CN109023536A - A kind of plant degradation group library constructing method - Google Patents
A kind of plant degradation group library constructing method Download PDFInfo
- Publication number
- CN109023536A CN109023536A CN201810682838.1A CN201810682838A CN109023536A CN 109023536 A CN109023536 A CN 109023536A CN 201810682838 A CN201810682838 A CN 201810682838A CN 109023536 A CN109023536 A CN 109023536A
- Authority
- CN
- China
- Prior art keywords
- minutes
- added
- test tube
- rna
- library
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Abstract
The invention discloses a kind of plant degradation group library constructing method, the recognition site containing Ecop15I enzyme in 5 ' RNA connectors, by Ecop15I digestion, library inserts length is 27 bases, and 5 ' RNA joint sequences are GUUCAGAGUUCUACAGUCCGACGA UCAGCAGWherein underscore part is the identification sequence of EcoP15I enzyme, the cochain of double-stranded DNA joint sequence: 5 ' NNTGGAATT CTCGGGTGCCAAGG 3 ', lower chain: 5 ' CCTTGGCACCCGAGA ATTCCA 3 ', due to the change of 5 ' RNA joint sequences and double-stranded DNA joint sequence, constructed plant degradation group library can be sequenced using Illumina TruSeq tiny RNA library sequencing approach, therefore be sequenced simple and easy to do.
Description
Technical field
The invention belongs to technical field of molecular biology, and in particular to a kind of plant degradation group library constructing method.
Background technique
MicroRNA (miRNA) be in eucaryote with important regulating and controlling function a kind of microRNA (Yu Y etc.,
The'how'and'where'of plant microRNAs.The New Phytologist,2017,216(4):1002-
1017).There is close to contact for growth, development, metabolism and the biology and abiotic stress of Mirnas of plant and plant
(Sunkar R etc., Functions of microRNAs in plant stress responses.Trends in Plant
Science 2012,17(4):196-203).MiRNA need to be played a role by regulating and controlling its target gene, and Mirnas of plant regulates and controls with it
Target gene mRNA have perfect or near perfect complementary pairing relationship, and mainly to mediate target gene mRNA at miRNA pairs
The mode being sheared between the 10-11 bit base answered is regulated and controled (Xie M etc., microRNA to target gene
biogenesis,degradation and activity in plants.Cellular and molecular life
science,2015,72(1):87-99).Therefore, the analysis to Mirnas of plant target gene and verifying are that research miRNA function must
Indispensable a part.Target gene can pass through bioinformatics method (Ding J etc., Finding MicroRNA Targets
in Plants:Current Status and Perspectives.Genomics Proteomics Bioinformatics,
2012,10 (5): 264-275) it is predicted, however, it is still necessary to just can confirm that by experimental verification for the target gene theoretically predicted.
RLM-5'RACE (RNA ligase-mediated 5'rapid amplification of cDNA ends) (Llave C etc.,
Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis
MiRNA.Science, 2002,297 (5589): being 2053-2056) classical way for verifying miRNA target gene.Its principle is
The target gene mRNA that miRNA is mediated can generate 2 segments (5' shears segment and 3' shearing segment) when being degraded, wherein 3' is sheared
Segment is more stable, there is exposed a 5' monophosphate group and polyA tail.Connected at 5' phosphate group with RNA ligase
Connect a RNA connector, through reverse transcription, PCR, clone and sequencing, then can determine testing gene whether the target gene for being miRNA
(Llave C etc., Cleavage of Scarecrow-like mRNA targets directed by a class of
Arabidopsis miRNA.Science,2002,297(5589):2053–2056).RLM-5'RACE is for verifying a small number of targets
It is very useful when gene, however the disadvantage is that be able to validate only a target gene every time, it is then time-consuming when to verify a large amount of target genes
Arduously.And degradation group sequencing (degradome sequencing) then combines RLM-5'RACE, high-flux sequence and biology letter
The advantage of credit analysis is ceased, piece can be sheared in 3' of the entire transcript profile level to the mRNA mediated of miRNA in cell or tissue
Duan Jinhang depth analysis, therefore be most practical, the most efficient technological means for studying miRNA target gene.
2008, two laboratory (Addo-Quaye C etc., Endogenous siRNA and miRNA targets
identified by sequencing of the Arabidopsis degradome.Current biology,2008,18
(10):758-762；German MA etc., Global identification of microRNA-target RNA pairs
By parallel analysis of RNA ends.Nat Biotechnol, 2008,26:941-946) almost use simultaneously
Similar method has carried out building, sequencing and analysis to the degradation group library of arabidopsis.Its principle is with RNA ligase in 3'
It shears and connects a RNA connector, the identification of the end the 3' restrictive restriction endonuclease MmeI of the RNA connector at the 5' phosphate group of segment
Site.CDNA is obtained through reverse transcription and carries out PCR simply expand, digestion then is carried out to PCR product with MmeI, is obtained containing 5'
The double-stranded segment of 20 bases of connector and downstream, then this segment is connect with 3' double-stranded DNA connector and carries out PCR amplification, through pure
Change and obtains degradation group library (German MA etc., Construction of Parallel Analysis of RNA Ends
(PARE)libraries for the study of cleaved miRNA targets and the RNA
Degradome.Natture protocols, 2008,4 (8): 356-362) (Figure 1A).The library is using Illumina company
High-flux sequence method is sequenced, and can only survey a library every time.Although when with Illumina upgrading instrument HiSeq sequencing
The sequence fragment number arrived is more, but cost also increases accordingly.(Zhai J etc., Rapid the construction of such as Zhai
parallel analysis of RNA end(PARE)libraries for Illumina sequencing.Methods,
2014,67 (1): 84-90) technology is further improved, index sequence is introduced into different libraries (Figure 1B), therefore can
It is sequenced after multiple degradation groups library is mixed.This is the common method that degradation group library uses so far.2009, Addo-Quaye
Degradation group library is constructed using Ecop15I etc. a kind of method is devised, it is high-throughput using Applied Biosystems SOLiD
Target gene (Addo-Quaye etc., Sliced microRNA the targets and of sequencing technologies research small liwan moss miRNA
precise loop-first processing of MIR319hairpins revealed by analysis of the
Physcomitrella patens degradome.RNA 2009,15:2112-2121).The advantage of this method is that: building
Library inserts be 27 bases, than being positioned using long 7 bases of MmeI method, therefore for the comparison of sequencing fragment
It can be more acurrate.But Applied Biosystems SOLiD sequencing approach is general far away from illumina company Hi-seq sequencing approach
Time, therefore, this method is not used widely.
Inventor herein seminar uses initial and improved degradation group library constructing method to rice (Li YF
Deng Transcriptome-wide identification of microRNA targets in rice.The Plant
Journal, 2010,62 (5): 742-759), wheat (Li YF etc., Characterization of small RNAs and
their target genes in wheat seedlings using sequencing-based approaches.Plant
Sci 203-204:17-24) miRNA target gene studied, it was found that a large amount of target genes.It is believed that this method
Still have following deficiency, need further improvement, concrete reason is as follows: a, the sequencing of degradation group are difficult.Improved degradation group
Although library is sequenced after can mixing multiple libraries, the 5'RNA connector due to degradation group library 5'RNA connector than tiny RNA library
Lack 5 bases, therefore (Zhai J etc., Rapid must be sequenced with primer using degradation group library spy
construction of parallel analysis of RNA end(PARE)libraries for Illumina
sequencing.Methods,2014,67(1):84-90).This self-built library of library system user, Illumina company do not have
For the kit of this kind of library sequencing, therefore most of biotechnology sequencing companies do not know about the library sequencing approach, because
This, the sequencing of degradation group library faces problems.B, sequencing fragment is accurately positioned difficult.Some segments can navigate to multiple target genes
On, therefore miRNA can not be determined to the regulation degree of these target genes；In addition, degradation group library can be used for identifying the production of miRNA
Raw mode and identification (Li YF etc., Transcriptome-wide identification of microRNA for being used for miRNA
targets in rice.The Plant journal,2010,62(5):742–759).We have found that a large amount of sequencing fragments can
Be positioned at the initiation site of miRNA or miRNA*, since Insert Fragment length only has 20 bases, and majority miRNA or
MiRNA* length is 21-22 base, only poor 1-2 base, these sequencing fragments can not be determined originating from miRNA/miRNA*
3' terminal adenosineization be also derived from miRNA generate during DCL1 digestion intermediate product, only pass through cumbersome experiment
Verifying just can determine that the source of these sequences.If several bases more than Insert Fragment ratio miRNA/miRNA* length, will have significantly
Help the research of miRNA mechanism of production.Therefore, as can constructing a kind of degradation group library both can solve that Insert Fragment is short to ask
Topic, and degradation group library can be sequenced using Illumina existing sequencing kit, not only to researcher's precise positioning
The target gene and target site of miRNA, the producing method for inquiring into miRNA Regulation Mechanism and miRNA is helpful, and can make to give birth to
The sequencing of object technology company becomes more simple and easy to do.At present both at home and abroad there is not yet being able to satisfy the degradation group building side of above-mentioned requirements
Method.
Summary of the invention
The technical problem to be solved by the present invention is to provide a kind of plant degradation group library constructing method, technical points include
New 5'RNA connector, design new 3 ' double-stranded DNA connectors and final library PCR amplification primer are designed to change.Using new method structure
The degradation group library size built is 150bp, and Insert Fragment length is 27 bases, solves the problems, such as that current library is short.Furthermore
The plant degradation group library of this method building can directly adopt Illumina TruSeq tiny RNA library sequencing kit and be surveyed
Sequence.The degradation group library (see Fig. 2) of arabidopsis, rice and wheat is successfully constructed using this new method, and to rice
Sequencing analysis has been carried out with the degradation group library of wheat, it was demonstrated that the technology is feasible.
The present invention adopts the following technical scheme that solve above-mentioned technical problem, a kind of plant degradation group library constructing method,
It is characterized by: the recognition site containing Ecop15I enzyme in 5 ' RNA connectors, by Ecop15I digestion, library inserts length
For 27 bases, 5 ' RNA joint sequences are GUUCAGAGUUCUACAGUCCGACGAUCAGCAG, wherein underscore part be
The identification sequence of EcoP15I enzyme, the cochain of double-stranded DNA joint sequence: 5 ' NNTGGAATTCTCGGGTGCCAAGG 3 ', lower chain:
5 ' CCTTGGCACCCGAGAATTCCA3 ', due to the change of 5 ' RNA joint sequences and double-stranded DNA joint sequence, constructed plant
Object degradation group library can be sequenced using Illumina TruSeq tiny RNA library sequencing approach.
Compared to existing degradation group library construction techniques, technical advantage of the invention is as follows:
(1) sequencing approach is simple and easy to do.The progress of tiny RNA library sequencing approach can be used in the degradation group library of this method building
Sequencing.Both it is sequenced after different degradation groups library being mixed, is sequenced after can also being mixed with tiny RNA library.And original degradation
Group library is sequenced after can not mixing with tiny RNA library, and spy is needed individually to be sequenced with primer.Even if encountering degradation group library
Index is identical as the index in tiny RNA library, can be according to the distinctive AGCAG sequence in the end degradation group sequence 5' by the two after sequencing
It distinguishes.
(2) length of Insert Fragment becomes 27 bases from 20 original bases in library, therefore reads positioning is more quasi-
Really.The technology can not only analyze the target gene of miRNA, while can also analyze the intermediate product in miRNA forming process,
Therefore help to study the formation mechenism of miRNA.
Detailed description of the invention
Fig. 1 is plant degradation group library construction schematic diagram in the prior art；
Fig. 2 is plant degradation group library construction schematic diagram of the present invention；
Fig. 3 is 1wt% agarose gel electrophoresis figure (10 μ L PCR amplifications 15 circulation) after cDNA amplification；
Fig. 4 be after EcoP15I digestion with double-stranded DNA connector connection product 12wt% polyacrylamide gel figure, square generation
Table cuts glue region, which is SYBRTMGold nucleic acid gel stain coloration result；
Fig. 5 is 8wt% polyacrylamide gel figure after the enrichment of degradation group library, and arrow represents library fragments；
Fig. 6 is AgilentBioanalyzer detection degradation group library size and quality, and the peak of 150bp is degradation group text
Library；
Fig. 7 is each site base contents analysis in degradation group library, and preceding 5 base AGCAG are derived from 5 ' RNA joint sequences, raw
It needs to cut off when object bioinformatics analysis；
Fig. 8 is that original method and our method sequence positioning compare, and originally method (above) can not determine connector institute
Refer to that the base of position 20 (dash area in middle figure) derives from rice MIR160a or MIR160b, and library length becomes 27
(middle figure underscore part) can distinguish the sequence from MIR160a and MIR160b after base (following figure arrow is signified)；
Fig. 9 be after EcoP15I digestion with double-stranded DNA connector connection product 12wt% polyacrylamide gel figure, square generation
Table cuts glue region, which is SYBRTMGold nucleic acid gel stain coloration result；
Figure 10 is 8wt% polyacrylamide gel figure after the enrichment of degradation group library, and arrow represents library fragments；
Figure 11,12 are AgilentBioanalyzer detection degradation group library size and quality, and the peak of 150bp is to degrade
Group library.
Specific embodiment
Above content of the invention is described in further details by the following examples, but this should not be interpreted as to this
The range for inventing above-mentioned theme is only limitted to embodiment below, and all technologies realized based on above content of the present invention belong to this hair
Bright range.
Main agents and enzyme:
Reagent(Invitrogen,Catalog no.15596-026).
RNaseOutTM(Invitrogen, Cat.No.10777-019)
SuperScriptTMII Reverse Transcriptase (Invitrogen, Cat No.18064)
Taq DNA Polymerase High Fidelity (Invitrogen, Cat
No.11304011).
EcoP15I(New England Biolabs,Cat No.R0646S).
phenol/chloroform/iso-amyl alcohol(25:24:1).
T4DNA ligase(Invitrogen,Cat No.15224-017).
T4RNA ligase (New England biolabs, Cat No.M0204S)
Glycogen(Invitrogen,Cat No.10814-010).
PCR purification kit(QIAGEN,Cat No.28004).
Connector and primer information:
5 ' RNA connectors: 5 ' GUUCAGAGUUCUACAGUCCGACGAUCAGCAG, 3 '
Oligo (dT) reverse transcription primer: 5 ' CGAGCACAGAATTAATACGAC (T)18V 3’.
5 ' adapter-primers: 5 ' GTTCAGAGTTCTACAGTCCGAC, 3 '
3 ' adapter-primers: 5 ' CGAGCACAGAATTAATACGACT, 3 '
Double-stranded DNA connector: cochain: 5 ' NNTGGAATTCTCGGGTGCCAAGG 3 '；Lower chain: 5 '
CCTTGGCACCCGAGAATTCCA 3’.
Amplified library primer 1 (RP1):
AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA.
Amplified library primer 2: 3 ' PCR primers, Index 1-24. of TruSeq tiny RNA library
Technical step:
Degradation group library construction process includes the purifying of plant mRNA, the connection of 5'RNA connector, reverse transcription, the expansion of first time PCR
Increase, EcoP15I digestion, the connection of double-stranded DNA connector, first time polyacrylamide gel isolates and purifies connection product, degradation group
Library is enriched with (second of PCR amplification), and second of polyacrylamide gel isolates and purifies degradation group library, the quality inspection and survey in library
Sequence analyzes (Fig. 2).Its building process in detail is as follows:
1. the purifying of plant mRNA
The extraction of 1.1 plant total serum IgEs:
UsingReagent (invitrogen, Catalog no.15596-026) extracts total serum IgE, Qi Tafang
Method can also, it is desirable that extracts high quality total serum IgE, degradation problem is not present in RNA.
The purifying of 1.2 plant mRNA:
Utilize Poly (A) PuristTMMAG Kit (Invitrogen, catalog No.AM1922) is purified from total serum IgE
mRNA.100-500 μ g total serum IgE is diluted with water to 600 μ g/mL, mRNA purifying is carried out according to the method in kit, by mRNA
It is dissolved in 11.5 μ L DEPC water.
The connection of 2.5'RNA connector
1.5 μ L 5'RNA adaptor (100 μM) are uniformly mixed with 11.5 μ L mRNA, test tube is placed in 65 DEG C of water-baths 5
After minute, test tube is placed in 2 minutes on ice rapidly, low-speed centrifugal collects liquid to tube bottom.It is mixed on ice with following ingredients, it will
Test tube is placed in 37 DEG C and connects 1 hour.
Connection after reaction, adds 80 μ L DEPC water, adds 100 μ L phenol: chloroform: isoamyl alcohol, and oscillation mixes,
14000rpm is centrifuged 2 minutes, and about 100 μ L of test tube upper solution (water phase) is transferred in 1.5 milliliters of new centrifuge tubes, is added
Then 10 μ L 3M sodium acetates, 5.2,1 μ L 10mg/mL glycogen of pH plus 220 μ L volume fraction, 95% alcohol and are mixed,
In 4 DEG C of centrifugations, 30 minutes (14000rpm) after test tube is placed in -80 DEG C of refrigerators 30 minutes, supernatant is abandoned, 500 μ L volumes are added
70% ethanol wash of score precipitating, concussion mixes, in 4 DEG C of centrifugations, 10 minutes (14000rpm).Supernatant is carefully abandoned, will be tried
Pipe dissolves RNA precipitate in drying at room temperature 1-2 minutes, with 20 μ L DEPC water.
3.mRNA reverse transcription
2 μ L dNTPs (10mM) and 2 μ L oligo (dT) reverse transcriptions are added in the above-mentioned test tube for connecting 5 ' RNA connectors
Above-mentioned test tube is placed in 65 DEG C of water-baths 5 minutes by primer (50 μM), is placed in 2 minutes and low-speed centrifugal on ice.Then be added 8 μ L5 ×
First Strand Buffer, 4 μ L0.1M DTT, 1 μ L RNaseOutTM (40U/ μ L), mix, and low-speed centrifugal is placed in 42 DEG C
After heat preservation 2 minutes, 3 μ L SuperScriptTMII RTase (200U/ μ L) are added, mix, low-speed centrifugal is placed in 42 DEG C of heat preservations
50 minutes.Then 70 DEG C of termination reverse transcriptions in 15 minutes.
4.PCR amplification and purifying
4.1PCR amplification: it usesTaq DNA Polymerase High Fidelity carries out PCR amplification, instead
It should be as follows:
Above-mentioned PCR mixed liquor is dispensed into 2 PCR pipes, every 50 μ L of pipe.PCR amplification condition: 94 DEG C, 2 minutes；94 DEG C,
30 seconds, 60 DEG C, 30 seconds, 72 DEG C, 5 minutes；7 circulations.
4.2PCR product purification: according to the purifying procedure pair of MinElute PCR Purification Kit (QIAGEN)
Above-mentioned 100 μ L PCR sample is purified, and is finally eluted with water twice, every time 10 μ L, and eluent is merged.
5.EcoP15I digestion, the connection of double-stranded DNA connector and product purification
5.1EcoP15I digestion
Digestion is carried out to the PCR product of above-mentioned purifying using the EcoP15I of New England Biolabs.
Above-mentioned each ingredient is uniformly mixed, after low-speed centrifugal in 37 DEG C endonuclease reaction 1 hour.Then test tube is placed in 65 DEG C
It is 20 minutes, cooling in room temperature.
5.2 connection double-stranded DNA connectors
1) prepared by connector: each 10 μ L of the upper chain and the lower chain (100 μM) of double-stranded DNA connector being mixed, 100 DEG C of heat preservation 5min
Afterwards, room temperature is cooling.
2) connection reaction: according to the form below mixes each ingredient, connects 1 hour in room temperature.
6. polyacrylamide gel separates connection product
It is separated using the polyacrylamide gel of 12wt%.12 6 × DNA of μ L are added in connection reaction solution
Loading buffer is mixed, and is added in 2-3 well；Simultaneously in the well of connection sample two sides, 0.5 μ g is added
20bp DNA ladder.0.5 × TBE, 160V electrophoresis 60min are added in electrophoresis tank.Glue taking-up is carefully placed in clean plastic casing
In, 0.5 × TBE (just flooding glue is advisable) and 2 μ L ethidium bromide is added (according to SYBRTM Gold
Nucleic acid gel stain, Invitrogen, S11494, better effect), dyeing is observed after five minutes and cuts glue.
During dyeing, hole is pricked from 0.5mL test tube mouth to bottom of the tube with syringe needle, is then placed in the 0.5mL test tube
It is spare in 2mL test tube.It is imaged with gel imaging system, glue of the size between 70-90bp is cut with clean blade, is put into
In ready 0.5mL test tube.Above-mentioned casing is centrifuged 2 minutes in room temperature 14000rpm, it is ensured that all glue have all passed through tube bottom
Afterwards, 0.5mL test tube is abandoned.It is added 300 μ L sterile waters in 2mL test tube, shaken at room temperature at least 2 hours or 4 DEG C of shaken overnights.
14000rpm is centrifuged 2 minutes, and water phase is transferred in 1.5mL test tube, and 1 μ L Glycogen, 30 μ L 3M sodium acetates, 660 μ are added
100% ethyl alcohol of L volume fraction mixes, is placed in -80 DEG C of refrigerators 30 minutes.It is small after (4 DEG C) of low temperature centrifugations 30 minutes (14000rpm)
The heart abandons supernatant.It is precipitated with 500 μ L volume fraction, 80% ethanol wash DNA, 14000rpm is centrifuged 5 minutes, careful to abandon
Clear liquid dissolves precipitating DNA with 37.8 μ L water by test tube in drying at room temperature 1-5 minutes.
7. the enrichment of degradation group library and purifying
With amplified library primer andTaq DNA Polymerase High Fidelity carries out PCR amplification
Enrichment.
PCR amplification condition: 94 DEG C, 2 minutes；94 DEG C, 30 seconds, 60 DEG C, 30 seconds, 72 DEG C, 30 seconds；10-15 circulation.
8. degradation group library purifies
It is separated using the polyacrylamide gel of 8wt%.10 μ L6 × DNA loading are added in PCR pipe
Buffer is mixed, is added in 2 wells；0.5 μ g 50bp DNA is respectively added in the well of sample two sides simultaneously
ladder.120V electrophoresis 50min.Subsequent dyeing (ethidium bromide) cuts glue, elution and precipitating with step 6.
Precipitating DNA, as degradation group library are dissolved with 15 μ L water.
9. library quality inspection and sequencing analysis
Library Quality is detected using Agilent Bioanalyzer.Degradation group library sequencing approach and ILLUMINA tiny RNA
Library sequencing approach is identical.It is sequenced after different degradation groups library being mixed, is sequenced after can also being mixed with tiny RNA library.Gained
Sequence needs the 5 base AGCAG that will be originated to remove before bioinformatic analysis.
Embodiment 1: degradation group library is constructed by material of OryzasativaLcv.Nipponbare rice leaves
1. the purifying of plant mRNA
The extraction of 1.1 plant total serum IgEs:
UsingReagent (invitrogen, Catalog no.15596-026) extracts total serum IgE
1) 1mL TRIzol is added in the EP pipe marked, is put into drawing materials in mortar, is quickly filled in liquid nitrogen
Divide grinding.The ground material of 0.1g is added in above-mentioned EP pipe, oscillation is uniformly mixed, and is stored at room temperature 5 minutes.
2) 0.2mL chloroform (chloroform) is added, vibrates 15 seconds, is stored at room temperature 2-3 minutes.
3) it 4 DEG C, 12000rpm, is centrifuged 15 minutes, upper strata aqueous phase (450-500 μ L) is transferred to a new RNase-
In Free EP pipe, isometric isopropanol is added, is mixed by inversion, with standing 10 minutes on ice.
4) it 4 DEG C, 12000rpm, is centrifuged 10 minutes, abandons supernatant, the ethanol washing precipitating of 1mL volume fraction 75% is added.
5) it 4 DEG C, 12000rpm, is centrifuged 3 minutes, abandons supernatant, be stored at room temperature 2-3 minutes, dry, 30 μ L DEPC water are added,
Sufficiently dissolution RNA.
6) the RNA sample concentration extracted using Nanodrop measurement；RNA sample is detected with 1wt% agarose gel electrophoresis
Quality.
The purifying of 1.2 plant mRNA:
Utilize Poly (A) PuristTMMAG Kit (Invitrogen, catalog No.AM1922) is purified from total serum IgE
mRNA。
1) 500 μ g total serum IgEs are diluted with water to 600 μ g/mL, the 2 × Binding isometric with total serum IgE is added
Solution, i.e. 830 μ l.
2) prepare Oligo (dT) MagBeads: every 100 μ g RNA needs 10 μ l Beads；Every 10 μ l Beads needs to add
The Wash Solution 1 for entering 50 μ l is washed, and takes 50 μ l Beads, and the Wash Solution 1 that 250 μ l are added is placed on magnet stand
Precipitate B eads abandons supernatant, repeats primary.
3) 1) solution in is added in the beads of step 2), 65 DEG C heating water bath 5 minutes.It shaken at room temperature 60 minutes, puts
It is precipitated on magnet stand, supernatant is transferred back to former pipe is placed in and save on ice.
4) it is separately added into 830 μ l Wash Solution 1 and Wash Solution 2 to wash twice, method is same as above.
5) the 200 μ l of RNA Storage Solution of 65 DEG C of preheatings is added, mixes on elution postposition magnetic frame, it will be upper
It is transferred to clearly in clean EP pipe, repeats elution once, merge supernatant.
6) 40 μ l 5M ammonium acetates, 1 μ l Glycogen, 1mL volume fraction, 100% ethyl alcohol, in -80 are added in supernatant
DEG C overnight precipitation.
7) 14000 × g 4 DEG C, is centrifuged 30 minutes, inhales and abandon supernatant；75% ethanol washing of 1mL volume fraction is added, be vortexed vibration
It swings, 14000 × g, 4 DEG C, is centrifuged 30 minutes, inhale and abandon supernatant.
8) above-mentioned precipitating is dissolved in 11.5 μ L DEPC water.
2. 5'RNA connector connects
By 1.5 μ L 5'RNA adaptor (100 μM), it is uniformly mixed with 11.5 μ L mRNA.Test tube is placed in 65 DEG C of water-baths
After five minutes, test tube is placed in 2 minutes on ice rapidly, low-speed centrifugal collects liquid to tube bottom.It is mixed on ice with following ingredients,
Test tube is placed in 37 DEG C to connect 1 hour.
Connection after reaction, adds 80 μ L DEPC water, adds 100 μ L phenol: chloroform: isoamyl alcohol, and oscillation mixes,
14000rpm is centrifuged 2 minutes, and about 100 μ L of test tube upper solution (water phase) is transferred in 1.5 milliliters of new centrifuge tubes, is added
Then 10 μ L 3M sodium acetates, 5.2,1 μ L 10mg/mL glycogen of pH plus 220 μ L volume fraction, 95% alcohol and are mixed.
Test tube is placed in -80 DEG C of refrigerators 30 minutes；In 4 DEG C of centrifugations, 30 minutes (14000rpm), supernatant is abandoned, 500 μ L volumes are added
70% ethanol wash of score precipitating, concussion mixes, in 4 DEG C of centrifugations, 10 minutes (14000rpm).Supernatant is carefully abandoned, will be tried
Pipe dissolves RNA precipitate in drying at room temperature 1-2 minutes, with 20 μ L DEPC water
3.mRNA reverse transcription
2 μ L dNTPs (10mM) and 2 μ L oligodT are added in the above-mentioned test tube for connecting RNA adaptor
Above-mentioned test tube is placed in 65 DEG C of water-baths 5 minutes by adaptor primer (50 μM), is placed in 2 minutes and low-speed centrifugal on ice, will be following
Ingredient is added in above-mentioned test tube, mixes, low-speed centrifugal, is placed in 42 DEG C and keeps the temperature 2 minutes.
Add 3 μ L SuperScriptTMII RTase (200U/ μ L) is mixed, low-speed centrifugal, is placed in 42 DEG C of heat preservations 50
Minute.Then 70 DEG C of termination reverse transcriptions in 15 minutes.
4.PCR amplification and purifying
4.1PCR amplification:
WithTaq DNA Polymerase High Fidelity carries out PCR amplification, reacts as follows:
Above-mentioned PCR mixed liquor is dispensed into 2 PCR pipes, every 50 μ L of pipe.PCR amplification condition: 94 DEG C, 2 minutes；94 DEG C,
30 seconds, 60 DEG C, 30 seconds, 72 DEG C, 5 minutes；7 circulations.
4.2PCR product purification:
According to the purifying procedure of MinElute PCR Purification Kit (QIAGEN) to above-mentioned 100 μ L PCR sample
Product are purified, and are finally eluted with water twice, every time 10 μ L, merge eluent.
5.EcoP15I digestion, the connection of double-stranded DNA connector and product purification
5.1EcoP15I digestion
Digestion is carried out to the PCR product of above-mentioned purifying using the EcoP15I of New England Biolabs.
Above-mentioned each ingredient is uniformly mixed, after low-speed centrifugal in 37 DEG C endonuclease reaction 1 hour.Then test tube is placed in 65 DEG C
It is 20 minutes, cooling in room temperature.
5.2 connection double-stranded DNA connectors
1) prepared by connector:
Each 10 μ L of the upper chain and the lower chain (100 μM) of double-stranded DNA connector is mixed, after 100 DEG C of heat preservation 5min, room temperature is cooling.
2) connection reaction: according to the form below mixes an ingredient, connects 1 hour in room temperature.
6. polyacrylamide gel separates connection product
It is separated using the polyacrylamide gel of 12wt%.12 μ L6 × DNA are added in connection reaction solution
Loading buffer is mixed, is added in 2 wells；Meanwhile 0.5 μ g 20bp DNA ladder is added to connection sample
In the well on product both sides.0.5 × TBE, 160V electrophoresis 60min are added in electrophoresis tank.Glue taking-up is carefully placed in clean plastics
In box, 0.5 × TBE (just flooding glue is advisable) and 2 μ L ethidium bromide is added (according to SYBRTM Gold
Nucleic acid gel stain, Invitrogen, S11494, better effect), it dyes 5 minutes.
During dyeing, hole is pricked from 0.5mL test tube mouth to bottom of the tube with syringe needle, then sets the 0.5mL test tube
In in 2mL test tube.It is imaged with gel imaging system, glue of the size between 70-90bp is cut with clean blade, is put into standard
In the 0.5mL test tube got ready.Above-mentioned casing is centrifuged 2 minutes in room temperature 14000rpm, it is ensured that after all glue have all passed through tube bottom,
Abandon 0.5mL test tube.It is added 300 μ L sterile waters in 2mL test tube, shaken at room temperature at least 2 hours or 4 DEG C of shaken overnights.
14000rpm is centrifuged 2 minutes, and filtrate is transferred in 1.5mL test tube, and 1 μ L Glycogen, 30 μ L 3M sodium acetates, 660 μ are added
100% ethyl alcohol of L volume fraction mixes, is placed in -80 DEG C of refrigerators 30 minutes.It is small after (4 DEG C) of low temperature centrifugations 30 minutes (14000rpm)
The heart abandons supernatant.It is precipitated with 500 μ L volume fraction, 80% ethanol wash DNA, 14000rpm room temperature is centrifuged 5 minutes, is carefully lost
Supernatant is abandoned, by test tube in drying at room temperature 1-5 minutes, dissolves precipitating DNA with 37.8 μ L water.
7. the enrichment of degradation group library and purifying
With amplified library primer andTaq DNA Polymerase High Fidelity carries out PCR amplification
Enrichment.
PCR amplification condition: 94 DEG C, 2 minutes；94 DEG C, 30 seconds, 60 DEG C, 30 seconds, 72 DEG C, 30 seconds；15 circulations.
8. degradation group library purifies
It is separated using the polyacrylamide gel of 8wt%.10 μ L6 × DNA loading are added in PCR pipe
Buffer is mixed, is added in 2 wells；Meanwhile 0.5 μ g 50bp DNA ladder is added to sample two sides.120V electricity
Swim 50min.Subsequent dyeing (ethidium bromide) cuts glue (segment for cutting 150bp or so), elution and precipitating
Ibid.Precipitating DNA, as degradation group library are dissolved with 15 μ L water.
9. library quality inspection and sequencing analysis
Library Quality is detected using Agilent Bioanalyzer.Degradation group library sequencing approach and Illumina tiny RNA
Library sequencing approach is identical.
10. experimental result
Experimental result is shown in Fig. 3-8.
Embodiment 2: degradation group library is constructed using wheat leaf and apical meristem as material
1. the purifying of plant mRNA
The extraction of 1.1 plant total serum IgEs:
UsingReagent (invitrogen, Catalog no.15596-026) extracts total serum IgE
1) 1mL TRIzol is added in the EP pipe marked, is put into drawing materials in mortar, is quickly filled in liquid nitrogen
Divide grinding.The ground material of 0.1g is added in above-mentioned EP pipe, oscillation is uniformly mixed, and is stored at room temperature 5 minutes.
2) 0.2mL chloroform (chloroform) is added, vibrates 15 seconds, is stored at room temperature 2-3 minutes.
3) it 4 DEG C, 12000rpm, is centrifuged 15 minutes, upper strata aqueous phase (450-500 μ L) is transferred to a new RNase-
In Free EP pipe, isometric isopropanol is added, is mixed by inversion, with standing 10 minutes on ice.
4) it 4 DEG C, 12000rpm, is centrifuged 10 minutes, abandons supernatant, the ethanol washing precipitating of 1mL volume fraction 75% is added.
5) it 4 DEG C, 12000rpm, is centrifuged 3 minutes, abandons supernatant, be stored at room temperature 2-3 minutes, dry, 30 μ L DEPC water are added,
Sufficiently dissolution RNA.
6) the RNA sample concentration extracted using Nanodrop measurement；RNA sample is detected with 1wt% agarose gel electrophoresis
Quality.
The purifying of 1.2 plant mRNA:
Utilize Poly (A) PuristTMMAG Kit (Invitrogen, catalog No.AM1922) is purified from total serum IgE
mRNA。
1) 500 μ g total serum IgEs are diluted with water to 600 μ g/mL, the 2 × Binding isometric with total serum IgE is added
Solution, i.e. 830 μ l.
2) prepare Oligo (dT) MagBeads: every 100 μ g RNA needs 10 μ l Beads；Every 10 μ l Beads needs to add
The Wash Solution 1 for entering 50 μ l is washed, and takes 50 μ l Beads, and the Wash Solution 1 that 250 μ l are added is placed on magnet stand
Precipitate B eads abandons supernatant, repeats primary.
3) 1) solution in is added in the beads of step 2), 65 DEG C heating water bath 5 minutes.It shaken at room temperature 60 minutes, puts
It is precipitated on magnet stand, supernatant is transferred back to former pipe is placed in and save on ice.
4) it is separately added into 830 μ l Wash Solution 1 and Wash Solution 2 to wash twice, method is same as above.
5) the 200 μ l of RNA Storage Solution of 65 DEG C of preheatings is added, mixes on elution postposition magnetic frame, it will be upper
It is transferred to clearly in clean EP pipe, repeats elution once, merge supernatant.
6) 40 μ l 5M ammonium acetates, 1 μ l Glycogen, 1mL volume fraction, 100% ethyl alcohol, in -80 are added in supernatant
DEG C overnight precipitation.
7) 14000 × g 4 DEG C, is centrifuged 30 minutes, inhales and abandon supernatant；75% ethanol washing of 1mL volume fraction is added, be vortexed vibration
It swings, 14000 × g, 4 DEG C, is centrifuged 30 minutes, inhale and abandon supernatant.
8) above-mentioned precipitating is dissolved in 11.5 μ L DEPC water.
The connection of 2.5'RNA connector
By 1.5 μ L 5'RNA adaptor (100 μM), it is uniformly mixed with 11.5 μ L mRNA.Test tube is placed in 65 DEG C of water-baths
After five minutes, test tube is placed in 2 minutes on ice rapidly, low-speed centrifugal collects liquid to tube bottom.It is mixed on ice with following ingredients,
Test tube is placed in 37 DEG C to connect 1 hour.
Connection after reaction, adds 80 μ L DEPC water, adds 100 μ L phenol: chloroform: isoamyl alcohol, and oscillation mixes,
14000rpm is centrifuged 2 minutes, and about 100 μ L of test tube upper solution (water phase) is transferred in 1.5 milliliters of new centrifuge tubes, is added
Then 10 μ L 3M sodium acetates, 5.2,1 μ L 10mg/mL glycogen of pH plus 220 μ L volume fraction, 95% alcohol and are mixed.
Test tube is placed in -80 DEG C of refrigerators 30 minutes；In 4 DEG C of centrifugations, 30 minutes (14000rpm), supernatant is abandoned, 500 μ L volumes are added
70% ethanol wash of score precipitating, concussion mixes, in 4 DEG C of centrifugations, 10 minutes (14000rpm).Supernatant is carefully abandoned, will be tried
Pipe dissolves RNA precipitate in drying at room temperature 1-2 minutes, with 20 μ L DEPC water
3.mRNA reverse transcription
2 μ L dNTPs (10mM) and 2 μ L oligodT are added in the above-mentioned test tube for connecting RNA adaptor
Above-mentioned test tube is placed in 65 DEG C of water-baths 5 minutes by adaptor primer (50 μM), is placed in 2 minutes and low-speed centrifugal on ice, will be following
Ingredient is added in above-mentioned test tube, mixes, low-speed centrifugal, is placed in 42 DEG C and keeps the temperature 2 minutes.
Add 3 μ L SuperScriptTMII RTase (200U/ μ L) is mixed, low-speed centrifugal, is placed in 42 DEG C of heat preservations 50
Minute.Then 70 DEG C of termination reverse transcriptions in 15 minutes.
4.PCR amplification and purifying
4.1PCR amplification:
WithTaq DNA Polymerase High Fidelity carries out PCR amplification, reacts as follows:
Above-mentioned PCR mixed liquor is dispensed into 2 PCR pipes, every 50 μ L of pipe.PCR amplification condition: 94 DEG C, 2 minutes；94 DEG C,
30 seconds, 60 DEG C, 30 seconds, 72 DEG C, 5 minutes；7 circulations.
4.2PCR product purification:
According to the purifying procedure of MinElute PCR Purification Kit (QIAGEN) to above-mentioned 100 μ L PCR sample
Product are purified, and are finally eluted with water twice, every time 10 μ L, merge eluent.
5.EcoP15I digestion, the connection of double-stranded DNA connector and product purification
5.1EcoP15I digestion
Digestion is carried out to the PCR product of above-mentioned purifying using the EcoP15I of New England Biolabs.
Above-mentioned each ingredient is uniformly mixed, after low-speed centrifugal in 37 DEG C endonuclease reaction 1 hour.Then test tube is placed in 65 DEG C
It is 20 minutes, cooling in room temperature.
5.2 connection double-stranded DNA connectors
3) prepared by connector:
Each 10 μ L of the upper chain and the lower chain (100 μM) of double-stranded DNA connector is mixed, after 100 DEG C of heat preservation 5min, room temperature is cooling.
4) connection reaction: according to the form below mixes an ingredient, connects 1 hour in room temperature.
6. polyacrylamide gel separates connection product
It is separated using the polyacrylamide gel of 12wt%.12 6 × DNA of μ L are added in connection reaction solution
Loading buffer is mixed, is added in 2 wells；Meanwhile 0.5 μ g 20bp DNA ladder is added to connection sample
In the well on product both sides.0.5 × TBE, 160V electrophoresis 60min are added in electrophoresis tank.Glue taking-up is carefully placed in clean plastics
In box, 0.5 × TBE (just flooding glue is advisable) and 2 μ L ethidium bromide is added (according to SYBRTMGold
Nucleic acid gel stain, Invitrogen, S11494, better effect), it dyes 5 minutes.
During dyeing, hole is pricked from 0.5mL test tube mouth to bottom of the tube with syringe needle, then sets the 0.5mL test tube
In in 2mL test tube.It is imaged with gel imaging system, glue of the size between 70-90bp is cut with clean blade, is put into standard
In the 0.5mL test tube got ready.Above-mentioned casing is centrifuged 2 minutes in room temperature 14000rpm, it is ensured that after all glue have all passed through tube bottom,
Abandon 0.5mL test tube.It is added 300 μ L sterile waters in 2mL test tube, shaken at room temperature at least 2 hours or 4 DEG C of shaken overnights.
14000rpm is centrifuged 2 minutes, and filtrate is transferred in 1.5mL test tube, and 1 μ L Glycogen, 30 μ L 3M sodium acetates, 660 μ are added
100% ethyl alcohol of L volume fraction mixes, is placed in -80 DEG C of refrigerators 30 minutes.It is small after (4 DEG C) of low temperature centrifugations 30 minutes (14000rpm)
The heart abandons supernatant.It is precipitated with 500 μ L volume fraction, 80% ethanol wash DNA, 14000rpm room temperature is centrifuged 5 minutes, is carefully lost
Supernatant is abandoned, by test tube in drying at room temperature 1-5 minutes, dissolves precipitating DNA with 37.8 μ L water.
7. the enrichment of degradation group library and purifying
With amplified library primer andTaq DNA Polymerase High Fidelity carries out PCR amplification
Enrichment.
PCR amplification condition: 94 DEG C, 2 minutes；94 DEG C, 30 seconds, 60 DEG C, 30 seconds, 72 DEG C, 30 seconds；15 circulations.
8. degradation group library purifies
It is separated using the polyacrylamide gel of 8wt%.10 μ L6 × DNA loading are added in PCR pipe
Buffer is mixed, is added in 2 wells；Meanwhile 0.5 μ g 50bp DNA ladder is added to sample two sides.120V electricity
Swim 50min.Subsequent dyeing (ethidium bromide) cuts glue (segment for cutting 150bp or so), elution and precipitating
Ibid.Precipitating DNA, as degradation group library are dissolved with 15 μ L water.
9. library quality inspection and sequencing analysis
Library Quality is detected using Agilent Bioanalyzer.Degradation group library sequencing approach and Illumina tiny RNA
Library sequencing approach is identical.
10. experimental result
Experimental result is shown in Fig. 9-12.
Embodiment above describes basic principles and main features of the invention and advantage, the technical staff of the industry should
Understand, the present invention is not limited to the above embodiments, and the above embodiments and description only describe originals of the invention
Reason, under the range for not departing from the principle of the invention, various changes and improvements may be made to the invention, these changes and improvements are each fallen within
In the scope of protection of the invention.
Sequence table
<110>He'nan Normal University
<120>a kind of plant degradation group library constructing method
<141> 2018-06-27
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 31
<212> RNA
<213> artificial chromosome
<400> 1
guucagaguu cuacaguccg acgaucagca g 31
<210> 2
<211> 19
<212> RNA
<213> artificial chromosome
<400> 2
cgagcacaga aaaacgaca 19
<210> 3
<211> 16
<212> RNA
<213> artificial chromosome
<400> 3
gcagagcaca gccgac 16
<210> 4
<211> 18
<212> RNA
<213> artificial chromosome
<400> 4
cgagcacaga aaaacgac 18
<210> 5
<211> 22
<212> RNA
<213> artificial chromosome
<400> 5
acgacgggaa ccggggccaa gg 22
<210> 6
<211> 17
<212> RNA
<213> artificial chromosome
<400> 6
ccggcacccg agaacca 17
<210> 7
<211> 40
<212> RNA
<213> artificial chromosome
<400> 7
aagaacggcg accaccgaga cacacgcaga gcacagccga 40
Claims (2)
1. a kind of plant degradation group library constructing method, it is characterised in that: the identification position in 5 ' RNA connectors containing Ecop15I enzyme
Point, by Ecop15I digestion, library inserts length is 27 bases, and 5 ' RNA joint sequences are
GUUCAGAGUUCUACAGUCCGACGAUCAGCAG, wherein underscore part is the identification sequence of EcoP15I enzyme, and double-stranded DNA connects
The cochain of header sequence: 5 ' NNTGGAATTCTCGGGTGCCAAGG 3 ', lower chain: 5 ' CCTTGGCACCCGAGAATTCCA 3 ', by
In the change of 5 ' RNA joint sequences and double-stranded DNA joint sequence, constructed plant degradation group library can use Illumina
TruSeq tiny RNA library sequencing approach is sequenced.
2. plant degradation group library constructing method according to claim 1, it is characterised in that specific steps are as follows:
1. the purifying of plant mRNA
The extraction of 1.1 plant total serum IgEs:
UsingReagent extracts total serum IgE；
The purifying of 1.2 plant mRNA:
Utilize Poly (A) PuristTMMAG Kit purifies mRNA from total serum IgE, and 100-500 μ g total serum IgE is diluted with water to 600 μ
G/mL carries out mRNA purifying according to the method in kit, mRNA is dissolved in 11.5 μ L DEPC water；
The connection of 2.5'RNA connector
The 5'RNA adaptor that 1.5 μ L molar concentrations are 100 μM is uniformly mixed with 11.5 μ L mRNA, test tube is placed in 65 DEG C
Test tube after five minutes, is placed in 2 minutes on ice rapidly by water-bath, and low-speed centrifugal collects liquid to tube bottom, is mixed on ice with following ingredients
It closes, test tube is placed in 37 DEG C and is connected 1 hour；
Connection after reaction, adds 80 μ L DEPC water, adds 100 μ L phenol: chloroform: isoamyl alcohol, and oscillation mixes, 14000rpm from
The heart 2 minutes, 100 μ L of test tube upper solution is transferred in a new 1.5mL centrifuge tube, adding 10 μ L molar concentrations is the vinegar of 3M
Acid sodium solution, 5.2,1 μ L 10mg/mL glycogen of pH, then plus 220 μ L volume fractions are 95% alcohol and mix, and will be tried
Pipe is centrifuged 30 minutes after being placed in -80 DEG C of refrigerators 30 minutes in 4 DEG C, abandons supernatant, and the alcohol that 500 μ L volume fractions are 70% is added
Washing precipitating, concussion mix, and are centrifuged 10 minutes, supernatant are abandoned, by test tube in drying at room temperature 1-2 minutes, with 20 μ L in 4 DEG C
DEPC water dissolves RNA precipitate；
3.mRNA reverse transcription
DNTPs that 2 μ L molar concentrations are 10mM is added in the above-mentioned test tube for connecting 5 ' RNA connectors and 2 μ L molar concentrations are
50 μM oligo (dT) reverse transcription primer, is placed in 65 DEG C of water-baths 5 minutes for above-mentioned test tube, be placed on ice 2 minutes and low speed from
Then 8 μ 5 × First of L Strand Buffer, 4 μ L 0.1M DTT, 1 μ L 40U/ μ L RNaseOut is added in the heartTM, it mixes,
3 μ L 200U/ μ L SuperScript are added after being placed in 42 DEG C of heat preservations 2 minutes in low-speed centrifugalTMII RTase, mix, low speed from
The heart is placed in 42 DEG C and keeps the temperature 50 minutes, then 70 DEG C of termination reverse transcriptions in 15 minutes；
4.PCR amplification and purifying
4.1PCR amplification: it usesTaq DNA Polymerase High Fidelity carries out PCR amplification, reacts as follows:
Above-mentioned PCR mixed liquor is dispensed into 2 PCR pipes, every 50 μ L of pipe, PCR amplification condition: 94 DEG C, 2 minutes；94 DEG C, 30
Second, 60 DEG C, 30 seconds, 72 DEG C, 5 minutes；7 circulations；
4.2PCR product purification: according to the purifying procedure of MinElute PCR Purification Kit to above-mentioned 100 μ L PCR
Sample is purified, and is finally eluted with water twice, every time 10 μ L, merges eluent；
5.EcoP15I digestion, the connection of double-stranded DNA connector and product purification
5.1 EcoP15I digestions
Digestion is carried out to the PCR product of above-mentioned purifying using the EcoP15I of New England Biolabs；
Above-mentioned each ingredient is uniformly mixed, after low-speed centrifugal in 37 DEG C endonuclease reaction 1 hour, test tube is then placed in 65 DEG C 20 points
Clock, it is cooling in room temperature；
5.2 connection double-stranded DNA connectors
1) prepared by connector: 100 μM of upper chain and the lower chain of double-stranded DNA connector each 10 μ L are mixed, after 100 DEG C of heat preservation 5min, and room temperature
It is cooling；
2) connection reaction: according to the form below mixes each ingredient, connects 1 hour in room temperature；
6. polyacrylamide gel separates connection product
It is separated using the polyacrylamide gel of 12wt%, 12 μ 6 × DNA of L loading is added in connection reaction solution
Buffer is mixed, and is added in 2-3 well；Simultaneously in the well of connection sample two sides, 0.5 μ g 20bp DNA is added
Ladder adds 0.5 × TBE, 160V electrophoresis 60min in electrophoresis tank, and glue taking-up is placed in clean plastic casing, it is added 0.5 ×
TBE and 2 μ L ethidium bromide, dyeing are observed after five minutes and cut glue；
During dyeing, hole is pricked from 0.5mL test tube mouth to bottom of the tube with syringe needle, the 0.5mL test tube is then placed in 2mL examination
It is spare in pipe, it is imaged with gel imaging system, glue of the size between 70-90bp is cut with clean blade, is put into preparation
In good 0.5mL test tube, above-mentioned casing is centrifuged 2 minutes in room temperature 14000rpm, it is ensured that after all glue have all passed through tube bottom, lose
0.5mL test tube is abandoned, is added 300 μ L sterile waters in 2mL test tube, shaken at room temperature at least 2 hours or 4 DEG C of shaken overnights,
14000rpm is centrifuged 2 minutes, and water phase is transferred in 1.5mL test tube, and it is molten that 1 μ L Glycogen, the sodium acetate of 30 μ L 3M is added
Liquid, 660 μ L volume fractions be 100% ethyl alcohol, mix, be placed in -80 DEG C of refrigerators 30 minutes, 4 DEG C of low temperature centrifugation 30 minutes after lose
Supernatant is abandoned, is precipitated with the ethanol wash DNA that 500 μ L volume fractions are 80%, 14000rpm is centrifuged 5 minutes, supernatant is abandoned,
By test tube in drying at room temperature 1-5 minutes, precipitating DNA is dissolved with 37.8 μ L water；
7. the enrichment of degradation group library and purifying
With amplified library primer andTaq DNA Polymerase High Fidelity carries out PCR amplification enrichment；
PCR amplification condition: 94 DEG C, 2 minutes；94 DEG C, 30 seconds, 60 DEG C, 30 seconds, 72 DEG C, 30 seconds；10-15 circulation；
8. degradation group library purifies
It is separated using the polyacrylamide gel of 8wt%, 10 μ 6 × DNA of L loading is added in PCR pipe
Buffer is mixed, is added in 2 wells；0.5 μ g 50bp DNA is respectively added in the well of sample two sides simultaneously
Ladder, 120V electrophoresis 50min, subsequent dyeing cut glue, elution and precipitating with step 6, and dissolving precipitating DNA with 15 μ L water is
For plant degradation group library.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810682838.1A CN109023536A (en) | 2018-06-28 | 2018-06-28 | A kind of plant degradation group library constructing method |
| CN201811557992.2A CN109457299A (en) | 2018-06-28 | 2018-12-19 | A kind of plant degradation group library constructing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810682838.1A CN109023536A (en) | 2018-06-28 | 2018-06-28 | A kind of plant degradation group library constructing method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109023536A true CN109023536A (en) | 2018-12-18 |
Family
ID=65520695
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810682838.1A Withdrawn CN109023536A (en) | 2018-06-28 | 2018-06-28 | A kind of plant degradation group library constructing method |
| CN201811557992.2A Pending CN109457299A (en) | 2018-06-28 | 2018-12-19 | A kind of plant degradation group library constructing method |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811557992.2A Pending CN109457299A (en) | 2018-06-28 | 2018-12-19 | A kind of plant degradation group library constructing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN109023536A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109750031A (en) * | 2019-02-22 | 2019-05-14 | 河南师范大学 | Using the library constructing method of high throughput sequencing technologies detection transcription initiation site |
| WO2020132844A1 (en) * | 2018-12-25 | 2020-07-02 | 中国医学科学院基础医学研究所 | Small rna medicament for prevention and treatment of inflammation-related diseases and combination thereof |
| CN116904445A (en) * | 2023-09-12 | 2023-10-20 | 南京诺唯赞生物科技股份有限公司 | mRNA enrichment method |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5866330A (en) * | 1995-09-12 | 1999-02-02 | The Johns Hopkins University School Of Medicine | Method for serial analysis of gene expression |
| CN100584957C (en) * | 2003-05-09 | 2010-01-27 | 岩手县 | Use of a type III restriction enzyme to isolate identification tags comprising more than 25 nucleotides |
| CN107075513B (en) * | 2014-09-12 | 2020-11-03 | 深圳华大智造科技有限公司 | Isolated oligonucleotides and their use in nucleic acid sequencing |
| US10301605B2 (en) * | 2014-11-26 | 2019-05-28 | Wisconsin Alumni Research Foundation | Poly(UG) polymerase, constructs, and methods of making and using the same |
| US10655170B2 (en) * | 2016-07-06 | 2020-05-19 | Takara Bio Usa, Inc. | Coupling adaptors to a target nucleic acid |
-
2018
- 2018-06-28 CN CN201810682838.1A patent/CN109023536A/en not_active Withdrawn
- 2018-12-19 CN CN201811557992.2A patent/CN109457299A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020132844A1 (en) * | 2018-12-25 | 2020-07-02 | 中国医学科学院基础医学研究所 | Small rna medicament for prevention and treatment of inflammation-related diseases and combination thereof |
| CN114729354A (en) * | 2018-12-25 | 2022-07-08 | 中国医学科学院基础医学研究所 | Small RNA medicine for preventing and treating inflammatory related diseases and combination thereof |
| CN109750031A (en) * | 2019-02-22 | 2019-05-14 | 河南师范大学 | Using the library constructing method of high throughput sequencing technologies detection transcription initiation site |
| CN116904445A (en) * | 2023-09-12 | 2023-10-20 | 南京诺唯赞生物科技股份有限公司 | mRNA enrichment method |
| CN116904445B (en) * | 2023-09-12 | 2023-12-29 | 南京诺唯赞生物科技股份有限公司 | mRNA enrichment method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109457299A (en) | 2019-03-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3146046B1 (en) | Haploidome determination by digitized transposons | |
| Morozova et al. | Applications of next-generation sequencing technologies in functional genomics | |
| EP3529374B1 (en) | Sequencing and analysis of exosome associated nucleic acids | |
| EP1922420B1 (en) | METHOD AND SUBSTANCES FOR ISOLATING miRNAs | |
| US20100035249A1 (en) | Rna sequencing and analysis using solid support | |
| CN109457299A (en) | A kind of plant degradation group library constructing method | |
| US11505824B2 (en) | Direct RNA nanopore sequencing with help of a stem-loop reverse polynucleotide | |
| Sanchez-Diaz et al. | Post-transcription meets post-genomic: the saga of RNA binding proteins in a new era | |
| US20200149036A1 (en) | Methods to distinguish rna and dna in a combined preparation | |
| US20220333186A1 (en) | Method and system for targeted nucleic acid sequencing | |
| CN107636163A (en) | For building the composition and method of chain specific cDNA libraries | |
| Guria et al. | Circular RNA profiling by Illumina sequencing via template-dependent multiple displacement amplification | |
| AU2022202281A1 (en) | Preparation Of Nucleic Acid Libraries From RNA And DNA | |
| US20220213469A1 (en) | Methods and compositions for barcoding nucleic acid libraries and cell populations | |
| CN109750031A (en) | Using the library constructing method of high throughput sequencing technologies detection transcription initiation site | |
| EP3896170A1 (en) | Method for identifying 2'-o-methylation modification in rna molecule, and application thereof | |
| CN115369115A (en) | Methods for reducing circular RNA levels | |
| CN114250224B (en) | Nucleic acid composition for extracting or detecting small-molecule RNA in sample, kit and method thereof | |
| WO2016127345A1 (en) | Method for constructing and sequencing small rna library | |
| KR101990216B1 (en) | Method for small RNA isolation | |
| Guria et al. | Research Article Circular RNA Profiling by Illumina Sequencing via Template-Dependent Multiple Displacement Amplification | |
| Lu et al. | Identification of full-length circular nucleic acids using long-read sequencing technologies | |
| WO2022271725A1 (en) | Detecting crispr genome modification on a cell-by-cell basis | |
| WO2022243437A1 (en) | Sample preparation with oppositely oriented guide polynucleotides | |
| Erhard Jr | Alternative polymerase genome regulation in Zea mays |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20181218 |