which is characterized in that the nucleotide of step 1) TK gene two sides sequence Length independently is 750~1500bp.
4. construction method according to claim 2, which is characterized in that the nucleotide of step 1) the EGFP gene expression cassette Sequence is successively arranged by following genetic fragment and is formed: CMV, MCS, EGFP and SV40PolyA tail.
5. construction method according to claim 2, which is characterized in that step 2) and step 3) inoculation cell include ST thin Born of the same parents.
6. construction method according to claim 5, which is characterized in that the ST cell waits cultivating to cell fusion 70% When, for being inoculated with.
7. construction method according to claim 2, which is characterized in that step 2) the Plaque-purified number is 4~7 It is secondary, show that purifying is complete when observing all virus plaques under the conditions of blue light in green fluorescence.
8. construction method according to claim 2, which is characterized in that step 3) the Plaque-purified number is 4~7 It is secondary, it is observed under the conditions of blue light and shows that purifying is complete when green fluorescence is not presented in all virus plaques.
9. recombinant porcine pseudorabies poison rPRV HN2012-TK described in claim 1-/gE-/gI-Or any one of claim 2~8 The recombinant porcine pseudorabies poison rPRV HN2012-TK that the preparation method is prepared-/gE-/gI-Preparing porcine pseudorabies Application in viral vaccine.
CN201810948406.0A 2018-08-20 2018-08-20 Recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI- and its construction method and application Pending CN109055322A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810948406.0A CN109055322A (en) 2018-08-20 2018-08-20 Recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI- and its construction method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810948406.0A CN109055322A (en) 2018-08-20 2018-08-20 Recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI- and its construction method and application

Publications (1)

Publication Number Publication Date
CN109055322A true CN109055322A (en) 2018-12-21

Family

ID=64687442

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810948406.0A Pending CN109055322A (en) 2018-08-20 2018-08-20 Recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI- and its construction method and application

Country Status (1)

Country Link
CN (1) CN109055322A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109628416A (en) * 2018-12-26 2019-04-16 河南农业大学 A kind of expression porcine circovirus 2 type ORF2 genetic recombination porcine pseudorabies virus strain and its construction method
CN110257345A (en) * 2019-07-18 2019-09-20 河南农业大学 A kind of dual-gene deletion mutation mutated viruses strain of porcine pseudorabies and its construction method
CN110724674A (en) * 2019-10-30 2020-01-24 重庆市畜牧科学院 Recombinant goat pox virus without screening marker for expressing orf virus F1L protein and construction method thereof
CN111748529A (en) * 2020-06-19 2020-10-09 国药集团动物保健股份有限公司 Porcine pseudorabies virus strain and application thereof
CN116064425A (en) * 2022-12-14 2023-05-05 中国农业科学院都市农业研究所 TK gene deleted recombinant porcine pseudorabies virus, infectious cloning system, construction method and application thereof

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103756977A (en) * 2013-12-11 2014-04-30 姜平 gE- and gI-deleted porcine pseudorabies virus variant strain and use thereof
CN103981153A (en) * 2014-05-29 2014-08-13 中国兽医药品监察所 Construction of double fluorescence labeled deletion viruses of pseudorabies virus
CN105200015A (en) * 2015-09-09 2015-12-30 河南农业大学 Herpesviridae strain

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103756977A (en) * 2013-12-11 2014-04-30 姜平 gE- and gI-deleted porcine pseudorabies virus variant strain and use thereof
CN103981153A (en) * 2014-05-29 2014-08-13 中国兽医药品监察所 Construction of double fluorescence labeled deletion viruses of pseudorabies virus
CN105200015A (en) * 2015-09-09 2015-12-30 河南农业大学 Herpesviridae strain

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ZHANG等: "Construction ofatriplegene-deletedChinesePseudorabies virusvariantanditsefficacystudyasavaccinecandidateonsucklingpigfets", 《VACCINE》 *
李爽: "猪伪狂犬病病毒变异株gE/gl/TK三基因缺失株的构建及免疫效力初步研究", 《中国优秀硕士学位论文全文数据库》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109628416A (en) * 2018-12-26 2019-04-16 河南农业大学 A kind of expression porcine circovirus 2 type ORF2 genetic recombination porcine pseudorabies virus strain and its construction method
CN110257345A (en) * 2019-07-18 2019-09-20 河南农业大学 A kind of dual-gene deletion mutation mutated viruses strain of porcine pseudorabies and its construction method
CN110257345B (en) * 2019-07-18 2021-07-16 河南农业大学 Porcine pseudorabies double-gene deletion mutation virus strain and construction method thereof
CN110724674A (en) * 2019-10-30 2020-01-24 重庆市畜牧科学院 Recombinant goat pox virus without screening marker for expressing orf virus F1L protein and construction method thereof
CN111748529A (en) * 2020-06-19 2020-10-09 国药集团动物保健股份有限公司 Porcine pseudorabies virus strain and application thereof
CN116064425A (en) * 2022-12-14 2023-05-05 中国农业科学院都市农业研究所 TK gene deleted recombinant porcine pseudorabies virus, infectious cloning system, construction method and application thereof

Similar Documents

Publication Publication Date Title
CN109055322A (en) Recombinant porcine pseudorabies poison rPRV HN2012-TK-/gE-/gI- and its construction method and application
AU623333B2 (en) Attenuated herpesviruses, herpesviruses which include foreign dna encoding an amino acid sequence and vaccine containing same
EP0332677B1 (en) Attenuated herpes viruses, herpes viruses which include foreign dna encoding an amino acid sequence and vaccines containing same
CN107723276A (en) A kind of construction method and kit of the cell line of stable high expression target product
CN109750007A (en) The Pseudorabies virus gE/gI deletion mutation strain and its building and application of double expression gC gene
JPH10506782A (en) Recombinant turkey herpesvirus and uses thereof
CN110257345A (en) A kind of dual-gene deletion mutation mutated viruses strain of porcine pseudorabies and its construction method
CN114805500B (en) Application of African swine fever virus I73R protein as immunosuppressant and construction of immunosuppression site mutant strain
CN109402071B (en) Recombinant turkey herpesvirus expressing H9N2 subtype avian influenza virus H9 protein
CN106536722B (en) Method for rapid preparation of infectious RNA viruses
US11155834B2 (en) Sin Nombre virus full-length M segment-based DNA vaccines
CN102329784A (en) Japanese encephalitis virus like particles as well as preparation method and application thereof
CN104195116A (en) Recombinant Newcastle disease virus for expressing goose parvovirus VP3 genes and construction method thereof
Kost et al. Biological evaluation of glycoproteins mapping to two distinct mRNAs within the BamHI fragment 7 of pseudorabies virus: expression of the coding regions by vaccinia virus
TW200813223A (en) High-yield transgenic mammalian expression system for generating virus-like particles
CN114196639B (en) Recombinant duck plague virus for expressing 3-type duck hepatitis A virus P1 and 3C genes, construction method and application thereof
CN104587490A (en) Therapeutic HBV minicircle DNA vaccine and preparation method thereof
CN106929483B (en) Construction and application of recombinant turkey herpesvirus expressing newcastle disease virus F gene
CN105238764B (en) A kind of Δ Intron plants of the area Pseudorabies virus LLT and construction method and application
JP2001519781A (en) Bovine respiratory and intestinal coronavirus as a vaccine
EP0794257A1 (en) Attenuated herpesviruses, herpesviruses which include foreign dna encoding an amino aced sequence and vaccine containing same
WO1994000586A2 (en) Infectious bovine rhinotracheitis virus mutants and vaccines
US5068192A (en) Attenuated pseudorabies virus which includes foreign DNA encoding an amino acid sequence
CN114107227B (en) Recombinant turkey herpesvirus live vector vaccine for simultaneously expressing classical strain infectious bursal disease virus VP2 protein and variant strain infectious bursal disease virus VP2 protein
US5763269A (en) Recombinant infectious bovine rhinotrocheitis virus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20181221