CN109053888A - A kind of anti-human CSF-1R monoclonal antibody and application thereof - Google Patents

Abstract

The present invention relates to a kind of anti-human CSF-1R monoclonal antibodies and application thereof, while providing coding nucleic acid molecule, expression vector, host cell and the method for expressing the antibody of the antibody.Additionally provide antibody mediated immunity coupling conjugate, bispecific molecule, embedding and antigen receptor, pharmaceutical composition and purposes including antibody of the present invention.Compared with the existing technology, the invention has the following advantages that the monoclonal antibody of energy specific recognition people CSF-1R of the invention, affinity of the antibody in conjunction with people CSF-1R is better than existing anti-human CSF-1R monoclonal antibody, and sequence is novel, and combines unique epitope.

Description

A kind of anti-human CSF-1R monoclonal antibody and application thereof

Technical field

The present invention relates to a kind of high-affinity and with the monoclonal antibody or antibody piece of functional anti-human CSF1R Section.Invention also provides the coding nucleic acid molecule of the antibody, expression vector, host cells and for expressing the antibody Method.Additionally provide including antibody of the present invention antibody mediated immunity coupling conjugate, bispecific molecule, embedding and antigen receptor, Pharmaceutical composition and diagnostic and therapeutic method.

Background technique

Colony-stimulating factor 1 receptor (CSF-1R) belongs to the receptor tyrosine kinase family of type III, by proto-oncogene c- Fms coding, protein structure include kinase domain intracellular and the extracellular ligand knot by the similar structure composition of 5 immunoglobulins Close area.CS1R is expressed on mononuclear phagocytic cells surface, is played a crucial role to the survival of mononuclear phagocytic cells, proliferation, differentiation (Felix,et al.,(2015)Structure 23,1621-1631).And CSF1R is also high to express in kinds of tumor cells perhaps Surface.For example, CSF1R expression and tumor tissues size and low survival are closely related.KLUGER,et al.(2004)Clinical cancer research.vol.10,no.1,p.173-7；SCHOLL,et al.(1994)Journal of the National Cancer Institute.vol.86, no.2, p.120-6.) is in oophoroma and carcinoma of endometrium, northern Hybridization analysis shows that most tumor tissues co-express CSF1 and CSF1R, and normal endometrial tissue CSF1R expression is very Weak (et al.(1991)Cancer,vol.67,no.4,p.990-6).CSF1R is also expressed in tumor infiltrating Macrophage Surface (CHAMBERS, et al. (1997) .Clinical Cancer Research.vol.3, no.6, p.999- 1007)。

After the extracellular region combination CSF-1 of CSF1R, cause CSF1R Receptor dimerization and its autophosphorylation intracellular, thus Originate intracellular signal transmitting.Abnormal receptor tyrosine kinase III signal transmitting causes a large amount of inflammation diseases and cancer to mention Show that RTK type III intracellular plays central role in congenital and the acquired immune response.For example, abnormal CSF1R signal transmitting Typically occur in a variety of human diseases pathological states of such as rheumatoid arthritis, atherosclerosis and tumour growth. (Chitu and Stanley,(2006),Curr.Opin.Immunol.18,39-48；Masteller and Wong, (2014),Drug Discov.Today,19,1212-1216；Pollard(2009),Nat.Rev.Immunol.9,259- 270；Stanley and Chitu,(2014),Perspect.Biol.6,a021857；Verstraete and Savvides, (2012),Nat.Rev.Cancer.12,753-766).

CSF1R signal is also proved to play physiological action in bone remodeling.The animal of gene knockout CSF1 or CSF1R are usual Show as osteopetrotic phenotype.For a long time, CSF1R inhibitor is as a kind of cancer, diseases associated with inflammation or bone loss disorders Potential therapy is furtherd investigate.Pexidartinib, a kind of inhibitor of CSF1R are clinical in 3 phases for the treatment of giant cell tumor of tendon sheath Powerful curative effect is shown in test.Another CSF1R inhibitor, Cabiralizumab, a kind of target tumor correlation macrophage The monoclonal antibody of cell, the positive early studies in man for carrying out metastatic cancer of pancreas.Another kind is in the drug of clinic II phase JNJ-40346527, a kind of oral CSF1R inhibitor, the mechanism of action are the survival of inhibition macrophage, proliferation and differentiation, but right In the intractable active rheumatoid arthritis of disease repairing type antirheumatic drug (DMARD-refractory active Rheumatoid arthritis) treatment is to no effect.

Although CSF1R antibody has exploitation, disease as above for treatment has more high-affinity and other drugs pass The CSF1R inhibitor of keyness matter, especially monoclonal antibody need to be furtherd investigate exploitation.

Summary of the invention

In order to overcome drawbacks described above, the object of the present invention is to provide a kind of anti-human CSF-1R monoclonal antibody and application thereof, The antibody has high-affinity and functionality, is better than existing anti-human CSF-1R monoclonal antibody.

In order to achieve the above object, the present invention provides a kind of anti-human CSF-1R monoclonal antibody, which is characterized in that the antibody Include: heavy chain and light chain；

The heavy chain and light chain includes variable region, which includes complementary determining region；

Complementary determining region CDR1, CDR2 and CDR3 of the heavy chain are indicated with CDR-H1, CDR-H2 and CDR-H3 respectively；

Complementary determining region CDR1, CDR2 and CDR3 of the light chain are indicated with CDR-L1, CDR-L2 and CDR-L3 respectively；

The amino acid sequence of the CDR-H1 is shown in SEQ ID NO:3；

The amino acid sequence of the CDR-H2 is shown in SEQ ID NO:4；

The amino acid sequence of the CDR-H3 is shown in SEQ ID NO:5；

The amino acid sequence of the CDR-L1 is shown in SEQ ID NO:6；

The amino acid sequence of the CDR-L2 is shown in SEQ ID NO:7；

The amino acid sequence of the CDR-L3 is shown in SEQ ID NO:8.

Heavy chain variable amino acid sequence is shown in SEQ ID NO:1；Chain variable region amino acid sequence is SEQ ID Shown in NO:2.

A kind of nucleic acid molecule, the nucleic acid molecule coding anti-human CSF-1R monoclonal antibody；

The sequence of the nucleic acid molecule is selected from SEQ ID NO:9 and/or SEQ ID NO:10；

The heavy chain variable region of the sequence SEQ ID NO:9 coding antibody；

The light chain variable region of the sequence SEQ ID NO:10 coding antibody.

A kind of expression vector, the expression vector contain the nucleic acid molecule.

A kind of host cell, the host cell contain the expression vector.

A kind of preparation method of anti-human CSF-1R monoclonal antibody, the preparation method comprise the following steps:

Step 1: the expression vector of nucleic acid molecule of the preparation containing the expression anti-human CSF-1R monoclonal antibody；

Step 2: transfecting eukaryotic host cell with the expression vector of step 1；

Step 3: the eukaryotic host cell that incubation step 2 transfects；

Step 4: isolating and purifying, obtain the antibody.

The invention further relates to the antibody mediated immunity coupling conjugates, double special for including anti-human CSF-1R monoclonal antibody above-mentioned Property molecule, embedding and antigen receptor or pharmaceutical composition.

The invention further relates to anti-human CSF-1R monoclonal antibodies to prepare anti-tumor drug, rheumatoid arthritis drug, move Application in pulse atherosclerosis drug or bone remodeling drug.

The heavy chain and light chain all further includes constant region, which is the constant region of human IgG, it is therefore preferable to IgG1's Constant region.

Compared with the existing technology, the invention has the following advantages that the monoclonal of energy specific recognition people CSF-1R of the invention Antibody, affinity of the antibody in conjunction with people CSF-1R are better than existing anti-human CSF-1R monoclonal antibody, and sequence is novel.

Specific embodiment

The following further describes the technical solution of the present invention with reference to embodiments.

One, the acquisition of antibody:

Embodiment 1 obtains the mouse monoclonal antibody of the anti-CSF1R of specificity by fusion hybridoma technology

1.1 animal immune

According to (E Harlow, D.Lane, Antibody:A Laboratory Manual, Cold Spring in document Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1998) mouse is immunized in general method.It is immune Originally be C-terminal contain human IgG1's Fc label recombined human CSF1R (amino acid Ile20-Glu512) albumen (Acro biosystems, Cat#CSR-H5258).Albumen (Acro biosystems, cat#CSR-H5228) using recombined human CSF1R with his label Detection antigen as measurement serum titer and hybridoma screening.Briefly, suitable freund adjuvant is taken out to manage to 1.5ml EP In, oscillator mixes.Antigen protein solution is prepared with PBS.Amount mixes adjuvant and proteantigen solution as required, passes through injection Device mutually pushes away the solution that fully emulsified antigen forms stable Water-In-Oil, then carries out animal injection.According to serum titer measurement result, It usually requires to can be only achieved good immune effect after carrying out 2 to 3 booster immunizations after first immunisation.Select serum titer high Immune mouse row intraperitoneal injection carries out cell fusion after exempting from eventually.

1.2 hybridoma fusions and screening

Before cell fusion, culture murine myeloma cell (SP2/0-Ag14, ATCC#CRL-1581) is in logarithmic growth Phase.It puts to death immune mouse gnotobasis and takes spleen, PEGylated fusion spleen B cell and SP2/0 myeloma are used according to method in document Cell (E Harlow, D.Lane, Antibody:A Laboratory Manual, (Cold Spring Harbor Laboratory Press,Cold Spring Harbor,N.Y.,1998)；Kohler G,and Milstein C," Continuous cultures of fused cell secreting antibody of predefined specificity,"Nature,256:495-497(1975)).Fused 96 porocyte culture plates of plating cells, usual 7 arrive The Growth of Hybridoma Cell that survival can be observed after 10 days under microscope comes out.Plating cells after two weeks, are collected in each hole culture Clearly, hybridoma screening is carried out with ELISA method employment CSF1R-his proteantigen.It is summarized as follows, with the people of 60ul 2ug/ml The PBS solution coated elisa plate of CSF1R-his antigen, 4 C overnights.Then after PBST board-washing 4 times, 200 holes μ l/ are added The PBST solution of 5% skimmed milk power is placed in 37 degrees Celsius and closes 2 hours.The hybridoma supematant in 60 holes μ l/ is added in board-washing again, 37 degrees Celsius are incubated for 40 minutes, then board-washing 4 times.It is small with the goat-anti that diluted horseradish peroxidase-labeled is added in 100 holes μ l/ Mouse secondary antibody (Jackson Immunoresearch, cat#115-036-071), 37 degrees Celsius are incubated for 40 minutes, then board-washing 4 It is secondary, it pats dry.The TMB chromogenic substrate in 100 holes μ l/ is added, color development at room temperature 5 to 15 minutes, is then terminated, is surveyed with the sulfuric acid solution of 1M The light absorption value in fixed each hole of 450 nanometers.Choose ELISA and combine positive hybridoma holes cell, is transferred in 24 orifice plates, continues to train It supports.And the second wheel secondary screening, the hybridoma for filtering out specific recognition and CSF1R/CSF1 capable of being blocked to combine are carried out by ELISA method (it the results are shown in Table 1, wherein 1C6 is the hybridoma that the present invention obtains, and anti-human CSF-1R obtained by the hybridoma expression present invention is mono- Clonal antibody), it is subcloned by limiting dilution assay, obtains desired monoclonal cell strain.Then these Dan Ke of a small amount of Expression products Grand antibody, antibody carry out the Function Appraising analysis of next step.

Table 1 merges hybridoma supematant and detects ELISA data

Two, ira vitro analytical methods:

Embodiment 2 is used to measure the ira vitro analytical methods of CSF1R monoclonal antibody functional activity

2.1 binding abilities based on capture ELSIA measurement antibody

Special secondary antibody (Jackson the Immuno Research, #115- of goat anti-mouse igg Fcr is prepared with 1xPBS 006-071), make its final concentration of 2 μ g/ml, with 100 μ l/ hole liquid feedings in 96 hole elisa Plates, 4 degrees Celsius of coatings are overnight.Next day, After PBS solution (i.e. 1xPBST) board-washing 4 times containing 0.05% polysorbas20,5% skimmed milk power in 200 holes μ l/ is added PBST solution is placed in 37 degree and closes 2 hours.Board-washing again, after the dilution antibody-solutions or hybridoma supematant in 100 holes μ l/ are added, 37 degree are incubated for 40 minutes, then board-washing 4 times.It is molten that the 60nM biotin labeling people's CSF1R Fc albumen prepared is added with 100 holes μ l/ Liquid (in the PBST of 2.5% skimmed milk power), 37 degree are incubated for 40 minutes, then board-washing 4 times.1:10000 is added with 100 holes μ l/ The Streptavidin (Jackson Immuno Research, #016-030-084) of diluted horseradish peroxidase-labeled, 37 Degree is incubated for 40 minutes, and then board-washing 4 times, pat dry.Add the ELISA chromogenic substrate TMB in 100 holes μ l/, 5 to 15 points of color development at room temperature Clock then uses the sulfuric acid solution color development stopping of 1M, measures the light absorption value in each hole of 450 nanometers.

The binding ability of 2.2 flow cytometries assessment antibody combination cell film surface CSF1R antigen

The 293F cell line that the film surface in logarithmic growth phase is overexpressed people CSF1R is collected, after washing cell 2 times with PBS Cell is resuspended with FACS buffer solution (PBS solution containing 2% fetal calf serum).Density is adjusted, is plated on 2x105 cells/well In 96 hole U bottom plates, 300g is centrifuged 5 minutes, and incline supernatant, is added the CSF1R antibody-solutions of gradient dilution and is placed on ice It is incubated for 40 minutes.It washes cell 2 times, adds the sheep anti-Mouse secondary antibody (Jackson of 100 hole μ L/ phycoerythrin fluorescent markers Immunoresearch, Cat#115-116-072,1:1000 dilution), 4 degrees Celsius are protected from light incubation after forty minutes, it washes cell 3 times, Then every hole adds the FACS buffer solution of 100 μ L to be resuspended, and blows upper machine testing after even cell.Use BD company Canto II model streaming Cell instrument measures the fluorescence intensity of every hole cell.Data processing is carried out using Graphpad prism software, show that antibody combines The EC50 concentration value (reaching corresponding antibody concentration value when the antibody maximum fluorescence binding signal 50%) of cell.

2.3 competitive ELISA

2.3.1 ligand receptor, which combines, blocks ELISA

The blocking ability that CSF1R/CSF1 is combined by competitive ELISA method assessment CSF1R antibody.It is summarized as follows, uses 1xPBS prepares the CSF1-his albumen (BSI, cat#BS-TA1601154-96) of people, makes its final concentration of 2 μ g/ml, with 100 μ The hole l/ liquid feeding is in 96 hole elisa Plates, and 4 degree of coatings are overnight.Next day, with PBS solution (i.e. PBST) board-washing of the polysorbas20 containing 0.05% After 4 times, the PBST solution for 5% skimmed milk power that 200 holes μ l/ are added is placed in 37 degree and closes 2 hours.Board-washing 4 times again.

CSF1R antibody or control antibodies gradient dilution in people's CSF1R FC protein solution containing biotin labeling, Rear room temperature is prepared to incubate in advance 40 minutes.Then the solution of the antibody and CSF1R Fc biotin that have been incubated for is added to 100 holes μ l/ It has been coated on the plate of CSF1-his, 37 degree are incubated for board-washing 4 times again after forty minutes.Horseradish peroxide then is added with 100 holes μ l/ The Streptavidin of compound enzyme label, 37 degree of incubation board-washing 4 times after forty minutes pat dry.Add the TMB colour developing and 50 in 100 holes μ l/ The 1M sulfuric acid in the hole μ l/ terminates reaction, measures the absorption value of 450 nanometers.It is carried out at data using Graphpad prism software Reason obtains the IC50 concentration value that antibody blocking CSF1R/CSF1 is combined.

2.3.2 reference antibody blocks ELISA

Pass through competitive ELISA method assessment CSF1R antibody blocking reference antibody/CSF1R antigen binding blocking ability.Letter State it is as follows, with 1xPBS prepare reference antibody (Cabiralizumab), make its final concentration of 1 μ g/ml, with 100 μ l/ hole liquid feedings in 96 hole elisa Plates, 4 degree of coatings are overnight.Next day is added after PBS solution (i.e. PBST) board-washing 4 times containing 0.05% polysorbas20 The PBST solution of 5% skimmed milk power in 200 holes μ l/ is placed in 37 degree and closes 2 hours, board-washing 4 times again.

CSF1R antibody or control antibodies gradient dilution in people's CSF1R FC protein solution containing biotin labeling In (10nM), prepares rear room temperature and incubate in advance 40 minutes.Then the solution for the antibody and CSF1R Fc biotin being incubated for 100 μ The hole l/ is added on the plate for being coated with reference antibody, and 37 degree are incubated for board-washing 4 times again after forty minutes.Then with the addition of 100 holes μ l/ The Streptavidin of horseradish peroxidase-labeled, 37 degree of incubation board-washing 4 times after forty minutes, pats dry.Add TMB colour developing and 1M sulphur Acid terminates reaction, measures the absorption value of 450 nanometers.Data processing is carried out using Graphpad prism software, obtains antibody The IC50 concentration value for blocking reference antibody/CSF1R to combine.

The combination activity of the anti-CSF1R mouse monoclonal antibody of embodiment 3

According to analysis method described in embodiment 2, the combination Activity Summary such as the following table 2 for CSF1R antibody of testing and assessing.Wherein Benchmark (Cabiralizumab) is existing not commercialized anti-human CSF1R monoclonal antibody as control.From table 2 It is found that the combination activity of anti-human CSF-1R monoclonal antibody and people's CSF1R antigen of the invention is substantially better than Benchmark.

The combination activity of 2 CSF1R antibody of table

4 functional blockade of embodiment experiment (analysis method referring to 2.3), it is real to obtain the antibody functional based on ELISA Data are commented in test

The functional evaluating result of the anti-CSF1R mouse monoclonal antibody of table 3

The competitive ELISA experiment of antibody on human CSF1/CSF1R shows that 1C6 antibody of the invention can specific blockage in table 3 CSF1R combines its ligand CSF1, and blocking ability is suitable with Benchmark；Antibody is to benchmark/humanCSF1R simultaneously Competitive ELISA experiment show that 1C6 antibody does not block BM combination people's CSF1R antigen, show 1C6 combine epitope difference It is unique antigen binding epitope in Benchmark antibody.

Embodiment 5DNA clone and sequencing, the variable region protein sequencing of anti-CSF1R mouse monoclonal antibody

Using Trizol reagent (Invitrogen, catalog#15596-018) from the mouse monoclonal cell strain of culture Middle extraction total serum IgE.Process is summarized as follows, the cell of 5x106 is collected by centrifugation into 1.5ml centrifuge tube, blots supernatant.Add 1ml Trizol reagent and blow and beat repeatedly and be placed at room temperature for 5 minutes afterwards for several times for lytic cell.And then, every pipe is added 0.2ml's Chloroformic solution, acutely concussion was placed at room temperature for 3 minutes after 15 seconds.Then, 4 degree of 12000g of centrifuge tube are centrifuged 10 minutes, take out centrifugation Pipe draws upper strata aqueous phase solution into new 1.5ml centrifuge tube, adds the isopropanol of 0.4ml for precipitating from water phase RNA.After mixing EP is managed and placed room temperature 10min manually, 4 degree of 12000g are centrifuged 10 minutes, abandon supernatant.The second of 1ml 75% is added Alcohol, 4 degree of 7500rpm are centrifuged 5min again, abandon supernatant.Tube bottom RNA precipitate after ten minutes, is added 30 and arrives 50ul's in drying at room temperature Sterile DEPC processing water dissolves RNA sample.

And then, selecting the reverse transcription cDNA kit (catalog#6110A) of Taraka becomes CDNA total serum IgE.It is real The system of testing is formulated as follows, and+8.5 μ l RNase-free water (total 14ul) of+0.5 μ l Oligo (dT) of total serum IgE of 5 μ l is first placed in 65 5min initial denaturation is spent, is then put 2 minutes on ice.Further it is added+0.5 μ l's of dNTP mixture of+1 μ l of 5x buffer of 4 μ l + 1 μ l reverse transcriptase (20.5ul system in total) of RNase inhibitor, mixes after preparing, and runs 40 degrees Celsius 50 points using PCR instrument Clock, 70 degree of 10min complete cDNA synthesis.

CDNA is further formulated as follows at 3 ' ends plus Poly G, reaction system: the ddH2O of+33.5 μ l of cDNA sample of 5 μ l Terminal deoxynucleotidyl transferase (the total volume of the dGTP+0.5 μ l of the CoCl2+1 μ l of+5 μ l of 10xTdT buffer of+5 μ l 50ul), it is mixed after preparing, runs 37 degrees Celsius 30 minutes, 70 degree of 10min using PCR instrument, complete Poly G tailing.

Further, the gene magnification of antibody variable region is carried out using the cDNA of tailing as template.It can for amplification heavy chain of antibody Become region sequence, prepares PCR reaction system: the general 0.5 μ l+ mouse of poly C primer (forward primer) of 5 μ l+ of 10xTaq enzyme buffer liquid 0.5 μ l+dNTP of IgG1 reverse primer, 11 μ l+ddH2O of μ l+Taq 1 μ l+cDNA of polymerase, 41 μ l.For expanding antibody light chain Variable region sequences, prepare PCR reaction system: the general 0.5 μ l+ of poly C primer (forward primer) of 5 μ l+ of 10xTaq enzyme buffer liquid is small 0.5 μ l+dNTP of mouse IgG kappa reverse primer, 11 μ l+ddH2O of μ l+Taq polymerase 1ul+cDNA, 41 μ l.Heavy chain of antibody It is following (wherein step 2 to 4 repeats 25 circulations) with the temperature cycles of light chain variable region PCR amplification.

95 DEG C of .5min of 1- initial denaturation；

2- is denaturalized 95 DEG C of .20sec；

56 DEG C of .20sec of 3- annealing；

4- extends 72 DEG C of .30sec；

5- saves 25 DEG C of .60min.

PCR product is analyzed through 1% agarose gel electrophoresis, cut out corresponding size DNA section band (the about 600bp of VH, Vkappa light chain about 500bp), the extracting of DNA is carried out with the gel DNA QIAquick Gel Extraction Kit (catalog#28704) of Qiagen.Letter State as follows: gel weighing adds the QG buffer of 3 times of gel volumes, is then incubated for 10 minutes until gel is completely dissolved for 50 degree.Add After the isopropanol mixing for entering 1 times of colloid product, sample moves to QIA purification column, is centrifuged 13000rpm 1 minute.The PE of 750ul is added Buffer is into column, and then 13000rpm is centrifuged 1 minute.And 13000rpm is centrifuged liquid residual in 1 minute removal column again.Add The water elution column for entering 30ul is centrifuged 1 minute, obtains the DNA sample of preparation, and the PCR product of purifying obtains the variable of antibody through sequencing Region sequence, as shown in table 4, the nucleotide sequence of CSF1R mouse monoclonal antibody are as shown in table 5.

The amino acid sequence and CDR region of 4 CSF1R mouse monoclonal antibody of table

The nucleotide sequence of table 5CSF1R mouse monoclonal antibody

The DNA sequence dna of heavy chain variable region

5’-GAGGTCCAGCTTCAGCAGTCAGGACCTGAGCTGGTGAAACCTGGGGCCTCAGTGAAGATATCCTG CAAGGCTTCTGGATACACATTCACTGACTACAATATGCAATGGGTGAGGCAGAGCCATGGAAAGAGCCTTGAGTGG ATTGGATATATTTATCCTTACAATGGTGATACTGGCTACAACCAGAAGTTCAAGAGCAAGGCCACATTGACTGTAG ACAATTCCTCCAGCACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCACG AGATGGTTACTACGGGAGGTACTTCGATGTCTGGGGCGCAGGGACCACGGTCACCG TCTCCTCA-3 ' (corresponds to SEQ ID No.9)

The DNA sequence dna of heavy chain constant region

5’-GCCAAAACGACACCCCCATCTGTCTATCCACTGGCCCCTGGATCTGCTGCCCAAACTAACTCCAT GGTGACCCTGGGATGCCTGGTCAAGGGCTATTTCCCTGAGCCAGTGACAGTGACCTGGAACTCTGGATCCCTGTCC AGCGGTGTGCACACCTTCCCAGCTGTCCTGCAGTCTGACCTCTACACTCTGAGCAGCTCAGTGACTGTCCCCTCCA GCACCTGGCCCAGCGAGACCGTCACCTGCAACGTTGCCCACCCGGCCAGCAGCACCAAGGTGGACAAGAAAATTGT GCCCAGGGATTGTGGTTGTAAGCCTTGCATATGTACAGTCCCAGAAGTATCATCTGTCTTCATCTTCCCCCCAAAG CCCAAGGATGTGCTCACCATTACTCTGACTCCTAAGGTCACGTGTGTTGTGGTAGACATCAGCAAGGATGATCCCG AGGTCCAGTTCAGCTGGTTTGTAGATGATGTGGAGGTGCACACAGCTCAGACGCAACCCCGGGAGGAGCAGTTCAA CAGCACTTTCCGCTCAGTCAGTGAACTTCCCATCATGCACCAGGACTGGCTCAATGGCAAGGAGTTCAAATGCAGG GTCAACAGTGCAGCTTTCCCTGCCCCCATCGAGAAAACCATCTCCAAAACCAAAGGCAGACCGAAGGCTCCACAGG TGTACACCATTCCACCTCCCAAGGAGCAGATGGCCAAGGATAAAGTCAGTCTGACCTGCATGATAACAGACTTCTT CCCTGAAGACATTACTGTGGAGTGGCAGTGGAATGGGCAGCCAGCGGAGAACTACAAGAACACTCAGCCCATCATG GACACAGATGGCTCTTACTTCGTCTACAGCAAGCTCAATGTGCAGAAGAGCAACTGGGAGGCAGGAAATACTTTCA CCTGCTCTGTGTTACATGAGGGCCTGCACAACCACCATACTGAGAAGAGCCTCTCC CACTCTCCTGGTAAA-3 ' is (right It should be in SEQ ID No.11)

The DNA sequence dna of light chain variable region

5’-GATGTTTTGCTGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAGGCCTCCATCTC TTGCAGATCTAGTCAGAGCATTGTACATAGTAATGGAAACACCTATTTAGAATGGTACCTGCAGAAACCAGGCCAG TCTCCAAAGCTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAG GGACAGATTTCACACTCAAGATCAGCAGAGTGGAGGCTGAGGATCTGGGAGTTTATTACTGCTTTCAAGGTTCACA TGTTCCGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAA-3 ' (corresponds to SEQ ID No.10)

The DNA sequence dna of constant region of light chain

5’-CGGGCTGATGCTGCACCAACTGTATCCATCTTCCCACCATCCAGTGAGCAGTTAACATCTGGAGGT GCCTCAGTCGTGTGCTTCTTGAACAACTTCTACCCCAAAGACATCAATGTCAAGTGGAAGATTGATGGCAGTGAAC GACAAAATGGCGTCCTGAACAGTTGGACTGATCAGGACAGCAAAGACAGCACCTACAGCATGAGCAGCACCCTCAC GTTGACTAAGGACGAGTATGAACGACATAACAGCTATACCTGTGAGGCCACTCACAAGACATCAACTTCACCCATT GTCAAGAGCTTCAACAGGGGAGAGTGT-3 ' (corresponds to SEQ ID No.12)

In conclusion the monoclonal antibody of energy specific recognition people CSF-1R of the invention, the antibody is in conjunction with people CSF-1R Affinity it is strong, sequence is novel, and combines unique epitope.

It is discussed in detail although the contents of the present invention have passed through above preferred embodiment, but it should be appreciated that above-mentioned Description is not considered as limitation of the present invention.After those skilled in the art have read above content, for of the invention A variety of modifications and substitutions all will be apparent.Therefore, protection scope of the present invention should be limited to the appended claims.

Sequence table

<110>letter biotechnology (Nanjing) Co., Ltd difficult to understand is won

<120>a kind of anti-human CSF-1R monoclonal antibody and application thereof

<130> xhx2018071801

<141> 2018-07-18

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 119

<212> PRT

<213> Homo sapiens

<400> 1

Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr

20 25 30

Asn Met Gln Trp Val Arg Gln Ser His Gly Lys Ser Leu Glu Trp Ile

35 40 45

Gly Tyr Ile Tyr Pro Tyr Asn Gly Asp Thr Gly Tyr Asn Gln Lys Phe

50 55 60

Lys Ser Lys Ala Thr Leu Thr Val Asp Asn Ser Ser Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Gly Tyr Tyr Gly Arg Tyr Phe Asp Val Trp Gly Ala Gly

100 105 110

Thr Thr Val Thr Val Ser Ser

115

<210> 2

<211> 113

<212> PRT

<213> Homo sapiens

<400> 2

Ser Asp Val Leu Leu Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu

1 5 10 15

Gly Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Ile Val His

20 25 30

Ser Asn Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro Gly Gln

35 40 45

Ser Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser Gly Val

50 55 60

Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys

65 70 75 80

Ile Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys Phe Gln

85 90 95

Gly Ser His Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile

100 105 110

Lys

<210> 3

<211> 8

<212> PRT

<213> Homo sapiens

<400> 3

Gly Tyr Thr Phe Thr Asp Tyr Asn

1 5

<210> 4

<211> 8

<212> PRT

<213> Homo sapiens

<400> 4

Ile Tyr Pro Tyr Asn Gly Asp Thr

1 5

<210> 5

<211> 12

<212> PRT

<213> Homo sapiens

<400> 5

Ala Arg Asp Gly Tyr Tyr Gly Arg Tyr Phe Asp Val

1 5 10

<210> 6

<211> 16

<212> PRT

<213> Homo sapiens

<400> 6

Arg Ser Ser Gln Ser Ile Val His Ser Asn Gly Asn Thr Tyr Leu Glu

1 5 10 15

<210> 7

<211> 7

<212> PRT

<213> Homo sapiens

<400> 7

Lys Val Ser Asn Arg Phe Ser

1 5

<210> 8

<211> 9

<212> PRT

<213> Homo sapiens

<400> 8

Phe Gln Gly Ser His Val Pro Trp Thr

1 5

<210> 9

<211> 357

<212> DNA

<213> Homo sapiens

<400> 9

gaggtccagc ttcagcagtc aggacctgag ctggtgaaac ctggggcctc agtgaagata 60

tcctgcaagg cttctggata cacattcact gactacaata tgcaatgggt gaggcagagc 120

catggaaaga gccttgagtg gattggatat atttatcctt acaatggtga tactggctac 180

aaccagaagt tcaagagcaa ggccacattg actgtagaca attcctccag cacagcctac 240

atggagctcc gcagcctgac atctgaggac tctgcagtct attactgtgc acgagatggt 300

tactacggga ggtacttcga tgtctggggc gcagggacca cggtcaccgt ctcctca 357

<210> 10

<211> 336

<212> DNA

<213> Homo sapiens

<400> 10

gatgttttgc tgacccaaac tccactctcc ctgcctgtca gtcttggaga tcaggcctcc 60

atctcttgca gatctagtca gagcattgta catagtaatg gaaacaccta tttagaatgg 120

tacctgcaga aaccaggcca gtctccaaag ctcctgatct acaaagtttc caaccgattt 180

tctggggtcc cagacaggtt cagtggcagt ggatcaggga cagatttcac actcaagatc 240

agcagagtgg aggctgagga tctgggagtt tattactgct ttcaaggttc acatgttccg 300

tggacgttcg gtggaggcac caagctggaa atcaaa 336

<210> 11

<211> 972

<212> DNA

<213> Homo sapiens

<400> 11

gccaaaacga cacccccatc tgtctatcca ctggcccctg gatctgctgc ccaaactaac 60

tccatggtga ccctgggatg cctggtcaag ggctatttcc ctgagccagt gacagtgacc 120

tggaactctg gatccctgtc cagcggtgtg cacaccttcc cagctgtcct gcagtctgac 180

ctctacactc tgagcagctc agtgactgtc ccctccagca cctggcccag cgagaccgtc 240

acctgcaacg ttgcccaccc ggccagcagc accaaggtgg acaagaaaat tgtgcccagg 300

gattgtggtt gtaagccttg catatgtaca gtcccagaag tatcatctgt cttcatcttc 360

cccccaaagc ccaaggatgt gctcaccatt actctgactc ctaaggtcac gtgtgttgtg 420

gtagacatca gcaaggatga tcccgaggtc cagttcagct ggtttgtaga tgatgtggag 480

gtgcacacag ctcagacgca accccgggag gagcagttca acagcacttt ccgctcagtc 540

agtgaacttc ccatcatgca ccaggactgg ctcaatggca aggagttcaa atgcagggtc 600

aacagtgcag ctttccctgc ccccatcgag aaaaccatct ccaaaaccaa aggcagaccg 660

aaggctccac aggtgtacac cattccacct cccaaggagc agatggccaa ggataaagtc 720

agtctgacct gcatgataac agacttcttc cctgaagaca ttactgtgga gtggcagtgg 780

aatgggcagc cagcggagaa ctacaagaac actcagccca tcatggacac agatggctct 840

tacttcgtct acagcaagct caatgtgcag aagagcaact gggaggcagg aaatactttc 900

acctgctctg tgttacatga gggcctgcac aaccaccata ctgagaagag cctctcccac 960

tctcctggta aa 972

<210> 12

<211> 321

<212> DNA

<213> Homo sapiens

<400> 12

cgggctgatg ctgcaccaac tgtatccatc ttcccaccat ccagtgagca gttaacatct 60

ggaggtgcct cagtcgtgtg cttcttgaac aacttctacc ccaaagacat caatgtcaag 120

tggaagattg atggcagtga acgacaaaat ggcgtcctga acagttggac tgatcaggac 180

agcaaagaca gcacctacag catgagcagc accctcacgt tgactaagga cgagtatgaa 240

cgacataaca gctatacctg tgaggccact cacaagacat caacttcacc cattgtcaag 300

agcttcaaca ggggagagtg t 321

<210> 13

<211> 324

<212> PRT

<213> Homo sapiens

<400> 13

Ala Lys Thr Thr Pro Pro Ser Val Tyr Pro Leu Ala Pro Gly Ser Ala

1 5 10 15

Ala Gln Thr Asn Ser Met Val Thr Leu Gly Cys Leu Val Lys Gly Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Thr Trp Asn Ser Gly Ser Leu Ser Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu Tyr Thr Leu

50 55 60

Ser Ser Ser Val Thr Val Pro Ser Ser Thr Trp Pro Ser Glu Thr Val

65 70 75 80

Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val Asp Lys Lys

85 90 95

Ile Val Pro Arg Asp Cys Gly Cys Lys Pro Cys Ile Cys Thr Val Pro

100 105 110

Glu Val Ser Ser Val Phe Ile Phe Pro Pro Lys Pro Lys Asp Val Leu

115 120 125

Thr Ile Thr Leu Thr Pro Lys Val Thr Cys Val Val Val Asp Ile Ser

130 135 140

Lys Asp Asp Pro Glu Val Gln Phe Ser Trp Phe Val Asp Asp Val Glu

145 150 155 160

Val His Thr Ala Gln Thr Gln Pro Arg Glu Glu Gln Phe Asn Ser Thr

165 170 175

Phe Arg Ser Val Ser Glu Leu Pro Ile Met His Gln Asp Trp Leu Asn

180 185 190

Gly Lys Glu Phe Lys Cys Arg Val Asn Ser Ala Ala Phe Pro Ala Pro

195 200 205

Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Arg Pro Lys Ala Pro Gln

210 215 220

Val Tyr Thr Ile Pro Pro Pro Lys Glu Gln Met Ala Lys Asp Lys Val

225 230 235 240

Ser Leu Thr Cys Met Ile Thr Asp Phe Phe Pro Glu Asp Ile Thr Val

245 250 255

Glu Trp Gln Trp Asn Gly Gln Pro Ala Glu Asn Tyr Lys Asn Thr Gln

260 265 270

Pro Ile Met Asp Thr Asp Gly Ser Tyr Phe Val Tyr Ser Lys Leu Asn

275 280 285

Val Gln Lys Ser Asn Trp Glu Ala Gly Asn Thr Phe Thr Cys Ser Val

290 295 300

Leu His Glu Gly Leu His Asn His His Thr Glu Lys Ser Leu Ser His

305 310 315 320

Ser Pro Gly Lys

<210> 14

<211> 107

<212> PRT

<213> Homo sapiens

<400> 14

Arg Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu

1 5 10 15

Gln Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe

20 25 30

Tyr Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg

35 40 45

Gln Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser

50 55 60

Thr Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu

65 70 75 80

Arg His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser

85 90 95

Pro Ile Val Lys Ser Phe Asn Arg Gly Glu Cys

100 105

Claims (9)

1. a kind of anti-human CSF-1R monoclonal antibody, which is characterized in that the antibody includes: heavy chain and light chain；

The heavy chain and light chain includes variable region, which includes complementary determining region；

Complementary determining region CDR1, CDR2 and CDR3 of the heavy chain are indicated with CDR-H1, CDR-H2 and CDR-H3 respectively；

Complementary determining region CDR1, CDR2 and CDR3 of the light chain are indicated with CDR-L1, CDR-L2 and CDR-L3 respectively；

The amino acid sequence of the CDR-H1 is shown in SEQ ID NO:3；

The amino acid sequence of the CDR-H2 is shown in SEQ ID NO:4；

The amino acid sequence of the CDR-H3 is shown in SEQ ID NO:5；

The amino acid sequence of the CDR-L1 is shown in SEQ ID NO:6；

The amino acid sequence of the CDR-L2 is shown in SEQ ID NO:7；

The amino acid sequence of the CDR-L3 is shown in SEQ ID NO:8.

2. a kind of anti-human CSF-1R monoclonal antibody according to claim 1, which is characterized in that heavy chain variable amino acid Sequence is shown in SEQ ID NO:1；Chain variable region amino acid sequence is shown in SEQ ID NO:2.

3. a kind of nucleic acid molecule, which is characterized in that the nucleic acid molecule encodes anti-human CSF- as claimed in claim 1 or 2 1R monoclonal antibody；

The sequence of the nucleic acid molecule is selected from SEQ ID NO:9 and/or SEQ ID NO:10；

The heavy chain variable region of the sequence SEQ ID NO:9 coding antibody；

The light chain variable region of the sequence SEQ ID NO:10 coding antibody.

4. a kind of expression vector, which is characterized in that the expression vector contains nucleic acid molecule as claimed in claim 3.

5. a kind of host cell, which is characterized in that the host cell contains expression vector as claimed in claim 4.

6. a kind of preparation method of anti-human CSF-1R monoclonal antibody of any of claims 1 or 2, which is characterized in that the preparation Method comprises the following steps:

Step 1: the expression vector of nucleic acid molecule of the preparation containing the expression anti-human CSF-1R monoclonal antibody；

Step 2: transfecting eukaryotic host cell with the expression vector of step 1；

Step 3: the eukaryotic host cell that incubation step 2 transfects；

Step 4: isolating and purifying, obtain the antibody.

7. the preparation method of anti-human CSF-1R monoclonal antibody according to claim 6, which is characterized in that the expression Carrier contains the nucleotide sequence selected from SEQ ID NO:9 and/or SEQ ID NO:10.

8. including antibody mediated immunity the coupling conjugate, bispecific of anti-human CSF-1R monoclonal antibody of any of claims 1 or 2 Molecule, embedding and antigen receptor or pharmaceutical composition.

9. anti-human CSF-1R monoclonal antibody of any of claims 1 or 2 is preparing anti-tumor drug, rheumatoid arthritis medicine Application in object, atherosclerosis drug or bone remodeling drug.