CN109045291A - A kind of porcine mycoplasmal pneumonia aerosol live vaccine and preparation method thereof - Google Patents
A kind of porcine mycoplasmal pneumonia aerosol live vaccine and preparation method thereof Download PDFInfo
- Publication number
- CN109045291A CN109045291A CN201811160764.1A CN201811160764A CN109045291A CN 109045291 A CN109045291 A CN 109045291A CN 201811160764 A CN201811160764 A CN 201811160764A CN 109045291 A CN109045291 A CN 109045291A
- Authority
- CN
- China
- Prior art keywords
- vaccine
- aerosol
- diluent
- dilution
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/0241—Mollicutes, e.g. Mycoplasma, Erysipelothrix
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/30—Macromolecular organic or inorganic compounds, e.g. inorganic polyphosphates
- A61K47/36—Polysaccharides; Derivatives thereof, e.g. gums, starch, alginate, dextrin, hyaluronic acid, chitosan, inulin, agar or pectin
- A61K47/40—Cyclodextrins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/007—Pulmonary tract; Aromatherapy
- A61K9/0073—Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy
- A61K9/0078—Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy for inhalation via a nebulizer such as a jet nebulizer, ultrasonic nebulizer, e.g. in the form of aqueous drug solutions or dispersions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
- A61K9/12—Aerosols; Foams
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
Abstract
The present invention provides a kind of porcine mycoplasmal pneumonia aerosol live vaccine and preparation method thereof, is related to animal vaccine field.The aerosol live vaccine is obtained after being atomized vaccine solution, and the vaccine solution is obtained after mycoplasma hyopneumoniae low virulent strain is suspended in vaccine diluent；The dilution is the aqueous solution containing following ingredient: 10 ~ 50 g/L of Macrogol 6000,1 ~ 10 g/L of cyclodextrin, 5 ~ 20 g/L of sodium thiosulfate, 10 ~ 20g/L of L-Histidine, pH value 6.8-7.6.The present invention also provides the preparation methods of the vaccine, comprising: by the bacterium solution or dried frozen aquatic products of mycoplasma hyopneumoniae low virulent strain, prepares solution with vaccine diluent, aerosol live vaccine is made by ultrasonic atomizatio method；The aerodynamic qualities median of the aerosol live vaccine is 1-5 μm, and Effective Antigens concentration is not less than 50%.Live vaccine of the present invention after being detained 30 minutes in air, still has compared with high titre, and immune protective rate is high, immune duration is long, and preparation is simple, at low cost.
Description
Technical field
The present invention relates to animal vaccine fields, and in particular to a kind of porcine mycoplasmal pneumonia aerosol live vaccine and its preparation side
Method.
Technical background
Porcine mycoplasmal pneumonia is a kind of contact chronic respiratory infectious disease as caused by mycoplasma hyopneumoniae infection.This disease
It is all over the world, and it easily is mixed infection with other cause of diseases, cause more serious pulmonary lesion, generates bigger economic damage
It loses.Vaccine immunity is the main method for preventing the disease.Alternative vaccine is broadly divided into import inactivated vaccine currently on the market
With domestic attenuated vaccine.Since only part is colonized in the lower respiratory tracts such as pig bronchus, bronchiole to mycoplasma hyopneumoniae, not with blood
Liquid is recycled into whole body.Therefore the serum antibody generated after porcine mycoplasmal pneumonia inactivated vaccine is immune is unrelated with immunoprotection, goes out
Also field planting of the wild poison of mycoplasma hyopneumoniae to bronchus cilium, therefore immunoprotection efficiency one can not be prevented after live vaccine is immune
As.And vaccine strain is directly seeded to lung, analog wild virus infection by the porcine mycoplasmal pneumonia live vaccine (168 plants) that China develops
Long-term occupation time process is generated, and inhibits the infection of wild poison；Simultaneously live vaccine it is immune also can produce it is directly related with immunoprotection
Respiratory tract specialized mucosal sIgA antibody, immune protective effect is excellent, and 2007 at home since marketing use, and clinic makes
Use significant effect.However used pulmonary injection immunization route is unfavorable for large-scale promotion to the live vaccine at present, if can be by pig branch
Nebulizer formulation is made in pneumonias live vaccine, then can not only improve the convenience of vaccine inoculation, and labour is greatly saved
And working time, achieve the purpose that more preferably to promote that the vaccine is immunized, sufficiently realizes that live vaccine is better than the speciality of inactivated vaccine.
The efficiently immune of aerosol vaccine is realized it is necessary that there are enough active vaccine strains that can enter pig
Lower respiratory tract.Therefore must two parameters of partial size to aerosol vaccine and activity strictly monitored.Due to pig turbinate with
The particle that the characteristics of tracheae anatomical structure, only aerodynamic qualities median (MMAD) are 1~10 μm is through aerosol with suitable
When angle can enter respiratory tract, the particle that wherein partial size is 1~5 μm more successfully can enter bronchus and thin with breathing
Bronchus, and thicker particle is largely fallen on upper respiratory tract bronchia mucosal, can not play targeting to vaccine.If micro-
Grain is too thin (≤0.5 μm), then enters after alveolar sac and be discharged again with exhaling, so live vaccine must be atomized porcine mycoplasmal pneumonia
Size controlling is in 1~10 μm, preferably between 1~5 μm.Other than aerosol vaccine partial size factor, aerosol is occurring
Having several factors in the process influences the vigor of microorganism, for example the cutting force in aerosol generating process, high pressure influence gas
The factor of colloidal sol microbial activity.Cutting force and high pressure in aerosol generating process is bigger, and atomization particle is smaller, but vaccine
The vigor of strain is also lower.In addition to the cutting force, high pressure the effects of other than power, influencing the factor of microfluidic aerosol biologos, there are also environment
Factor is atomized moisture content rapid evaporation in vaccine, salt metabolism imbalance and desiccation sharply, oxygen such as under low humidity, hot environment
Change effect substantially reduces atomization vaccine vigor.With the extension of aerosol duration in air, environment is to active shadow
Ringing can be more obvious.
Patent No. 201210275639.1, entitled " a kind of preparation and inspection of porcine mycoplasmal pneumonia atomization live vaccine
The patent of invention of method " uses air blowing type atomization or hydraulic atomization to prepare partial size as under 1~10 μm, instantaneous titre
Mycoplasma hyopneumoniae aerosol vaccine within 0.25~1 titre drops.In the patent of invention, the vaccine quantitative collection of use
Device is only capable of collecting atomization when just occurring, the aerosol vaccine that is not yet completely dispersed and is detained certain time in air (if mist
Collected after change, the aerosol vaccine being collected into is less, and the efficiency for being converted to liquid seedling is too low), it can not accurate evaluation environment
Influence of the factor to aerosol vaccine activity.Applicant has found during follow-up study, although vaccine solution is in newly formed gas
When colloidal sol vaccine, titre decline is lower, but with the extension of residence time in air, activity decline is significant, causes and exempts from
Epidemic disease protective rate is lower.
Summary of the invention
The object of the present invention is to provide a kind of porcine mycoplasmal pneumonia aerosol live vaccines, after being detained 30 minutes in air,
Still have compared with high titre, immune protective rate is high, immune duration is long.
It is a further object of the present invention to provide the preparation methods of porcine mycoplasmal pneumonia aerosol live vaccine, and this method is simple,
It is at low cost.
The purpose of the present invention adopts the following technical scheme that realization.
A kind of porcine mycoplasmal pneumonia aerosol live vaccine, is obtained after being atomized vaccine solution, and the vaccine solution is
Mycoplasma hyopneumoniae low virulent strain is suspended in and is obtained after vaccine diluent；The vaccine diluent is the water containing following ingredient
Solution: 10~50g/L of Macrogol 6000,1~10g/L of cyclodextrin, 5~20g/L of sodium thiosulfate, L-Histidine 10~
20g/L, pH value 6.8-7.6.
In preferred technical solution, mucosal adjuvant is also contained in the vaccine diluent, the mucosal adjuvant is poly- for shell
The mixing of one or more of sugar, Gel01, PolyI:C, E.coli LT, CpG, IL-12, ISCOM
Object.
In preferred technical solution, the concentration of chitosan is 0.05-5g/L in the vaccine diluent；The vaccine dilution
The concentration of Gel01 is 1-30g/L in liquid, the concentration of PolyI:C is 10-1000mg/L in the vaccine diluent；The vaccine
The concentration of E.coli LT is 1-10mg/L in dilution；The concentration of CpG is 1- in the vaccine diluent
100mg/L；The concentration of IL-12 is 0.1-5mg/L in the vaccine diluent, the concentration of ISCOM is in the vaccine diluent
0.1-1g/L。
In the present invention, the mycoplasma hyopneumoniae low virulent strain is 168 plants.
The present invention also provides the preparation methods of the porcine mycoplasmal pneumonia aerosol live vaccine, comprising the following steps:
(1) by the bacterium solution or dried frozen aquatic products of mycoplasma hyopneumoniae low virulent strain, porcine mycoplasmal pneumonia is configured to vaccine diluent
Live vaccine solution；
(2) aerosol epidemic disease living is made by ultrasonic atomizatio method in the resulting porcine mycoplasmal pneumonia live vaccine solution of step (1)
Seedling；The aerodynamic qualities median of the aerosol live vaccine is 1-5 μm, and Effective Antigens concentration is not less than 50%.
In the present invention, the bacterium solution Yu vaccine diluent volume ratio of the mycoplasma hyopneumoniae low virulent strain are 1:1-100；Institute
Stating mycoplasma hyopneumoniae low virulent strain dried frozen aquatic products freeze-drying the ratio between front volume and vaccine diluent volume is 1:1-100.
In preferred technical solution, atomization plant used in the ultrasonic atomizatio method is that frequency of oscillation is the super of 1.7-2.4MHz
Sound atomizer.
Compared with prior art, the invention has the benefit that
Porcine mycoplasmal pneumonia aerosol live vaccine of the present invention after being detained 30 minutes in air, still has compared with high titre,
Immune protective rate reaches 60% or more, meets requirement of novel chiral synthon evaluation in China's to porcine mycoplasmal vaccine, in addition, molten using the gas
After glue live vaccine is immune, the immune duration of pig reaches 8 months or more.Since porcine mycoplasmal pneumonia aerosol live vaccine passes through
Pig can be immunized in aerosol immunization, improve the convenience of vaccine inoculation, labour and working time is greatly saved.
The preparation method of porcine mycoplasmal pneumonia aerosol live vaccine of the present invention, the ultrasonic atomizatio used, method are easier, low
Cost is conducive to large-scale promotion in farm, and can realize automation.
The present invention is total using the previous aerodynamics of more accurate aerodynamic qualities median (MMAD) substitution
Particle median diameter (NMAD) detects the sizes of aerosol vaccination particles, finds the porcine mycoplasmal pneumonia aerosol of preparation epidemic disease living
The partial size of seedling is thinner, and MMAD is controlled in 1~5 μm, and size distribution more concentrates (geometric standard deviation GSD closer to 1), can
Guarantee that more effectively aerosol vaccines enter the lower respiratory tracts target organs such as bronchus and the bronchiole of pig, generates higher immune
Protection；
The present invention has updated dilution formula of liquid due to the change of atomizing type, to greatly reduce because of atomization process pair
It is damaged caused by vaccine, after especially floating 30 minutes naturally in air, vaccine titre only declines≤0.5 titre.More
The presence of active vaccine strain ensure that more efficient, more lasting immunoprotection.
Specific embodiment
168 plants of freeze-drying lactobacillus of mycoplasma hyopneumoniae used in the present invention: by 168 plants of cultures of 2ml mycoplasma hyopneumoniae
It is fitted into the cillin bottle of 1 5ml and is lyophilized, obtain 168 plants of freeze-drying lactobacillus of mycoplasma hyopneumoniae.Every bottle of freeze-drying lactobacillus uses 2ml epidemic disease
Titre after seedling dilution redissolves is 5 × 107CCU/ml.168 plants of mycoplasma hyopneumoniae are current domestic commerce porcine mycoplasmals
The vaccine strain of pneumonia live vaccine (168 plants).168 plants of cultures of mycoplasma hyopneumoniae refer to the strain using conventional medium culture
Gained culture.
The preparation and inspection of 1 porcine mycoplasmal pneumonia aerosol live vaccine of embodiment
1. strain
168 plants of freeze-drying lactobacillus of mycoplasma hyopneumoniae are equipped with 168 plants of cultures of 2ml mycoplasma hyopneumoniae before every bottle of freeze-drying.
2. vaccine diluent is prepared
Vaccine diluent A is the aqueous solution containing following substance: 0.1g/L chitosan (molecular weight 150KDa), 20g/L
PEG6000 (Macrogol 6000), 2g/L cyclodextrin, 10g/L sodium thiosulfate, 10g/L L-Histidine, pH value 7.4.
Specific preparation method is as follows:
(1) Macrogol 6000, cyclodextrin, sodium thiosulfate and L-Histidine are first dissolved in water, adjusting pH value is 7.4,
Obtain vaccine protectant solution.
(2) by Chitosan powder put into suitable aqueous acetic acid after completely dissolution, with NaOH solution adjust pH to
Neutrality obtains the chitosan mother liquor of 10g/L.
(3) chitosan mother liquor is added in vaccine protectant solution, so that the final concentration of chitosan reaches 0.1g/L,
His substance it is final concentration of: PEG6000 20g/L, cyclodextrin 2g/L, sodium thiosulfate 10g/L, L-Histidine 10g/L are adjusted
PH value obtains vaccine diluent to 7.4.
3. preparing aerosol vaccine
168 plants of freeze-drying lactobacillus of every bottle of mycoplasma hyopneumoniae using 200ml vaccine diluent A dissolution (be lyophilized before strain with it is dilute
Releasing liquid volume ratio is 1:100), obtain vaccine solution.
Vaccine solution is poured into the ultrasonic atomizer that frequency of oscillation is 1.7MHz to be atomized, obtains aerosol vaccine.
4. the detection of aerosol vaccine properties
(1) droplet measurement
The aerosol vaccine that 168 plants of mycoplasma hyopneumoniae are prepared using method in the present embodiment title 3, by the aerosol epidemic disease
Seedling is passed through atomization box, and atomization box bottom opening is connect with aerosol partial size spectrometer detection mouth, and aerosol vaccine is 2 minutes spraying
Afterwards, aerosol partial size spectrometer power supply is opened, aerosol vaccination particles are detected.As a result as follows: aerosol vaccination particles
Aerodynamic qualities median (MMAD) is 2.64 microns, and geometric standard deviation (GSD) is 1.28.
(2) Effective Antigens Concentration Testing
By cell Proliferation tracer fluorescence probe dyestuff (CFDA-SE) specification, by 168 plants of strain dyes of mycoplasma hyopneumoniae
Color, after washing, by every bottle of freeze-drying lactobacillus with 200ml vaccine diluent A (strain and dilution volume ratio are 1:100 before being lyophilized) into
Vaccine solution is poured into the ultrasonic atomizer that frequency of oscillation is 1.7-2.4MHz and is atomized, obtains aerosol vaccine by row dissolution.
Aerosol particle is acquired with clean coverslip.Coverslip is immediately placed on attached reeded glass slide after sampling, and in sharp
It is observed under light Laser Scanning Confocal Microscope oil mirror (60X).20 visuals field are selected at random, count the aerosol particle number in each visual field,
And the aerosol particle number containing fluorescent marker, according to the Effective Antigens concentration of aerosol vaccine=gas containing fluorescent marker
Sol particle number/aerosol particle number * 100% calculates Effective Antigens concentration.As a result: the Effective Antigens concentration of aerosol vaccine
It is 52.32% ± 4.6%.
(3) Activity determination
The aerosol vaccine that 168 plants of mycoplasma hyopneumoniae are prepared using method in the present embodiment title 3, by the aerosol epidemic disease
Seedling is passed through atomization box, and the aperture of atomization box bottom is connect with air microorganism sampler (U.S. SKC).It is spraying to close after five minutes
Atomizer is closed, air microorganism sampler is opened after 30 minutes, is collected in atomization box vaccine aerosol 2 minutes.Whole process control
Atomization box temperature processed is at 20-30 DEG C, humidity >=40%.
The activity titers of vaccine strains in sampler are measured by CCU50 method, and atomization is detected by quantitative PCR method respectively
The copy number of vaccine strains in preceding vaccine solution and atomization post-sampling device, according to the two copy number ratio, calibration simultaneously calculates gas
Titre decline 0.48 before colloidal sol vaccine is relatively atomized.The specific method is as follows:
1) be atomized before, by CCU50 method detect vaccine solution in antigen titre A1 (Litamoi, J., Palya, V.J.,
Sylla,D.,Rweyemamu,M.M.,1996.Quality control testing of contagious bovine
pleuropneumonia live attenuated vaccine.In:FAO Animal Production and Health
Paper 128.Food and Agriculture Organization of the United Nations,Rome,pp.14–
15.).Using mycoplasma hyopneumoniae fluorescent quantitative PCR detection method, (Wu Yu is diligent etc., and mycoplasma hyopneumoniae P97TaqMan-BHQ is glimmering
The foundation of Fluorescent Quantitative PCR detection method and application China veterinary science, 2012.12:1268-1272.) it detects in vaccine solution
The P97 gene copy number B1 of antigen.
2) after being atomized, aerosol live vaccine is collected using BioSampler liquid bio aerosol sampler, is sampled
Liquid；
3) titre A2 and P97 the gene copy number B2 of antigen in sample solution, the same step 1) of specific method are detected；By as follows
The ideal titre A3:A3=B2/B1*A1 of formula calculating sample solution；
4) titre drop-out value=A3-A2 before aerosol vaccine is relatively atomized.Being computed the aerosol vaccine titre A2 is 2.50
LgCCU50, titre drop-out value is 0.48 titre (declining 0.48 lgCCU50) before being relatively atomized.
5. the immune and effect of aerosol vaccine
10 first week old piglets (immune group) are placed in piglet atomization box, 1 bottle of mycoplasma hyopneumoniae, 168 plants of freeze-dried vaccines are taken
Kind prepares aerosol vaccine according to method in the present embodiment title 3 in piglet atomization box.In this way, realizing son in atomization box
The atomization of pig is immune, immunizing dose 107CCU/ parts.It is to be atomized to finish (nebulisation time about 30 minutes), allow piglet to continue
It is stopped 30 minutes in atomization box.It separately sets not immune healthy control group (not immune not attack poison) and attacks malicious control group and (be not immunized still
Attack poison), every group of 10 piglets.6 weeks after aerosol immunization, intratracheal pig pneumonia branch original is carried out with the pig for attacking malicious control group to immune group
Body virulent (JS plants) attacks poison, and 4 weeks dissects after attacking poison, by evaluation method (Xiong et al., 2014.Protective
efficacy of a live attenuated Mycoplasma hyopneumoniae vaccine with an ISCOM-
Matrix adjuvant in pigs.The Veterinary Journal 199:268-274.) record pulmonary lesion scoring,
Calculated result is as follows: the immune protective rate of immune group pig is 65%.
From the present embodiment, it can be seen that, diluent A can preferably protect 168 plants of activity, and aerosol live vaccine is in sky
After being detained 30min in gas, activity reduction is less, and reaches 60% to the immune protective rate of pig after immune pig, meets China
Novel chiral synthon evaluates the requirement to porcine mycoplasmal vaccine, and 168 plants of aerosol immunization will be made to become a reality, and more original intrapulmonary is immune,
The convenience for improving vaccine inoculation, is greatly saved labour and working time.
The droplet measurement of 2 various concentration aerosol vaccine of embodiment
Diluent A is the aqueous solution containing following substance: 3g/L chitosan (molecular weight 150KDa), 20g/L PEG6000,
2g/L cyclodextrin, 10g/L sodium thiosulfate, 10g/L L-Histidine, pH value 7.4.
10 bottles of mycoplasma hyopneumoniaes, 168 plants of freeze-drying lactobacillus are taken, (preceding strain and dilution volume are lyophilized with 20ml diluent A
Than for 1:1) dissolution, take wherein 2ml vaccine solution be added 198ml diluent A (strain and dilution volume ratio are 1 before being lyophilized:
100) it dilutes.The vaccine solution of two kinds of various concentrations is poured into ultrasonic atomizer atomization, frequency of oscillation 1.7MHz respectively, and is pressed
Droplet measurement method detects the aerodynamic size of aerosol vaccination particles respectively in embodiment 1, repeats three times.Meanwhile
With control vaccine A ' (deionized water solution (pH value 7.5) containing 5% glycerol, 0.1% polyvinylpyrrolidone), according to identical
Method prepares the porcine mycoplasmal pneumonia live vaccine solution that preceding strain is lyophilized with dilution volume ratio for two kinds of concentration of 1:1 and 1:100,
The vaccine solution is added in medical lower respiratory tract appositional pattern sprayer (German Berry), by sprayer connection air compression
Pump adjusts after pressure is 0.2MPa and is sprayed, prepares aerosol vaccine by compressed air air blast.It measures in aforementioned manners
Mean aerodynamic mass median partial size.
(table 1) as the result is shown, the aerosol vaccine prepared using diluent A, strain and dilution volume ratio before being lyophilized
When for 1:1, mean aerodynamic mass median partial size is 4.72 microns, and average geometric standard deviation is 1.54；Before freeze-drying
When strain and dilution volume ratio are 1:100, mean aerodynamic mass median partial size is 4.28 microns, average geometric standard
Deviation is 1.44.And the aerosol vaccine partial size of control vaccine A ' preparation and the aerosol vaccine partial size using diluent A preparation
It is bigger than normal compared to significant, and it is all larger than 5.0 microns.
The porcine mycoplasmal pneumonia aerosol live vaccine aerodynamic size testing result of 1 various concentration of table
In table 1 " * ", the significant difference (P < 0.05) compared with aerosol vaccine prepared by control vaccine A ' is indicated
The concentration of Effective Antigens in 3 various concentration aerosol vaccine of embodiment
Diluent A is the aqueous solution containing following ingredients: CpG (sequence TCGTCGTTGTCGTTTTGTCGTT) 100mg/
L, PEG6000 20g/L, cyclodextrin 2g/L, sodium thiosulfate 10g/L, L-Histidine 10g/L, pH value 7.4.
Dilution B is the aqueous solution containing following substance: (immunostimulating complex is disclosed in Xiong et to ISCOM
al.,2014.Protective efficacy of a live attenuated Mycoplasma hyopneumoniae
vaccine with an ISCOM-matrix adjuvant in pigs.The Veterinary Journal 199:268-
274.) 0.5g/L, PEG6000 20g/L, cyclodextrin 2g/L, sodium thiosulfate 10g/L, L-Histidine 10g/L, pH value 7.2.
Compare dilution 1: the deionized water solution containing 5% glycerol, 0.1% polyvinylpyrrolidone, pH value 7.5.
10 bottles of mycoplasma hyopneumoniaes, 168 plants of freeze-drying lactobacillus are taken, are said by cell Proliferation tracer fluorescence probe dyestuff (CFDA-SE)
After 168 plants of mycoplasma hyopneumoniae are dyed and washed, (preceding strain and dilution volume is lyophilized with the dissolution of 20ml diluent A in bright book
Than taking for 1:1), wherein (strain and dilution volume ratio are dilute for 1:100) before being lyophilized for 2ml vaccine solution 198ml diluent A
It releases.
Same method, the 10 bottles of mycoplasma hyopneumoniaes that will be marked through cell Proliferation tracer fluorescence probe dyestuff (CFDA-SE)
168 plants of strains take wherein 2ml vaccine solution with 20ml dilution B dissolution (strain and dilution volume ratio are 1:1 before being lyophilized)
With 198ml dilution B (strain and dilution volume ratio are 1:100 before being lyophilized) dilution.
In addition, 168 plants of 10 bottles of mycoplasma hyopneumoniaes will marked through cell Proliferation tracer fluorescence probe dyestuff (CFDA-SE)
Strain is dissolved into porcine mycoplasmal pneumonia live vaccine with 20ml control dilution 1 (strain and dilution volume ratio are 1:1 before being lyophilized)
Solution, take wherein 2ml vaccine solution with control dilution 1 be 1:100 dilution by strain and dilution volume ratio before being lyophilized.
By the vaccine solution for each concentration being formulated using diluent A, B, ultrasonic atomizer atomization, oscillation are poured into respectively
Frequency is 1.7MHz, and detects having in each aerosol vaccination particles respectively by Effective Antigens concentration detection method in embodiment 1
Imitate antigen concentration.In addition, the vaccine solution for each concentration being formulated using control dilution 1 is added to medical lower respiratory tract
In appositional pattern sprayer (German Berry), sprayer is connected into air pressure pump, adjusts after pressure is 0.2MPa and is sprayed, led to
Overcompression air puff method prepares aerosol vaccine, and detects each gas respectively by Effective Antigens concentration detection method in embodiment 1
Effective Antigens concentration in colloidal sol vaccination particles.
(table 2) as the result is shown, diluent A are aerosol epidemic disease made of 1:1 according to strain before being lyophilized and dilution volume ratio
Miao Zhong, Effective Antigens concentration are 88.2% ± 5.1%；Diluent A is 1:100 system according to strain before being lyophilized and dilution volume ratio
At aerosol vaccine in, Effective Antigens concentration 55.6% ± 4.7%.Dilution B is according to strain and dilution volume before being lyophilized
Than in aerosol vaccine made of 1:1, Effective Antigens concentration is 81.0% ± 3.5%；Dilution B according to be lyophilized before strain with
Dilution volume ratio is Effective Antigens concentration 52.3% ± 4.6% in aerosol vaccine made of 1:100.Control dilution 1 is pressed
It is in aerosol vaccine made of 1:100 according to strain before being lyophilized and dilution volume ratio, Effective Antigens concentration has been lower than 50%
(40.6% ± 0.8%).
The porcine mycoplasmal pneumonia aerosol live vaccine Effective Antigens Concentration Testing result of 2. various concentration of table
The activity of 4 various concentration aerosol vaccine of embodiment
Compare dilution 1: the deionized water solution containing 5% glycerol, 0.1% polyvinylpyrrolidone, pH value 7.5.
Diluent A is the aqueous solution containing following substance: PolyI:C (being purchased from Invivogen) 500mg/L, PEG6000
50g/L, cyclodextrin 1g/L, sodium thiosulfate 5g/L, L-Histidine 20g/L, pH value 7.6.
Dilution B is the aqueous solution containing following substance: Gel01 (French SEPPIC company) 1g/L, PEG600010g/L,
Cyclodextrin 10g/L, sodium thiosulfate 20g/L, L-Histidine 10g/L, pH value 7.2.
Dilution C is the aqueous solution containing following ingredients: CpG (sequence TCGTCGTTGTCGTTTTGTCGTT) 10mg/
L, PEG6000 20g/L, cyclodextrin 2g/L, sodium thiosulfate 10g/L, L-Histidine 10g/L, pH value 7.4.
10 bottles of mycoplasma hyopneumoniaes, 168 plants of freeze-drying lactobacillus are taken, (preceding strain and dilution are lyophilized with the dissolution of 20ml diluent A
Volume ratio is 1:1), take wherein 2ml vaccine solution be added 198ml diluent A (strain and dilution volume ratio are 1 before being lyophilized:
100) it dilutes.
According to the method for using diluent A preparation vaccine solution in the present embodiment, dilution B, C preparation is respectively adopted not
With the vaccine solution of concentration.
In addition, by 10 bottles of mycoplasma hyopneumoniaes, 168 plants of freeze-drying lactobacillus, with 20ml control dilution 1 (before being lyophilized strain with it is dilute
Releasing liquid volume ratio is 1:1) it is dissolved into porcine mycoplasmal pneumonia live vaccine solution, take wherein 2ml vaccine solution addition 198ml control dilute
Release liquid 1 (strain and dilution volume ratio are 1:100 before being lyophilized) dilution.
The vaccine solution for the various concentration being formulated using diluent A, B, C is poured into ultrasonic atomizer atomization respectively,
Frequency of oscillation is 1.7MHz, detects aerosol vaccine respectively by activity test method in embodiment 1 and floats in air 30 minutes
The decline degree of titre afterwards.The vaccine solution for two kinds of various concentrations being formulated using control dilution 1 is added separately to
In medical lower respiratory tract appositional pattern sprayer (German Berry), sprayer is connected into air pressure pump, adjusting pressure is 0.2MPa
After be sprayed, aerosol vaccine is prepared by compressed air air blast, and detect respectively by activity test method in embodiment 1
The decline degree of titre after aerosol vaccine floats 30 minutes in air.
(table 3) as the result is shown, the aerosol vaccine concentration prepared using diluent A strain and dilution volume before freeze-drying
When than for 1:1, after aerosol vaccine is detained 30 minutes in air, activity 0.38 titre of decline；Strain and dilution before being lyophilized
When liquid volume ratio is 1:100,0.41 titre of activity decline after aerosol vaccine is detained 30 minutes in air.Using dilution
When strain and dilution volume ratio are 1:1 before freeze-drying, aerosol vaccine is detained the aerosol vaccine concentration of B preparation in air
After 30 minutes, activity 0.40 titre of decline；When strain and dilution volume ratio are 1:100 before being lyophilized, aerosol vaccine is in sky
0.44 titre of activity decline after being detained 30 minutes in gas.The aerosol vaccine concentration prepared using dilution C bacterium before freeze-drying
When kind and dilution volume ratio are 1:1, after aerosol vaccine is detained 30 minutes in air, activity 0.32 titre of decline；Freeze
When strain and dilution volume ratio are 1:100 before dry, activity decline 0.48 after aerosol vaccine is detained 30 minutes in air
Titre.The aerosol vaccine prepared using control dilution 1, when strain and dilution volume ratio are 1:1 before being lyophilized, aerosol epidemic disease
1.37 titres of activity decline after seedling is detained 30 minutes in air；When strain and dilution volume ratio are 1:100 before being lyophilized, gas
1.82 titres of activity decline after being detained 30 minutes in colloidal sol vaccine air.Dilution C to 168 plants of active protective capabilities compared with
Good, after aerosol vaccine is detained 30min in air, 168 plants of activity only have reduction slightly.Dilution 1 is compared to 168 plants of work
Property protective capability it is weaker, after aerosol vaccine is detained 30min in air, 168 plants activity significantly reduce.
The porcine mycoplasmal pneumonia aerosol live vaccine Activity determination result of 3. various concentration of table
Influence of the 5 variety classes dilution of embodiment to aerosol vaccine immunity protective rate
Diluent A is the aqueous solution containing following substance: 200mg/L PolyI:C (being purchased from Invivogen), 50g/L
PEG6000,1g/L cyclodextrin, 5g/L sodium thiosulfate, 20g/L L-Histidine, pH value 7.6.
Dilution B is the aqueous solution containing following substance: ISCOM 0.5g/L, PEG6000 20g/L, cyclodextrin 2g/L,
Sodium thiosulfate 10g/L, L-Histidine 10g/L, pH value 7.2.
Dilution C is the aqueous solution containing following ingredients: CpG (sequence TCGTCGTTGTCGTTTTGTCGTT) 10mg/
L, PEG6000 20g/L, cyclodextrin 2g/L, sodium thiosulfate 10g/L, L-Histidine 10g/L, pH value 7.4.
Dilution D is the aqueous solution containing following substance: chitosan (molecular weight 150KDa) 0.1g/L, PEG600050g/
L, cyclodextrin 1g/L, sodium thiosulfate 5g/L, L-Histidine 20g/L, pH value 7.2.
Dilution E is the aqueous solution containing following substance: Gel01 (French SEPPIC company) 10g/L, PEG6000 10g/
L, cyclodextrin 10g/L, sodium thiosulfate 20g/L, L-Histidine 10g/L, pH value 7.2.
Compare dilution 1: the deionized water solution containing 5% glycerol, 0.1% polyvinylpyrrolidone, pH value 7.5.
1 bottle of pig is respectively dissolved with diluent A, dilution B, dilution C, dilution D, dilution E and control dilution 1 respectively
168 plants of freeze-drying lactobacillus of mycoplasma pneumoniae, the dosage of every kind of dilution is 20ml, obtains vaccine solution.
Diluent A, dilution B, dilution C, dilution D, dilution the E vaccine solution being formulated are poured into respectively super
10 piglets, immunizing dose 1 is immunized by immunization method in embodiment 1 in the atomization of sound atomizer, frequency of oscillation 1.7MHz respectively
Bottle freeze-drying lactobacillus is inoculated with 10 pigs (i.e. 1 × 107CCU/ parts), 14th, 28, the 42 day acquisition immune swine nose swab after immune,
(entitled anti-pig SC protein monoclonal antibody and its mycoplasma hyopneumoniae is being prepared by Patent No. ZL 201510239712.3
Application in terms of SIgA antibody ELISA detection kit) disclosed in method detection specificity sIgA antibody turn sun rate, and press
Protective rate of the method detection aerosol vaccine immunity piglet to strong virus attack in embodiment 1.Will using control dilution 1 prepare and
At vaccine solution be added in medical lower respiratory tract appositional pattern sprayer (German Berry), by sprayer connection air compression
Pump adjusts after pressure is 0.2MPa and is sprayed, prepares aerosol vaccine, immunizing dose and detection by compressed air air blast
The aerosol vaccine that the same diluent A of method, B, C, D, E are prepared into.
The result shows that (table 4), the aerosol vaccine prepared using diluent A are inoculated with 10 pigs (i.e. 1 in 1 bottle of freeze-drying lactobacillus
×107CCU/ parts) dosage under, 28 days after being immunized, specific sIgA antibody turns positive rate up to 80%, turns within 42 days after being immunized
Positive rate is 100%, which is 65.3% to the protective rate of immune swine.The aerosol vaccine prepared using dilution B,
10 pigs (i.e. 1 × 10 are inoculated in 1 bottle of freeze-drying lactobacillus7CCU/ parts) dosage under, be immunized after 28 days, specific sIgA antibody
Turn positive rate up to 70%, it is 100% that 42 days after being immunized, which turn positive rate, which is 62.9% to the protective rate of immune swine.
The aerosol vaccine prepared using dilution C is inoculated with 10 pigs (i.e. 1 × 10 in 1 bottle of freeze-drying lactobacillus7CCU/ parts) dosage
Under, 28 days after being immunized, specific sIgA antibody turns positive rate up to 70%, and it is 100% that 42 days after being immunized, which turn positive rate, the aerosol
Vaccine is 70.6% to the protective rate of immune swine.The aerosol vaccine prepared using dilution D, in 1 bottle of freeze-drying lactobacillus inoculation 10
Head pig (i.e. 1 × 107CCU/ parts) dosage under, 28 days after being immunized, specific sIgA antibody turns positive rate up to 80%, is immunized
Turning within 42 days positive rate afterwards is 100%, which is 68.3% to the protective rate of immune swine.The gas prepared using dilution E
Colloidal sol vaccine is inoculated with 10 pigs (i.e. 1 × 10 in 1 bottle of freeze-drying lactobacillus7CCU/ parts) dosage under, be immunized after 28 days, specificity
SIgA antibody turns positive rate up to 70%, and it is 100% that 42 days after being immunized, which turn positive rate, and aerosol vaccine is to the protective rate of immune swine
61.5%.And the aerosol vaccine for using control dilution 1 to prepare, 10 pigs (i.e. 1 × 10 are inoculated in 1 bottle of freeze-drying lactobacillus7CCU/
Head part) dosage under, 28 days after being immunized, the positive rate that turns of specific sIgA antibody is only 50%, turns within 42 days positive rates after immune and is
80%, the protective rate to immune swine is 47.2%.Therefore, the protective rate of the aerosol vaccine of dilution B, C, D, E preparation is higher.
It is weaker to the protective capability of 168 plants of vigor (embodiment 4) to compare dilution 1, it is also seen that control dilution 1 is made from table 4
Standby aerosol vaccine protective rate is lower, substantially less than the minimum requirements 60% of porcine mycoplasmal pneumonia vaccine protection efficiency evaluation.
The porcine mycoplasmal pneumonia aerosol live vaccine immune protective rate testing result that 4. different diluent of table is prepared
6 variety classes dilution of embodiment is to aerosol vaccine size distribution compared with activity difference
Dilution B is the aqueous solution containing following substance: ISCOM 1.0g/L, PEG6000 20g/L, cyclodextrin 2g/L,
Sodium thiosulfate 10g/L, L-Histidine 10g/L, pH value 7.2.
Dilution E is the aqueous solution containing following substance: Gel01 (French SEPPIC company) 10g/L, PEG6000 10g/
L, cyclodextrin 10g/L, sodium thiosulfate 20g/L, L-Histidine 10g/L, pH value 7.2.
Dilution F is the aqueous solution containing following substance: 50mg/L PolyI:C (being purchased from Invivogen), 50g/L
PEG6000,1g/L cyclodextrin, 5g/L sodium thiosulfate, 20g/L L-Histidine, pH value 7.6.
Compareing dilution 2 is the aqueous solution containing following substance: 50mg/L PolyI:C (being purchased from Invivogen), 10g/L
Gelatin, pH value 7.6.
Compareing dilution 3 is the aqueous solution containing following substance: 50mg/L PolyI:C (being purchased from Invivogen), 50g/L
Sucrose, pH value 7.6.
Dilution B, dilution E, dilution F, control dilution 2 and control dilution 3 respectively 1 bottle of pig lung of dissolution is respectively adopted
168 plants of freeze-drying lactobacillus of scorching mycoplasma, the additional amount of dilution is 20ml in every bottle of freeze-drying lactobacillus, that is, strain and dilution before being lyophilized
The volume ratio of liquid is 1:10.
6 kinds of different vaccine solutions for releasing liquid preparation are poured into ultrasonic atomizer atomization respectively, frequency of oscillation is
1.7MHz is detected the mean aerodynamic mass median of aerosol vaccination particles by droplet measurement method in embodiment 1 respectively
Partial size repeats three times.Simultaneously by activity test method in embodiment 1 detect respectively each diluent preparing at aerosol vaccine
The decline degree of titre after floating 30 minutes in air.
The result shows that the aerosol vaccine that dilution B is configured to, mean aerodynamic mass median partial size is 4.56 micro-
Rice, average geometric standard deviation are 1.84 (tables 5), 0.39 titre (table 6) of activity decline after being detained 30 minutes in air；It is dilute
The aerosol vaccine that liquid E is configured to is released, mean aerodynamic mass median partial size is 4.88 microns, average geometric standard deviation
For 1.68 (tables 5), 0.48 titre (table 6) of activity decline after being detained 30 minutes in air；The aerosol that dilution F is configured to
Vaccine, mean aerodynamic mass median partial size are 3.14 microns, and average geometric standard deviation is 1.38 (tables 5), in air
0.45 titre (table 6) of activity decline after middle delay 30 minutes；The aerosol vaccine being configured to, in mean aerodynamic quality
Position partial size is 4.26 microns, average geometric standard deviation 1.35 (table 5), activity decline 0.43 after being detained 30 minutes in air
Titre (table 6)；The aerosol vaccine prepared with control dilution 2, mean aerodynamic mass median partial size are 3.89 microns,
Average geometric standard deviation 1.54 (table 5), 2.06 titres (table 6) of activity decline after being detained 30 minutes in air；With control
The aerosol vaccine that dilution 3 is prepared, mean aerodynamic mass median partial size are 4.68 microns, average geometric standard deviation
1.88 (tables 5), 1.87 titres (table 6) of activity decline after being detained 30 minutes in air.Therefore, dilution B, E, F can be preferably
168 plants of protection of activity, after aerosol vaccine is detained 30min in air, loss of activity is smaller.2,3 pairs of dilution of control
168 plants of active protection ability is weaker, and after aerosol vaccine is detained 30min in air, loss of activity is larger.
The mean aerodynamic mass median partial size for the aerosol live vaccine that 5. different diluent of table is prepared
| Aerosol live vaccine used diluent | Aerosol live vaccine average quality median (MMAD ± GSD) |
| Dilution B | 4.56±1.84 |
| Dilution E | 4.88±1.68 |
| Dilution F | 3.14±1.38 |
| Compare dilution 2 | 3.89±1.54 |
| Compare dilution 3 | 4.68±1.88 |
The porcine mycoplasmal pneumonia aerosol live vaccine Activity determination result that 6. different diluent of table is prepared
The comparison of the different immunizing dose aerosol vaccine immunity protective rate differences of embodiment 7
Diluent A is the aqueous solution containing following substance: 0.1g/L chitosan (molecular weight 150KDa), 20g/
LPEG6000,2g/L cyclodextrin, 10g/L sodium thiosulfate, 10g/L L-Histidine, pH value 7.4.
Compare dilution 1: the deionized water solution containing 5% glycerol, 0.1% polyvinylpyrrolidone, pH value 7.5.
20 bottles of mycoplasma hyopneumoniaes, 168 plants of freeze-drying lactobacillus are taken, wherein 10 bottles are dissolved with 100ml diluent A, pour into ultrasonic mist
Change device atomization；Other 10 bottles are dissolved with 100ml control dilution 1, are added to medical lower respiratory tract appositional pattern sprayer (Germany hundred
It is auspicious) in be atomized, two kinds of atomization vaccines are immunized by method in 1 title 5 of embodiment, are attacked poison and are calculated and attack the protection after poison
Rate, the difference is that immunizing dose is 1 × 108CCU/ parts.
2 bottles of mycoplasma hyopneumoniaes, 168 plants of freeze-drying lactobacillus are taken, wherein 1 bottle is dissolved with 100ml diluent A, pour into ultrasonic atomizatio
Device atomization；Other 1 bottle is dissolved with 100ml control dilution 1, is added to medical lower respiratory tract appositional pattern sprayer (German Berry)
In be atomized, two kinds of atomization vaccines carry out immune and attack poison and calculate the protection after attacking poison by method in 1 title 5 of embodiment
Rate, wherein immunizing dose is 1 × 107CCU/ parts.
The result shows that (table 7), using diluent A and the aerosol vaccine made of Ultrasonic atomization method, in immunizing dose
It is 1 × 108When CCU/ parts, immune protective rate 75.6%；And when immunizing dose is 1 × 107When CCU/ parts, it is immunized
Protective rate is 65.0%.Using the control dilution 1 and aerosol vaccine with air blast made of, immunizing dose for 1 ×
108When CCU/ parts, immune protective rate 55.8%；And when immunizing dose is 1 × 107When CCU/ parts, immune protective rate
It is 47.2%.After which kind of dose immunization the aerosol vaccine made of air blast either uses, protective rate is not up to 60%.
The porcine mycoplasmal pneumonia aerosol live vaccine immune protective rate testing result of the different immunizing doses of table 7.
The detection of 8 aerosol vaccine immunity duration of embodiment
Diluent A is the aqueous solution containing following substance: 0.1g/L chitosan (molecular weight 150KDa), 20g/L
PEG6000,2g/L cyclodextrin, 10g/L sodium thiosulfate, 10g/L L-Histidine, pH value 7.4.
Dilution C is the aqueous solution containing following ingredients: CpG (sequence TCGTCGTTGTCGTTTTGTCGTT) 10mg/
L, PEG6000 20g/L, cyclodextrin 2g/L, sodium thiosulfate 10g/L, L-Histidine 10g/L, pH value 7.4.
Compare dilution 1: the deionized water solution containing 5% glycerol, 0.1% polyvinylpyrrolidone, pH value 7.5.
60 bottles of mycoplasma hyopneumoniaes, 168 plants of freeze-drying lactobacillus are taken, wherein 20 bottles are dissolved with 200ml diluent A, pour into ultrasonic mist
Change device atomization, 20 piglets are immunized by method in 1 title 5 of embodiment in frequency of oscillation 1.7MHz, immunizing dose for 1 ×
108CCU/ parts detect immune protective rate.Other 20 bottles are dissolved with 200ml dilution C, ultrasonic atomizer atomization are poured into, with same
The method of sample is immunized, and immunizing dose is 1 × 108CCU/ parts.Last 20 bottles are dissolved with 200ml control dilution 1, are added
It is atomized into medical lower respiratory tract appositional pattern sprayer (German Berry), immunizing dose is 1 × 108CCU/ parts.Respectively
4 months and 8 months after immune, poison is attacked by attacking malicious method progress in title 5 in embodiment 1 mycoplasma hyopneumoniae being virulent, and examine
Survey the protective rate to strong virus attack.
The result shows that (table 8), the aerosol vaccine prepared using diluent A, 4 months protective rates are after immune
70.8%；8 months protective rates are 64.3% after immune.As a result illustrate, aerosol vaccine made of diluent A, it is immune to hold
It renews at 8 months or more.The aerosol vaccine prepared using dilution C, 4 months protective rates are 64.3% after immune；?
8 months protective rates are 62.4% after immune.As a result illustrate, aerosol vaccine made of dilution C, immune duration is at 8
Month or more.The aerosol vaccine prepared using control dilution 1,4 months protective rates are 32.6% after immune；After immune
8 months protective rates are 11.5%, not up to immunoprotection standard.
8. porcine mycoplasmal pneumonia aerosol live vaccine immune duration testing result of table
Claims (7)
1. a kind of porcine mycoplasmal pneumonia aerosol live vaccine is to obtain after being atomized vaccine solution, which is characterized in that the epidemic disease
Seedling solution is obtained after mycoplasma hyopneumoniae low virulent strain is suspended in vaccine diluent；The vaccine diluent is containing as follows
The aqueous solution of ingredient: 10 ~ 50 g/L of Macrogol 6000,1 ~ 10 g/L of cyclodextrin, 5 ~ 20 g/L, L- group ammonia of sodium thiosulfate
Acid 10 ~ 20g/L, pH value 6.8-7.6.
2. porcine mycoplasmal pneumonia aerosol live vaccine according to claim 1, it is characterised in that in the vaccine diluent
Also contain mucosal adjuvant, the mucosal adjuvant be chitosan, Gel01, PolyI:C, E.coli LT, CpG,
The mixture of one or more of IL-12, ISCOM.
3. porcine mycoplasmal pneumonia aerosol live vaccine according to claim 2, it is characterised in that shell in the vaccine diluent
The concentration of glycan is 0.05-5g/L；The concentration of Gel01 is 1-30g/L, in the vaccine diluent in the vaccine diluent
The concentration of PolyI:C is 10-1000mg/L;The concentration of E.coli LT is 1- in the vaccine diluent
10mg/L;The concentration of CpG is 1-100mg/L in the vaccine diluent;The concentration of IL-12 is 0.1- in the vaccine diluent
The concentration of ISCOM is 0.1-1g/L in 5mg/L, the vaccine diluent.
4. porcine mycoplasmal pneumonia aerosol live vaccine according to claim 1 or claim 2, it is characterised in that the mycoplasma hyopneumoniae
Low virulent strain is 168 plants.
5. the preparation method of porcine mycoplasmal pneumonia aerosol live vaccine described in claim 4, which is characterized in that including following step
It is rapid:
(1) by the bacterium solution or dried frozen aquatic products of mycoplasma hyopneumoniae low virulent strain, porcine mycoplasmal pneumonia epidemic disease living is configured to vaccine diluent
Seedling solution；
(2) aerosol live vaccine is made by ultrasonic atomizatio method in the resulting porcine mycoplasmal pneumonia live vaccine solution of step (1)；Institute
The aerodynamic qualities median for stating aerosol live vaccine is 1-5 μm, and Effective Antigens concentration is not less than 50%.
6. the preparation method of porcine mycoplasmal pneumonia aerosol live vaccine according to claim 5, it is characterised in that the pig lung
The bacterium solution and vaccine diluent volume ratio of scorching mycoplasma low virulent strain are 1:1-100；The mycoplasma hyopneumoniae low virulent strain dried frozen aquatic products
It is 1:1-100 that the ratio between front volume and vaccine diluent volume, which is lyophilized,.
7. the preparation method of porcine mycoplasmal pneumonia aerosol live vaccine according to claim 6, it is characterised in that the ultrasound
Atomization plant used in atomization is the ultrasonic atomizer that frequency of oscillation is 1.7-2.4 MHz.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811160764.1A CN109045291B (en) | 2018-09-30 | 2018-09-30 | Aerosol live vaccine for swine mycoplasma pneumonia and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811160764.1A CN109045291B (en) | 2018-09-30 | 2018-09-30 | Aerosol live vaccine for swine mycoplasma pneumonia and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109045291A true CN109045291A (en) | 2018-12-21 |
| CN109045291B CN109045291B (en) | 2021-08-17 |
Family
ID=64767439
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811160764.1A Active CN109045291B (en) | 2018-09-30 | 2018-09-30 | Aerosol live vaccine for swine mycoplasma pneumonia and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109045291B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113599513A (en) * | 2020-10-23 | 2021-11-05 | 青岛大学 | Preparation method and inoculation method of novel coronavirus vaccine suitable for throat inoculation |
| CN114712336A (en) * | 2020-12-22 | 2022-07-08 | 黄嘉若 | Aqueous aerosol for pulmonary administration, preparation method and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1562367A (en) * | 2004-04-07 | 2005-01-12 | 复旦大学 | Mucous membrane immunizing agent of polyglycol-inactivated vaccine |
| CN101612122A (en) * | 2009-06-18 | 2009-12-30 | 江苏省农业科学院 | Atomization immunization method of pig attenuated vaccines |
| CN103157104A (en) * | 2011-12-14 | 2013-06-19 | 普莱柯生物工程股份有限公司 | Sodium thiosulfate diluent of swine fever vaccine |
| CN102764431B (en) * | 2012-08-03 | 2014-10-22 | 江苏省农业科学院 | Swine mycoplasmal pneumonia atomized live vaccine and preparation and inspection method thereof |
-
2018
- 2018-09-30 CN CN201811160764.1A patent/CN109045291B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1562367A (en) * | 2004-04-07 | 2005-01-12 | 复旦大学 | Mucous membrane immunizing agent of polyglycol-inactivated vaccine |
| CN101612122A (en) * | 2009-06-18 | 2009-12-30 | 江苏省农业科学院 | Atomization immunization method of pig attenuated vaccines |
| CN103157104A (en) * | 2011-12-14 | 2013-06-19 | 普莱柯生物工程股份有限公司 | Sodium thiosulfate diluent of swine fever vaccine |
| CN102764431B (en) * | 2012-08-03 | 2014-10-22 | 江苏省农业科学院 | Swine mycoplasmal pneumonia atomized live vaccine and preparation and inspection method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 付佳: "不同序列的CpG-ODN对禽流感H5N1灭活病毒鼻腔免疫效果的研究", 《万方数据知识服务平台》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113599513A (en) * | 2020-10-23 | 2021-11-05 | 青岛大学 | Preparation method and inoculation method of novel coronavirus vaccine suitable for throat inoculation |
| CN114712336A (en) * | 2020-12-22 | 2022-07-08 | 黄嘉若 | Aqueous aerosol for pulmonary administration, preparation method and application |
| CN114712336B (en) * | 2020-12-22 | 2023-11-07 | 黄嘉若 | Aqueous aerosol for pulmonary administration, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109045291B (en) | 2021-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103740625B (en) | A kind of mycoplasmal pneumonia of swine attenuated live vaccine and application thereof | |
| Feng et al. | Development and validation of an attenuated Mycoplasma hyopneumoniae aerosol vaccine | |
| CN107412943A (en) | A kind of soluble microneedle patch and preparation method thereof | |
| CN109045291A (en) | A kind of porcine mycoplasmal pneumonia aerosol live vaccine and preparation method thereof | |
| WO2015109578A1 (en) | Swine mycoplasmal pneumonia attenuated live vaccine and use thereof | |
| CN110801436B (en) | Porcine transmissible gastroenteritis and porcine epidemic diarrhea bivalent live vaccine freeze-drying protective agent and bivalent live vaccine | |
| CN106754762A (en) | A kind of antigen of encephalitis B live vaccine and preparation method and application | |
| AU2013351213B2 (en) | Vaccine to protect a ruminant against pneumonia caused by Pasteurella multocida | |
| CN111346222B (en) | Preparation method of plague attenuated live vaccine dry powder | |
| CN105497904B (en) | A kind of pseudorabies virus vaccine heat-resisting lyophilized protecting agent and preparation method thereof | |
| CN108969492A (en) | A kind of swine fever takes orally weak malicious freeze dried vaccine and preparation method thereof | |
| CN104096222B (en) | A kind of vaccine combination and its preparation method and application | |
| CN103784951B (en) | Prevent and treat antigen composition of respiratory disease of scabies secondary infection of pig and its preparation method and application | |
| CN107589256A (en) | The method of inspection of the type of Haemophilus parasuis 4,5 type bivalent inactivated vaccine effect | |
| CN104800842B (en) | A kind of goatpox, sheep pox divalence cell weak-toxic vaccine and its preparation method and application | |
| CN102764431B (en) | Swine mycoplasmal pneumonia atomized live vaccine and preparation and inspection method thereof | |
| CN104099269B (en) | Mycoplasma hyopneumoniae virulent strain and application thereof | |
| CN107338227B (en) | Bovine parainfluenza virus PBIV3-B strain and application thereof | |
| CN109010814A (en) | The production method of haemophilus parasuis and mycoplasma hyopneumoniae bivalent inactivated vaccine | |
| Hao et al. | Phenotypic characteristics and protective efficacy of an attenuated Mycoplasma hyopneumoniae vaccine by aerosol administration | |
| CN108938574A (en) | Heat resisting protective, preparation method and the usage is lyophilized in pseudorabies disease live-vaccine | |
| CN113577262B (en) | Heat-resistant protective agent, application of heat-resistant protective agent as poultry freeze-dried vaccine diluent, heat-resistant live vaccine for newcastle disease and preparation method of heat-resistant live vaccine | |
| CN108703952A (en) | A kind of swine fever takes orally weak malicious freeze dried vaccine freeze drying protectant and application | |
| CN111317723B (en) | Live vaccine freeze-drying protective agent for livestock and poultry | |
| CN116440282B (en) | Freeze-drying protective agent for live vaccine of infectious bronchitis and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |