CN109022580A - A kind of dog circular rna gene as dog Diagnosis of Breast Tumor marker - Google Patents
A kind of dog circular rna gene as dog Diagnosis of Breast Tumor marker Download PDFInfo
- Publication number
- CN109022580A CN109022580A CN201810858765.7A CN201810858765A CN109022580A CN 109022580 A CN109022580 A CN 109022580A CN 201810858765 A CN201810858765 A CN 201810858765A CN 109022580 A CN109022580 A CN 109022580A
- Authority
- CN
- China
- Prior art keywords
- dog
- breast
- circular rna
- rna
- rna gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of dog circular rna gene, the nucleotide sequence of the dog circular rna gene is as shown in SEQ ID NO.1.The nucleotide sequence of the detection primer of the dog circular rna gene is as shown in NO.2~3 SEQ ID.The present invention has obtained a new dog circular rna gene, gene differential expression in dog breast tumor tissues and cancer beside organism, and the expression quantity in dog breast tumor tissues is substantially less than cancer beside organism, can be used as a kind of diagnosis marker of dog tumor of breast.The detection primer detection effect of the dog circular rna gene is accurate, can be used for the diagnosis detection of dog tumor of breast, has a good application prospect in terms of the prevention and control of dog tumor of breast.
Description
Technical field
The present invention relates to dog Diagnosis of Breast Tumor technical fields, are used as dog Diagnosis of Breast Tumor more particularly, to a kind of
The dog circular rna gene of marker.
Background technique
Dog tumor of breast (Canine mammary tumor) is common a kind of disease of dog, complex genesis, morbidity
Mechanism is still not clear.The disease incidence of tumor of breast accounts for about the 1/2 of all tumours of bitch.Although the disease incidence phase of female cat tumor of breast
To lower, but tumor of breast is also the third major class kinds of tumor of cat.Tumor of breast is female dog common clinical disease, few hair in
Male dogs.The dog about tumor of breast of 30%-50% is pernicious, and cat then reaches 90%.In China, which is mainly in
Capital bar dog, Shih Tzu, German shepherd, rich U.S. dog.Age of onset focuses mostly at 8-10 years old or so, does not give birth to, non-sterilization, has vacation
The dog of pregnant history and daily ration based on meat is multiple.Happening part is mostly single mammary gland morbidity, is concentrated mainly on right side breast and a left side
Below right inguinal mammary glands, suffers from dog estradiol and progesterone level is higher.
Many studies have shown that circular rna (circRNA) is related with the occurrence and development of tumour.But there is no bright
The direct relation that true circular rna (circRNA) and dog tumor of breast occur.The common method of the screening of differential gene is high-throughput
Sequencing technologies and biochip technology.Meanwhile high-flux sequence is the prefered method of the new circRNA of discovery.But it may
There is the problem of false positive and false negative, so the sequencing result to acquisition still needs RT-qPCR and NB(Northern
Blot it) is further verified.But Northern Blot method program is complicated and sensitivity is low, is not suitable for clinical sample
Detection, therefore most suitably used detection method is RT-qPCR method.
Therefore, lack a kind of method that can promptly and accurately diagnose dog tumor of breast based on RT-qPCR now.
Summary of the invention
It is a kind of as dog Diagnosis of Breast Tumor marker the purpose of the invention is to overcome the deficiencies of the prior art and provide
Dog circular rna gene.
The first purpose of the invention is to provide a kind of dog circular rna genes.
A second object of the present invention is to provide the detection primers of the dog circular rna gene.
Third object of the present invention is to provide dog circular rna gene the answering as dog Diagnosis of Breast Tumor marker
With.
Fourth object of the present invention is to provide the detection primer or detection described above of dog circular rna gene described above
Application of the primer in preparation dog Diagnosis of Breast Tumor kit.
Fifth object of the present invention is to provide the kits of a dog Diagnosis of Breast Tumor.
To achieve the goals above, the present invention is achieved by the following technical programs:
Inventor has found a new rna gene closely related with dog tumor of breast occurrence and development, in dog tumor of breast group
It knits and is substantially less than cancer beside organism with differential expression in cancer beside organism, the expression quantity in dog breast tumor tissues, can be used as one
The diagnosis marker of kind dog tumor of breast.
Therefore claimed a kind of dog circular rna gene, nucleotide sequence is as shown in SEQ ID NO. 1.
The position of the dog circular rna gene is chr13-62685728-62729175+.
The detection primer of above-described dog circular rna gene, the detection primer can detecte dog circular rna gene and exist
The abundance in sample is detected, protection scope of the present invention is also belonged to.
The detection primer of above-described dog circular rna gene, the nucleotide sequence of the detection primer such as SEQ ID
NO. shown in 2~3, protection scope of the present invention is also belonged to.
Application of the dog circular rna gene described above as dog Diagnosis of Breast Tumor marker.
Application of the detection primer described above in preparation dog Diagnosis of Breast Tumor kit.
A kind of kit of dog Diagnosis of Breast Tumor, the kit contain detection primer described above.
Preferably, the kit also contains quantitative fluorescent PCR reagent.
Preferably, the quantitative fluorescent PCR reagent is SYBR Green I.
Preferably, the reaction system of kit are as follows: ddH26 I Master of μ L, SYBR Green of O 10 μ L, PCR
1 μ L, PCR Reverse Primer of Forward Primer, 1 μ L, cDNA template, 2 μ L.
Preferably, the reaction condition of kit: 95 DEG C of 1min, 1 circulation；95 DEG C of 10s, 60 DEG C of 10s, 72 DEG C of 10s,
45 circulations；95 DEG C of 5s, 65 DEG C of 1min, 1 circulation；97 DEG C of preservations.Compared with prior art, the present invention has following beneficial
Effect:
The present invention has obtained a new dog circular rna gene, gene difference in dog breast tumor tissues and cancer beside organism
Expression, the expression quantity in dog breast tumor tissues are substantially less than cancer beside organism, can be used as a kind of diagnosis of dog tumor of breast
Marker.The detection primer detection effect of the dog circular rna gene is accurate, can be used for the diagnosis detection of dog tumor of breast,
It is had a good application prospect in terms of the prevention and control of dog tumor of breast.
Detailed description of the invention
Fig. 1 is the design of primers schematic diagram of circular rna；The primer that blue arrow indicates is used for specific detection circular rna,
The primer that black arrow indicates is used for specific detection linear rna.
Fig. 2 is gene chr13-62685728-62729175+ melting curve and amplification curve.
Fig. 3 is reference gene ACTB melting curve and amplification curve.
Fig. 4 is that difference circular rna expresses variation tendency in sequencing sample.
Fig. 5 is difference circular rna detection of expression in sequencing sample.
Fig. 6 is chr13-62685728-62729175+ expression quantity inspection in different dog breast tumor cells and its culture solution
It surveys.
Fig. 7 is gene expression amount situation of change before and after RNaseR enzymatic treatment.
Fig. 8 is gene chr13-62685728-62729175+ sequencing result.
Fig. 9 is tissue specificity testing result.
Figure 10 is the difference analysis that difference circular rna is expressed in tumor tissues and cancer beside organism in 14 clinical samples.
Figure 11 is chr13-62685728-62729175+ in 14 clinical samples by dog breast tumor tissues and tumour
Expression quantity detection in tissue.
Figure 12 is chr13-62685728-62729175+ in 9 clinical samples in dog breast tumor tissues and health tissues
The difference analysis of middle expression.
Figure 13 is the expression quantity testing result of chr13-62685728-62729175+ in 9 clinical samples.
Specific embodiment
The present invention is made with specific embodiment with reference to the accompanying drawings of the specification and further being elaborated, the embodiment
It is served only for explaining the present invention, be not intended to limit the scope of the present invention.Test method as used in the following examples is such as without spy
Different explanation, is conventional method；Used material, reagent etc., unless otherwise specified, for the reagent commercially obtained
And material.
Sample source:
This experiment, which is selected, carries out the dog tumor of breast case treated and through definitive pathological diagnosis in Guangzhou pets hospital, and sterile working is stayed
It takes part of cancerous tissue and Carcinoma side normal tissue (apart from cancerous tissue 2cm or so) to be sub-packed in cryopreservation tube, is immediately placed in Liquid nitrogen storage.Institute
There is the affected animal pathological diagnosis through senior pathologist, is not suffering from other tumours before being included in this research, and without radiation or chemical drugs
Object treatment.Clinical stages, classifies according to WHO staging scale, after liver histopathological analysis, has chosen 3 malignant galactophores
The cancerous tissue and Carcinoma side normal tissue of tumor cases are studied.
Main agents:
TRIZOL reagent is purchased from Takara company；Chloroform, isopropanol, 75% ethyl alcohol, DEPC water etc. are domestic analysis net product；
Reverse transcription reagent box is purchased from Takara company；Real-time PCR kit is purchased from Roche company.
Key instrument and equipment:
Superclean bench (SuZhou Antai Air Tech Co., Ltd.), thermostat water bath (the permanent Science and Technology Ltd. in Shanghai one), height
Fast room temperature centrifuge (U.S. Thermo), high speed freezing refrigerated centrifuge (German Eppendorf), vortex oscillator (Germany
IKA), LightCycler480 fluorescence quantitative PCR instrument (U.S. Roche), electronic analytical balance (FA1604 type Shanghai day level
Device factory), 4 DEG C of refrigerators (middle section's U.S. water chestnut), -80 DEG C of refrigerators (middle section's U.S. water chestnut), refiners (French Bertin Technologie).
Inventor has found a gene chr13-62685728- closely related with dog tumor of breast occurrence and development
62729175+, this experiment use RT-qPCR method to the detection of dog tumor of breast difference circRNA, pass through special design of primers
And its debugging, the spy of optimization and solubility curve analysis and cDNA amplified production through reverse transcription being sequenced to realize circular rna
Opposite sex expression.In addition, select in experimental group and control group stablize expression ACTB as internal reference to destination gene expression amount into
Row standardization.The experimental results showed that dog tumor of breast difference circRNA difference table in dog breast tumor tissues and cancer beside organism
It reaches.
Specific research method and result are as follows:
The acquisition of 1 dog circular rna gene of embodiment
Dog breast cancer tissue and cancer beside organism are acquired, a new shape relevant to dog breast cancer is had found by high-flux sequence
Rna gene, nucleotide sequence is as shown in SEQ ID NO. 1.
The design and synthesis of 2 primer of embodiment
Each 200bp base of its nucleotide sequence head and the tail of the sequence as shown in SEQ ID NO. 1 is spliced, and wherein end 200bp makees
For spliced first sequence；The base sequence newly spliced is subjected to design of primers with the primer-blast of NCBI, parameter is by mark
Standard is chosen；When choosing primer pair, PCR product includes the site back-splicing；It is cyclized site, primer is on both sides.
Design principle are as follows:
(1) length of primer is generally the bp of 15 bp~25.
(2) G/C content of primer sequence is generally 40%~60%.The G/C content of upstream and downstream primer cannot differ too big.
(3) quantitative pcr amplification product length is in 200 bp or so.
Gene chr13-62685728-62729175+(SEQ ID NO. 1) design of primers step as shown in Figure 1, will
The synthesis of designed primer commission one Hui Yuan bioengineering Co., Ltd of day.The primer of design expanded according to amplification efficiency
Increase specificity further to be screened, finally obtain the best primer sequence of expanding effect are as follows:
F::TGCAACGGTGACAATAGCTC(SEQ ID NO.2)；
R:GAGGTCTTCTGTTCCCAAGG(SEQ ID NO.3).
Embodiment 3 organizes the synthesis of extracting, the Quality Control and cDNA of RNA
One, experimental implementation
(1) extracting of tissue RNA
1, tissue homogenate
Every 50-100mg tissue sample is put into the processed homogenate tube of high pressure sterilization after being shredded with sterilizing scissors, and 1 ml is added
TRIZOL reagent, with tissue refiner's disrupting tissue.
2, two-phase laminated flow (histocyte)
Sample was in incubation at room temperature 5 minutes after homogenate, so that nucleic acid-protein complex will be completely dissociated.The TRIZOL reagent of every 1 ml is even
The chloroform of 0.2ml is added in the sample of slurry, covers tightly pipe lid.It is acutely incubated at room temperature 2 to 3 minutes after oscillation tube body 15 seconds manually.4
12,000 × g is centrifuged 15 minutes at DEG C.Mixing liquid is classified into the red phenol chloroform phase of lower layer, middle layer core upper layer after centrifugation
Colourless water phase.RNA is all distributed in water phase.The volume of water phase about makes the TRIZOL reagent being added when homogenate
60%。
3, RNA precipitate
Water phase is transferred in new centrifuge tube.It is every that water phase, which mixes with isopropanol and the amount of isopropanol is added to precipitate RNA therein,
The isopropanol for adding 0.5ml at this time of 1ml TRIZOL reagent is added when a sample homogenization.Be incubated at room temperature after mixing after ten minutes, in
4 DEG C of 12,000 × g are centrifuged 10 minutes.Sightless RNA precipitate will form glue in bottom of the tube and side wall before being centrifuged at this time
Precipitate block.
4, RNA is cleaned
Supernatant is removed, 75% ethyl alcohol of at least 1ml is added in the sample of every 1mlTRIZOL reagent homogenate, cleans RNA precipitate.Vibration
After swinging, 4 DEG C 12,000 × g is centrifuged 5 minutes.
5, RNA precipitate is re-dissolved
Ethanol solution is removed, air drying RNA precipitate 5~10 minutes, it is dry to be sure not traditional vacuum.Notice that RNA precipitate should not
It is completely dried, otherwise will substantially reduce the solubility of RNA.Dissolve RNA when, be first added no RNA enzyme water blown and beaten repeatedly with rifle it is several
It is secondary.The RNA solution of acquisition is stored in -70 DEG C.
(2) RNA Quality Control
1, reagent:
8,1 mM EDTA(Tris-HCl, EDTA Huamei Bio-Engrg Co., of TE:10 mM, Tris-HCl pH)
0.2 M MOPS, pH 7.0 (MOPS Huamei Bio-Engrg Co.)
0.02 M sodium acetate (Solution on Chemical Reagents in Shanghai Co., Ltd)
0.01M EDTA (Huamei Bio-Engrg Co.)
Formaldehyde (Solution on Chemical Reagents in Shanghai Co., Ltd)
Formaldehyde loading dye liquor (ambion)
Gold View dyestuff (matches Bai Sheng gene technology Co., Ltd in Shanghai)
Agarose (Sheng Gong bioengineering Co., Ltd)
2, determination of uv absorption method
RNA concentration and purity are measured using NanoDrop ND-1000, is first returned to zero with the DEPC water of dissolution RNA before measurement,
Operating method is as follows:
1 μ L DEPC water or RNA sample is added dropwise to the surface for measuring pedestal.
Drop can form fluid column between upper bottom base automatically and be automatically performed measurement, each seed ginseng of RNA concentration and quality
Number will automatically generate file in computer.
After the completion of primary measurement, the sample liquid on upper base surface is wiped with soft lens wiping paper, can be carried out next
The measurement of a sample.
Measurement result:
(1) concentration mensuration
Readings is 1 40 ng RNA/ μ l of expression at 260nm.
Sample RNA concentration calculation formula are as follows: the ng/ul of A260 × 40.Specific calculating is as follows:
RNA is dissolved in 20 μ l DEPC water, is taken 1 μ l to be used to measure, is measured A260=65.003:
Concentration=65.003 RNA × 40 ng/ μ l=2600.12ng/ μ l.
After taking 1 μ l to be used to measure, remaining sample RNA is 19 μ l, remaining RNA total amount are as follows: 19 μ l × 2600.12ng/
µl = 49.4 µg
(2) purity detecting
The ratio of the A260/A280 of RNA solution is a kind of RNA method for detecting purity, ratio range 1.8 to 2.1.Even if ratio is super
It goes beyond the scope, RNA sample similarly can be used in some routine experimentations as Northern hybridization, RT-PCR and RNA enzyme are protected
Shield experiment.
3, Denaturing Agarose Gel electrophoresis (histocyte)
A, glue
1 g agarose is dissolved in 72 ml water, is cooled to 60 DEG C, and the 37% of 10 × MOPS electrophoretic buffer of 10 ml and 18 ml
Formalin (12.3 M).
10 × MOPS electrophoretic buffer:
Concentration components
0.2M MOPS, pH 7.0
0.02M sodium acetate
0.01M EDTA
25 μ l solution can be at least added in Casting of gels plate, reserved well.Comb is removed after gelling, and gel slab is put into electricity
It swims in slot, adds enough 1 × MOPS electrophoretic buffers to the covering several millimeters of glue surface.
B, prepare RNA sample
3 μ g RNA are taken, the formaldehyde loading dye liquor of 3 times of volumes is added, add EB in formaldehyde loading dye liquor to final concentration of 10 μ g/ml.
Being heated to 70 DEG C of incubations makes denaturing samples in 5 minutes.
C, electrophoresis
It is splined in glue hole, electrophoresis is to bromjophenol blue indicator into glue at least 2~3 cm under 5-6 V/cm voltages.
D, it observes and takes pictures under ultraviolet transmission light
(its size is decided by the species for extract RNA) dense with non-be always on of 28S and 18S rRNA, above one
The density of band is about 2 times of a following band.It is also possible to observing the one smaller band slightly spread, it is by low molecule
RNA(tRNA the and 5S rRNA of amount) composition.Generally it can be seen that the EB of a piece of disperse between 18S and 28S ribosomes band
Coloring matter, it may be possible to be made of mRNA and other abnormal shape RNA.If there is DNA pollution in RNA preparation process, it will in 28S
The upper surface of rRNA band occurs, i.e. the disperse migration substance or band of higher molecular weight.The degradation of RNA shows as ribosomes
The disperse of RNA band.
(3) synthesis of cDNA
The reverse transcription that total serum IgE is carried out according to Takara reverse transcription reagent box, such as table 1.Reverse transcription to sample progress total serum IgE, 10
μ L system inverts 1,000 ng total serum IgE, and " * " indicates the RNA volume for needing to be added according to the concentration calculation of total serum IgE,
1 reverse transcription system of table:
Piping and druming carries out reverse transcription after mixing repeatedly, and the specific reverse transcription time is as follows:
37℃ 15min
85℃ 5s
- 20 DEG C of preservations
Two, experimental result
The RNA concentration of each sample is measured using Nano Drop ND-1000 instrument (Agilent Inc. USA).With
OD260/OD280 value is as RNA purity index.OD260/OD280 value range is qualified in 1.8~2.1, RNA purity.
The expression of difference circRNA in 4 fluorescence quantitative PCR method of embodiment detection sequencing sample
By measurement experiment group (cancerous tissue) and the target gene and reference gene of control group (cancer beside organism), it is relatively fixed to carry out
Amount, obtains the relationship of the target gene of the relevant target gene of dog tumor of breast and control group, using real-time fluorescence quantitative PCR skill
Art is to its nucleotide sequence of chr13-62685728-62729175+(such as 1 institute of SEQ ID NO. that early period, high-flux sequence screened
Show) expression detection, ACTB makees reference gene.
One, experimental implementation
The cDNA that reverse transcription is completed in previous step is taken out, according to Roche LightCycler®480 real-time PCRs are wanted
It asks, the system of 20 μ L is established, such as table 2；
The primer sequence of each gene such as table 3.
The system of 2 fluorescent quantitation of table:
3 fluorescence quantification PCR primer sequence of table:
It wherein needs to prepare PCR mix according to PCR hole count, each hole is separately added into after mixing gently, to reduce error, each sample
Detection Duplication three times.
After sample-adding finishes, with sealing plate film sealing plate, 1500g is centrifuged 96 orifice plate 2min of PCR plate, plate is put into
LightCycler®In 480 instruments, according to following parameter setting:
(5) interpretation of result
The experimental result calculated using following formula:
Relative expression quantity=2Δ Δ ct,
In formula-Δ Δ ct=(experimental group target gene ct value-experimental group reference gene ct value)-(control group target gene
Ct value-control group reference gene ct value),
Data in each group are analyzed using paired sample T test using 20.0 software of SPSS, P < 0.05 is to have conspicuousness poor
Different, P < 0.01 is that difference is extremely significant.
Two, experimental result
Fig. 2 is gene chr13-62685728-62729175+ melting curve and amplification curve；Fig. 3 is reference gene ACTB melting
Curve and amplification curve.
RT-qPCR is as the result is shown: chr13-62685728-62729175+ is consistent with high-flux sequence result, i.e., in dog
Expression quantity is significantly lowered in breast tumor tissues, as shown in Figure 4 and Figure 5.
The expression quantity detection of circular rna in the different tumour cells of embodiment 5 and its culture solution
One, experimental implementation
(1) recovery of dog breast tumor cell
By dog breast tumor cell CHMm(transfevent dog breast tumor cell) and CHMp(essential dog breast tumor cell) from
It is placed in rapidly after taking-up in liquid nitrogen container in 37 DEG C of water-baths, constantly rocking cryopreservation tube keeps the liquid in cryopreservation tube instant fastly
Change, then the liquid in cryopreservation tube is drawn in 15 mL centrifuge tubes in superclean bench, the incomplete culture of 10 mL is added
Liquid is blown and beaten and is mixed by base；2,000 rpm of centrifuge is centrifuged 5 min, and visible tube bottom has a small amount of white precipitate after centrifugation；By supernatant
Cell is resuspended in 2 mL are added in liquid complete medium after discarding；It draws liquid into new Tissue Culture Flask, it is complete that 3 mL is added
It blows and beats and mixes after culture medium；It covers bottle cap and marks；It is placed in 37 DEG C, 5% CO2Cell incubator in cultivate 24 h after observe
Cell state has most cells adherent growth, shows cell if cell bottle bottom only has small part cells float in culture solution
Successful Resuscitation.
(2) culture of dog breast tumor cell
When observing that Tissue Culture Flask inner cell density reaches 90% or so under the microscope, cell passage can be carried out.In ultra-clean work
Make the culture medium being sucked out in cell bottle in platform, is added after 3 mL PBS softly purge attached cell surface and discards, then purge one time
To adjust pH value；1 mL trypsase is added along the opposite side bottle wall of cell aufwuchsplate, cell bottle, which is laid flat, keeps trypsase equal
Cellular morphology situation of change is observed after even covering cell surface under inverted microscope, when space between cells increase, cell rounding,
Trypsase is siphoned away immediately and is discarded；3 mL complete mediums are added, repeatedly the adherent face of cell of piping and druming cell bottle, general one bottle
At 3 bottles, every bottle of cell dispenses 1 mL for cell passage；It is added in the bottle of passage cell into 4 mL complete mediums, pressure-vaccum is uniform
After be put in 37 DEG C, 5% CO2Cell incubator in cultivate.
(3) dog breast tumor cell freezes
Cell cryopreservation box are reverted into room temperature in advance；Cell bottle to be frozen is put into superclean bench, is sucked out in cell bottle
Culture medium, be added 3 mL PBS softly purge attached cell surface after discard；1 is added along the opposite side bottle wall of cell aufwuchsplate
ML trypsin digestion and cell is transferred in 15 mL centrifuge tubes after 3 mL complete mediums piping and druming cell aufwuchsplate is added；2000
Rpm discards supernatant liquid after being centrifuged 5 min；Every bottle of cell prepares 1 mL cells frozen storing liquid (containing 90% fetal calf serum and 10%DMSO)；
1 mL cells frozen storing liquid piping and druming precipitating is added in centrifuge tube makes its resuspension；The suspension that cell piping and druming mixes is sucked into cell cryopreservation
Guan Zhong；It marks and with being put into freezing storing box after sealed membrane overlay marks and pipe lid, freezing storing box is quickly placed in -80 DEG C of ice
In case；Cell is taken out after 24 h and is moved in liquid nitrogen and is saved for a long time.
(4) expression quantity variation of the chr13-62685728-62729175+ in different tumour cells and its culture solution
Cell growth status is observed under the microscope daily, is passed on when cell bottle inner cell density reaches 90% or so.To
Every kind of cell culture collects cell and cell culture fluid when covering with to forth generation respectively, for extracting RNA.Cell is trained in forth generation
Liquid is not changed in health growth process.
In cell in the extraction of total serum IgE and cell culture fluid in the synthesis reference embodiment 3 of the extraction of total serum IgE and cDNA
" extracting of (one) tissue RNA " step carries out.Cell and cell culture fluid are detected with fluorescent quantitation, concrete operation step ginseng
According to embodiment 4.
Two, experimental result
In different tumour cells, expression quantity of the chr13-62685728-62729175+ in cell culture fluid is thin with tumour
The change of expression quantity in born of the same parents and change, and variation tendency is consistent, as shown in Figure 6.Prompt chr13-62685728-62729175+
It can be discharged into cell culture fluid by tumour cell, it will be with considerable as dog tumor of breast candidate's potential source biomolecule marker
Application prospect.
6 RNase R tolerance test of embodiment
One, experimental implementation
(1) total serum IgE of dog breast tumor cell line CHMp, " extracting of (one) tissue RNA " step in method for extracting reference 3 are extracted
It is rapid to carry out.
(2) total serum IgE of RNase R enzymatic treatment dog breast tumor cell line CHMp is used.
It is as follows that RNase R handles specific practice:
4 μ L 10 × RNase R Reaction Buffer(U.S. epicentre),
1.2 μ L (24 U) RNase R (U.S. epicentre),
8 μ g total serum IgEs.
The above system supplies 40 μ L systems with DEPC water.
First 37 DEG C of 15 min of water-bath；Then 85 DEG C of 3 min of water-bath inactivate enzymatic activity；
Control group substitutes 1.2 μ L(24 U of experimental group), 1.2 μ L DEPC water of RNase R.
(3) 2.5 μ L are respectively taken to two groups before and after the processing, through 1% agarose gel electrophoresis, 180 V, 10 min, detection
Digest the variation of the RNA band of front and back.
(4) total serum IgE of (1) is taken to carry out reverse transcription respectively.
(5) table of fluorescent quantitation detection digestion front and back circular rna and linear rna is carried out using the cDNA in (4) as template
Up to the variation of amount.
Two, experimental result
After RNase R processing, being basically unchanged of expression quantity of circRNA, the expression of chr13-62685728-62729175+
It measures being basically unchanged (Fig. 7), being presently considered may be to contain Mg inside RNase R buffer2+, Mg2+PCR reaction can be enhanced.
And the expression quantity of linear rna (ACTB and GPI) then significantly reduces, this further demonstrates that circRNA is cricoid.Thus may be used
See that circRNA is insensitive to RNase R enzyme, is not easy to be degraded, has the condition as disease marker.
7 Sanger of embodiment sequencing
One, experimental implementation
The RT-qPCR amplified production of control group without RNase R enzymatic treatment in embodiment 6 is retained.The product of each gene
10 μ L are taken to do sanger sequencing respectively.Sequencing result is compared with DNAMAN software.
Two, experimental result
The product for the gene chr13-62685728-62729175+ that the cDNA of sample is obtained after qRT-PCR is expanded entrusts day one
Hui Yuan bioengineering Co., Ltd carries out sanger sequencing.Sanger sequencing result is shown, can be recycled to the differential gene of signal
Identical as expected sequencing result 100%, sequence alignment result shows that gene order regional signal is good (Fig. 8), sequencing result
Reliably.This also demonstrates the reliability of design of primers and RT-qPCR reaction.
8 tissue specificity testing result of embodiment
One, experimental implementation
Select Adult female beasle dog liver, spleen, lung, kidney, stomach, colon and the breast tissue pattern detection chr13- of health
The expression quantity of 62685728-62729175+.
Detection method is the same as embodiment 4.
Two, experimental result
Tissue specificity testing result shows that chr13-62685728-62729175+ has expression in the Various Tissues of dog, special
It is not enriched in breast tissue.
9 cancer of embodiment and cancer beside organism's specific detection result
One, experimental implementation
(1) 14 dog tumor of breast cases have been selected, and have detected chr13-62685728-62729175+ in tumor tissues and
Cancer beside organism's expression.
(2) fluorogenic quantitative detection has been carried out to 18 breast tissues, wherein 9 are dog breast tumor tissues (male dogs 1
Example), in addition 9 are Healthy Dogs breast tissue (male dogs 1).
Detection method is the same as embodiment 4.
Two, experimental result
(1) as shown in FIG. 10 and 11, chr13-62685728-62729175+(P < 0.01) in 14 dog tumor of breast clinic samples
Extremely significant level is lowered and reached to expression significantly in this, shows that dog breast tumor tissues and cancer beside organism can pass through gene
Chr13-62685728-62729175+expression distinguish.
(2) in 9 Healthy Dogs breast tissues, the expression of chr13-62685728-62729175+ and reference gene ACTB
Amount reaches unanimity.Therefore, the breast tissue detection data of Healthy Dogs is averaged the contrasting data as tumor of breast group, into
The row later period 2-△△CtCalculating, compare in breast tumor tissues chr13-62685728-62729175+ compared with the table of health tissues
Change up to amount.
It is as shown in figure 12 using two groups of independent samples t test analysis results, in 9 dog breast tumor tissues, chr13-
The expression quantity relative healths dog breast tissue of 62685728-62729175+ significantly lowers (p < 0.01), thus with different samplings
Angle demonstrates accuracy of the chr13-62685728-62729175+ as dog tumor of breast biomarker, testing result tool
The following Figure 13 of body.
A kind of kit of the dog gland diagnosing tumor of embodiment 10
1, a kind of kit of dog Diagnosis of Breast Tumor includes a pair of of dog circular rna gene chr13-62685728-62729175
+ detection primer and quantitative fluorescent PCR reagent；Wherein, a pair of of dog circular rna gene chr13-62685728-62729175
+ detection primer nucleotide sequence as shown in SEQ ID NO. 2~3, also protect reference gene ACTB amplimer, nucleosides
Acid sequence is as shown in SEQ ID NO. 4~5.
2, application method
(1) RNA of test serum is extracted, reverse transcription obtains cDNA after quality inspection.
(2) according to Roche LightCycler®The system of 20 μ L: ddH is established in the requirement of 480 real-time PCRs2O
(sterile purified water) 6 μ L；SYBR Green Ⅰ Master 10 μL；PCR Forward Primer 1 μL；PCR
Reverse Primer 1 μL；2 μ L of DNA profiling.
It wherein needs to prepare PCR mix according to PCR hole count, each hole is separately added into after mixing gently, to reduce error, each
Each detection Duplication of sample is three times.
(3) after sample-adding finishes, with sealing plate film sealing plate, 1500g is centrifuged 96 orifice plate 2min of PCR plate, plate is put into
LightCycler®In 480 instruments, according to following parameter setting:
(4) interpretation of result
The experimental result calculated using following formula:
Relative expression quantity=2Δ Δ ct,
In formula-Δ Δ ct=(experimental group target gene ct value-experimental group reference gene ct value)-(control group target gene
Ct value-control group reference gene ct value),
Data in each group are analyzed using paired sample T test using 20.0 software of SPSS, P < 0.05 is to have conspicuousness poor
It is different.
Sequence table
<110>Agricultural University Of South China
<120>a kind of dog circular rna gene as dog Diagnosis of Breast Tumor marker
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 662
<212> DNA
<213> Canis familiaris
<400> 1
acatgatgcc attattatct caggaactga aatggccaaa caaattcaga aagaaataca 60
gagaggtgtg gaatcatgga tttcccttgg gaacagaaga cctcacctca gtatcatctt 120
agtgggcgat aacccagcaa gccatacgta cgtcaggaag aagatcagag ccgcctctgc 180
tgtaggtatc tgtagtgaga tcattctaaa acctaaggat gtttctcagg aagaactttt 240
ggacataact gatcaattga atatggaccc aagagtcagt ggtatattag ttcagttgcc 300
actgccagac catgtggatg agcgaacagt gtgcaatgga attgcccctg aaaaagatgt 360
agatggattt catattatca atattggaag actgtgcctt gatcagcatt ctctcatacc 420
cgccactgcc agtgcagttt gggaaataat caagagaaca ggaattgaaa catttgggaa 480
aaatgtggtt gtagctggaa gatccaagaa tgtagggatg cccattgcca tgcttttaca 540
cactgatgga gaacacgaac ggccaggagg tgatgcaacg gtgacaatag ctcacagata 600
cactcccaaa gaacaactga agatccatac tcagctggca gatattatca tagtagctgc 660
cg 662
<210> 2
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tgcaacggtg acaatagctc 20
<210> 3
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
gaggtcttct gttcccaagg 20
<210> 4
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
ggcatcctga ccctgaagta 20
<210> 5
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ggggtgttga aagtctcgaa 20
Claims (9)
1. a kind of dog circular rna gene, which is characterized in that its nucleotide sequence is as shown in SEQ ID NO. 1.
2. the detection primer of dog circular rna gene described in claim 1, which is characterized in that the detection primer can detecte
Abundance of the dog circular rna gene in detection sample.
3. the detection primer of dog circular rna gene described in one group of claim 1, which is characterized in that the nucleosides of the detection primer
Acid sequence is as shown in SEQ ID NO. 2~3.
4. application of the dog circular rna gene as dog Diagnosis of Breast Tumor marker described in claim 1.
5. application of the detection primer described in Claims 2 or 3 in preparation dog Diagnosis of Breast Tumor kit.
6. a kind of kit of dog Diagnosis of Breast Tumor, which is characterized in that the kit contains inspection described in Claims 2 or 3
Survey primer.
7. kit according to claim 5, which is characterized in that the kit also contains quantitative fluorescent PCR reagent.
8. kit according to claim 7, which is characterized in that the reaction system of kit are as follows: ddH2O 6 μ L, SYBR
I Master of Green, 10 μ L, PCR Forward Primer, 1 μ L, PCR Reverse Primer, 1 μ L, cDNA template
2 μL。
9. kit according to claim 7, which is characterized in that the reaction condition of kit: 95 DEG C of 1min, 1 is followed
Ring；95 DEG C of 10s, 60 DEG C of 10s, 72 DEG C of 10s, 45 circulations；95 DEG C of 5s, 65 DEG C of 1min, 1 circulation；97 DEG C of preservations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810858765.7A CN109022580B (en) | 2018-07-31 | 2018-07-31 | Canine circular RNA gene as diagnosis marker of canine breast tumor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810858765.7A CN109022580B (en) | 2018-07-31 | 2018-07-31 | Canine circular RNA gene as diagnosis marker of canine breast tumor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109022580A true CN109022580A (en) | 2018-12-18 |
| CN109022580B CN109022580B (en) | 2021-12-24 |
Family
ID=64647035
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810858765.7A Active CN109022580B (en) | 2018-07-31 | 2018-07-31 | Canine circular RNA gene as diagnosis marker of canine breast tumor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109022580B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109620832A (en) * | 2019-01-14 | 2019-04-16 | 大连大学 | Glycocholic acid is preparing the application in resisting hyperplasia of mammary glands drug |
| CN113355410A (en) * | 2021-07-09 | 2021-09-07 | 川北医学院附属医院 | Primary gout diagnosis marker and application |
| CN115240773A (en) * | 2022-09-06 | 2022-10-25 | 深圳新合睿恩生物医疗科技有限公司 | Method, device, equipment and medium for identifying novel antigen of tumor specific circular RNA |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017156362A1 (en) * | 2016-03-11 | 2017-09-14 | President And Fellows Of Harvard College | Modulating t cell survival by targeting the one-carbon metabolic pathway |
-
2018
- 2018-07-31 CN CN201810858765.7A patent/CN109022580B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017156362A1 (en) * | 2016-03-11 | 2017-09-14 | President And Fellows Of Harvard College | Modulating t cell survival by targeting the one-carbon metabolic pathway |
Non-Patent Citations (3)
| Title |
|---|
| 张庆林: "乳腺癌上皮和间质细胞中差异表达的线粒体相关基因及其功能模块研究", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 * |
| 徐飞等: "环状RNA circ_MTHFD2对mircoRNA-124的调控在肺癌培美曲塞耐药中的作用", 《临床肿瘤学杂志》 * |
| 未知: "PREDICTED: Canis lupus familiaris methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2 like (MTHFD2L), transcript variant X1, mRNA", 《GENBANK》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109620832A (en) * | 2019-01-14 | 2019-04-16 | 大连大学 | Glycocholic acid is preparing the application in resisting hyperplasia of mammary glands drug |
| CN113355410A (en) * | 2021-07-09 | 2021-09-07 | 川北医学院附属医院 | Primary gout diagnosis marker and application |
| CN115240773A (en) * | 2022-09-06 | 2022-10-25 | 深圳新合睿恩生物医疗科技有限公司 | Method, device, equipment and medium for identifying novel antigen of tumor specific circular RNA |
| CN115240773B (en) * | 2022-09-06 | 2023-07-28 | 深圳新合睿恩生物医疗科技有限公司 | New antigen identification method and device, equipment and medium of tumor specific circular RNA |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109022580B (en) | 2021-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2358912B1 (en) | Methods for assessing rna patterns | |
| CN105112522A (en) | Detection primer combination and kit for HER2 (human epidermal growth factor receptor 2) gene amplification | |
| MX2008011839A (en) | Propagation of primary cells. | |
| CN109022580A (en) | A kind of dog circular rna gene as dog Diagnosis of Breast Tumor marker | |
| AU2020310247B2 (en) | Gene marker combination and use thereof | |
| CN106191055A (en) | A kind of non-small cell lung carcinoma marker, detectable and test kit | |
| CN109593848A (en) | A kind of tumour correlated series, long-chain non-coding RNA and its application | |
| CN107519193A (en) | Esophageal squamous cell carcinoma early molecule diagnosis marker and its application | |
| CN106947805A (en) | Fluorescence PCR method, kit and the system of septin9 gene methylations in human peripheral dissociative DNA are detected based on ARMS PCR methods | |
| CN106676183A (en) | ZFHX4 as biomarker for prognosis of esophagus cancer | |
| CN109022583A (en) | Hsa_circ_0021977 is preparing the application on Diagnosis of Breast cancer product | |
| CN105441541A (en) | Lung cancer detection quality control product and preparation method thereof | |
| CN108504737A (en) | A kind of application of long-chain non-coding RNA TRALR | |
| GB2465088A (en) | Methods for characterising prostate cancer | |
| CN106520992A (en) | Application of molecular marker STAC2 to oral squamous cell carcinoma | |
| CN110951873A (en) | Bone and sarcoma marker, application thereof and kit | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN108531486A (en) | A kind of application of dog circular rna gene as dog Diagnosis of Breast Tumor marker | |
| CN103451303B (en) | Kit for detecting expression level of human ERCC1 (excision repair cross complementation 1) through PCR (polymerase chain reaction) method | |
| CN108531595A (en) | Detect the Primer composition, detection method and application of DNA methylation to be measured | |
| CN107760787A (en) | A kind of breast cancer molecular parting real-time fluorescence multiple PCR primer and kit and application | |
| Zhao et al. | Primary application study in early diagnosis of bladder cancer by survivin molecular beacons | |
| CN102899390A (en) | Small cell lung cancer markers and their detection | |
| CN105274100A (en) | Human TWIST1/Vimentin gene methylation detection marker and kit | |
| Robotti et al. | Circulating Biomarkers for Cancer Detection: Could Salivary microRNAs Be an Opportunity for Ovarian Cancer Diagnostics? Biomedicines 2023, 11, 652 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |