CN109021082A

CN109021082A - The expression and purification of microspironema pallidum recombinant protein Tp0971 and application

Info

Publication number: CN109021082A
Application number: CN201810845528.7A
Authority: CN
Inventors: 赵飞骏; 张晓红; 刘�文; 赵铁; 周成龙; 段君霞
Original assignee: University of South China
Current assignee: University of South China
Priority date: 2018-07-27
Filing date: 2018-07-27
Publication date: 2018-12-18

Abstract

The present invention relates to recombinant protein, expression and purification and the application of a kind of microspironema pallidum recombinant protein Tp0971 are provided, amino acid sequence is as shown in SEQ ID NO.1；Using genomic DNA as template, with upstream primer P1, downstream primer P2 amplification, prokaryotic plasrnid PET30a (+) and target gene Tp0971 double digestion and purifying, PET30a (+) carrier is connect with Tp0971 gene, construct recombinant expression plasmid pET30a (﹢)-Tp0971, it is transformed into E.coli BL21 and goes out corresponding recombination fusion protein with IPTG inducing expression, the recombinant protein that purifying is obtained after nickel column affinity purification, additionally provide containing recombinant protein rTp0971 for controller used in syphilis diagnosis and sentence ELISA kit more.The present invention has good specificity and sensitivity to the diagnosis of syphilis.

Description

The expression and purification of microspironema pallidum recombinant protein Tp0971 and application

Technical field

The present invention relates to recombinant proteins, and in particular to the expression and purification of microspironema pallidum recombinant protein Tp0971 and application.

Background technique

Syphilis (syphilis) is a kind of serious harm human physical and mental health, classics and ancient sexually transmitted disease.It faces Bed incidence of occult, clinical symptoms are complicated and changeable, and early infection is easily failed to pinpoint a disease in diagnosis or mistaken diagnosis, and pathogen is that Spirochaeta pallida is grey White subspecies [Treponema pallidum subspecies pallidum], are commonly called as microspironema pallidum (Tp), mainly connect through property The infection of the modes approach such as touching, Transfusion Transmission and mother and sons' vertical transmission.There is epidemic data to show there is 3600 in world wide Ten thousand syphilitics have the new cases greater than 11,000,000 every year.Although this data is declined in recent years, syphilis, which is still, draws Play the major reason influence newborn population quality of monster, miscarriage, stillborn foetus.Further, since route of transmission and AIDS (AIDS) phase Together, syphilis considerably increases the risk of aids infection.The syphilis rate and disease incidence in China are but linear always in recent years Ascendant trend, syphilis is only second to virus hepatitis, pulmonary tuberculosis in the national Notifiable disease report that the Ministry of Public Health in 2010 announces Third position is occupied, and occupy mankind's sexually transmitted disease (STD) first place.How to effectively control with prevention syphilis, have become me at present The public health problem of state or even whole world common concern.In time, accurately, reliably diagnostic method especially early syphilis is examined It is disconnected particularly important for the management of syphilis.

Since microspironema pallidum (Tp) not can be carried out always in vitro culture, this largely limits always Tp and causes a disease The development of mechanism illustrated with controller used in syphilis diagnosis method.In fact, the current diagnosis of syphilis is mainly also by serodiagnosis side Method, for the serological screening experimental arrangement of syphilis, there are two main classes at present: traditional screening program and corresponding backward Screening method.Disease prevention and control center of the U.S. (CDC) suggestion uses conventional method: i.e. serological syphilis screening, and experiment starts from one The experiment of kind non-syphilitic leptospira: RPR, TRUST or VDRL, and then confirmed with a kind of syphilitic leptospira experimental.Experiment Room association, Britain's health protection administration, the international reflexive alliance that spreads the disease then encourages using backward screening program.There is scholar in recent years It supports backward screening, also there is scholar to hold careful attitude to backward screening.FTA-ABS, TPPA test have high sensibility And specificity, it is generally acknowledged at present syphilis confirmation method, but expensive, data are not easy to maintain, it is difficult to automation and cannot The judgement infected for curative effect and again.Although commercially available colloidal gold method is easy quickly, is also applied, deposited in clinic at present It is difficult to detect in low concentration, the problems such as false negative reaction.PCR detection is also applied in the detection of syphilis, has scholar to recognize Have very important significance in primary syphilis and mesosyphilis for Tp-DNA detection.But PCR method is difficult to popularize, general only in reality Room is tested just to be achieved.TRUST/RPR is generally used for the curative effect judgement of syphilis, preceding to have addressed, false positive reaction (virus infection, The factors such as autoimmunity disease, heterophil antibody) it is its great defect, and its diagnostic test that cannot function as syphilis.And with Serological test especially enzyme-linked immunization and chemoluminescence method detection based on microspironema pallidum, because its is easy to operate, weight Renaturation, sensitivity and specificity are preferable, and easy to automate, greatly reduce workload, improve working efficiency, by The favor of people.But for identical sample, because of the object of detection different (IgG/IgM antibody) knot between different kits Fruit may be not quite identical, in addition, current ELISA test is also not used to the judgement of syphilis curative effect, for this purpose, this project is uncommon Prestige searches out not only the diagnosis that can be used for syphilis from microspironema pallidum thallus, but also can be used for the albumen of syphilis curative effect judgement.

Since microspironema pallidum (Tp) not can be carried out in vitro culture, largely limit its pathogenic mechanism illustrate and The development of diagnostic method.The protein function research for resolving to Tp of Tp whole genome sequence provides new opportunity.The blood of syphilis Before clear diagnosis starts from more than 100 years.In fact, the diagnosis of syphilis is mainly also to be divided into non-treponemal by serodiagnosis Serological test based on body and microspironema pallidum.The former includes: TRUST, RPR, VDRL etc.；The latter include: TPPA, TPHA, FTA-ABS, EIA and CIA etc..In recent years, the enzyme linked immunological based on microspironema pallidum outer membrane protein and flagellin Method and chemoluminescence method are because of its original advantage (objective, accurate, time-consuming short, to be easy to automate and digitize etc.), in syphilis Certain application has been obtained in serodiagnosis.Representative diagnostic antigen includes: TPN15 (Tp1071), TPN17 (Tp0435), Tp0663, TPN44.5 (TmpA, Tp0768) and TPN47 (Tp0574) etc. and flagellin FlaB1, FlaB2, FlaB3.Although these antigens have preferable performance in the serodiagnosis of syphilis, which definitely shows currently without data The diagnostic value of a kind of albumen or recombinant protein is best；In addition, ELISA test cannot evaluate the treatment of syphilis.With non-syphilis Serological test (RPR, TRUST etc.) cardinal principle based on conveyor screw is based on reagin.Their titre variation is usual There is close relationship with the active degree of disease, therefore can be used as sentencing for syphilis and more test.But since reagin is at it Its disease such as SLE, malaria, monocytosis,mononucleosis etc. can also exist, so false positive rate is higher.Therefore, it is necessary to find new Diagnostic antigen/recombination diagnostic antigen, be desirable to combine tradition ELISA test and RPR/TRUST test the advantages of, further Improve the diagnostic value to syphilis.Therefore, high specificity and the high Tp antigen of sensibility are found to improve serodiagnosis of syphilis It is the key that research and development that positive rate, which especially can effectively carry out the evaluation of syphilis clinical therapeutic efficacy,.

Summary of the invention

Against the above technical problems, it the present invention provides the expression and purification of microspironema pallidum recombinant protein Tp0971 and answers With.

Technical solution of the present invention: microspironema pallidum recombinant protein Tp0971, the microspironema pallidum recombinant protein As shown in SEQ ID NO.1, the microspironema pallidum recombinant protein Tp0971 is examined rTp0971 amino acid sequence for syphilis It is disconnected.

The present invention also provides microspironema pallidum recombinant protein Tp0971: the microspironema pallidum recombinant protein rTp0971 As shown in SEQ ID NO.1, the microspironema pallidum recombinant protein Tp0971 sentences more amino acid sequence for syphilis.

The present invention also provides the preparation methods of mentioned-above microspironema pallidum recombinant protein Tp0971 a kind of, comprising: Using microspironema pallidum genomic DNA as template, with upstream primer P1:5 ' CGCGGATCC ATGAAGAGGGTGAGTTTGCTC 3 ' With downstream primer P2:5 ' CCGCTCGAGCTACCACTGAGGCCCCTTC 3 ' expand complete sequence, prokaryotic plasrnid PET30a (+) with Target gene Tp0971 double digestion and after purification, PET30a (+) carrier is connect with Tp0971 gene, constructs recombinant expression plasmid PET30a (﹢)-Tp0971, is transformed into E.coli BL21 (DE3) and with IPTG inducing expression, gives expression to its phase respectively The recombination fusion protein answered obtains the recombinant protein of purifying after nickel column affinity purification.

The present invention also provides a kind of mentioned-above microspironema pallidum recombinant protein Tp0971 to prepare controller used in syphilis diagnosis examination Purposes in agent.

Sentence the present invention also provides a kind of mentioned-above microspironema pallidum recombinant protein Tp0971 in preparation syphilis and more tries Purposes in agent.

The present invention also provides a kind of for expressing the prokaryotic expression of microspironema pallidum recombinant protein Tp0971 noted earlier Recombinant vector, the prokaryotic expression recombinant vector are pET30a (﹢)-Tp0971.

It include coating buffer, cleaning solution, confining liquid, end in the kit the present invention also provides a kind of ELISA kit Only liquid, also include following components: microspironema pallidum recombinant protein Tp0971, amino acid sequence is as shown in SEQ ID NO.1；Institute State diagnosis of the ELISA kit for syphilis.

It include coating buffer, cleaning solution, confining liquid, end in the kit the present invention also provides a kind of ELISA kit Only liquid, also include following components: microspironema pallidum recombinant protein Tp0971, amino acid sequence is as shown in SEQ ID NO.1；Institute State ELISA kit sentencing more for syphilis.

Further, the coating buffer is the carbonate buffer solution of 0.05M, pH 9.6；The cleaning solution be containing The PBST buffer of 0.05%Tween-20, pH 7.6, the confining liquid are the PBS buffer solution containing 5%BSA, the end Only liquid is the H of 2mol/L₂SO₄Solution.

The present invention also provides ELISA kits noted earlier to prepare controller used in syphilis diagnosis reagent and sentence answering in more reagent With.

Compared with prior art, the invention has the benefit that

1, with syphilitic's serum specific bond can occur for microspironema pallidum recombinant protein Tp0971 provided by the present invention, It is detected through indirect elisa method, with the indirect elisa method established with good immunocompetent infection dependence antigen Tp0971 To the detection of 2138 parts of clinical serums the results show that its sensitivity reaches 96.4%, specificity 97.7%, with clinical reagent box The serum testing result consistency of TPPA is up to 97.1%.Simultaneously compared with beautiful pearl Tp-ELISA preliminary screening agent box testing result, Consistency is that 95.1%, kappa value is 0.902.Confirm that the indirect ELISA established based on infection dependence antigen Tp0971 is had There are higher sensitivity and specificity, with TPPA and beautiful pearl Tp-ELISA testing result consistency with higher, explanation Tp0971 albumen has the application value of syphilis clinical diagnosis candidate antigens.

2, by the Parallel testing to 60 parts of pretherapy and post-treatment treponema pallidum agglutination samples, Tp0971-ELISA as the result is shown A450 value and the variation of RPR titre value are positively correlated (coefficient R 0.82), and there is recombinant protein rTp0971 clinic to sentence more Value.

Detailed description of the invention

Fig. 1 is 1.0% agarose electrophoretic analysis figure of PCR product in embodiment, wherein swimming lane 1:DNA Marker；Swimming lane 2, 3:Tp0971PCR product；Swimming lane 4: negative control；

Fig. 2 is pET-30a (+)/Tp0971 PCR qualification figure in embodiment, wherein swimming lane M:DNAMaker, swimming lane 1-5: Tp0971 bacterial clone PCR product；

Fig. 3 is the SDS-PAGE result figure of recombinant vector Tp0971 expression in embodiment, wherein swimming lane M: ProteinMarker；Swimming lane 1:E.coli BL21 (DE3)/Tp0462；Swimming lane 2,4:E.coliBL21 (DE3)/pET30a (+)/Tp0971,20 DEG C, 37 DEG C of conditions, 0.5mM IPTG induce supernatant；Swimming lane 3,5:E.coli BL21 (DE3)/pET30a (+)/Tp097120 DEG C, 37 DEG C of conditions, 0.5mM IPTG induced precipitation；

Fig. 4 is the Western blot qualification figure of Tp0971 recombinant protein in embodiment, wherein swimming lane 1: negative serum；Swimming Road 2,3: positive serum；

Fig. 5 is the Purification figure of recombinant protein Tp0971, wherein swimming lane M:protein Marker；Swimming lane 1: lysate (Cleared Lysate)；Swimming lane 2: efflux (effluent liquid)；Swimming lane 3:20mM imidazole wash buffer (imidazole washing buffer)；Swimming lane 4,5:50mM azoles washing buffer (imidazole washing buffer)；Swimming lane 6-8:100mM imidazole elution (imidazole Elution buffer)；

Fig. 6 be Tp0971 (a), Tp0768 (b), Tp0462 (c) and Tp92 (d) in the pretherapy and post-treatment serum of syphilis in The scatter plot of the variation of absorbance value and the variation of RPR titre at 450nm.

Specific embodiment

Technical solution of the present invention is further described below with reference to drawings and examples.

Embodiment: the building of prokaryotic expression recombinant vector

1, the PCR amplification of target gene

(1) extraction of microspironema pallidum (Nichols plants) full-length genome

Microspironema pallidum (Nichols plants) is saved by causal organism research institute of University Of Nanhua.Zoopery is in strict accordance with state The relevant regulations of family, by the examination and approval of the animal welfare committee of University Of Nanhua.With Qiagen genome extraction kit (Qiagen, Hilden, Germany), by specification operating process extract microspironema pallidum complete genome DNA template.

The DNA sequence dna of microspironema pallidum Tp0971 is as shown in SEQ ID NO.2, microspironema pallidum recombinant protein rTp0971 Amino acid sequence is as shown in SEQ ID NO.1.

(2) design and synthesis of target gene specific primer

From the gene order for obtaining Tp0971 in GenBank (http://www.ncbi.nlm.nhi.gov/), utilize 6.0 software of Primer, according to design of primers and restriction enzyme site design principle, in conjunction with PET30a (+) restriction enzyme site map, respectively Restriction enzyme site and protectiveness base are added before upstream and downstream primer, design primer and introducing restriction enzyme site difference are as follows:

3 ' BamHI of P1:5 ' CGCGGATCC ATGAAGAGGGTGAGTTTGCTC

3 ' XhoI of P2:5 ' CCGCTCGAGCTACCACTGAGGCCCCTTC

Primer P1 is shown in sequence table SEQ ID NO.5, and primer P2 is amplified production shown in sequence table SEQ ID NO.6 For shown in sequence table SEQ ID NO.3-4.

(3) the pcr amplification reaction system and program of target gene

Using Nichols plants of DNA of Tp as template, respectively with Tp0971 (P1), Tp0971 (P2) for primer, total volume is reacted For 50 μ L, reagent is placed on ice entirely, sequentially adds in the sterile centrifugation tube of 0.25mL:

It is loaded on ice, low-speed centrifugal 10s after piping and druming mixes, PCR amplification obtains target gene Tp0971.The item of PCR amplification Part is as follows:

Initial denaturation

Denaturation

Annealing

Extend

Cycle-index

It re-extends

TP0971

98 DEG C, 30S

98 DEG C, 10S

58℃30S

72 DEG C, 30S

30

72℃2min

10 μ L PCR products are taken to mix on clean film with 2 μ 6 × loading of L buffer, by 1.0% (W/V) Ago-Gel is put into equipped in 1 × TAE buffer electrophoresis tank, carries out electrophoresis in electric current for 90mA, voltage 100V, probably 30min or so takes glue to observe under ultraviolet lamp, and is photographed to record with gel imaging system and save result.As the result is shown as attached Shown in Fig. 1, the PCR product that size is 615bp is amplified respectively, and the expection clip size of Tp0971 gene is consistent.Then it uses OMEGA company DNA purification kit carries out purification and recovery to PCR product.

2, the double digestion and purification and recovery of PET30a (+) carrier and Tp0971 gene

(1) the double digestion system of prokaryotic plasrnid PET30a (+) and target gene Tp0971

PET30a (+) plasmid double digestion, reaction system are as follows:

pET30a(+)	15μL
		10×NEB Buffer	4μL
BamH I	1μL
		Xho I	1μL
ddH₂O	19μL
		total	40μL

The above operation carries out on ice, is put after mixing gently from being placed in 37 DEG C of water bath digestion 4h.

PCR purified product double digestion, reaction system are as follows:

The above operation carries out on ice, is put after mixing gently from placing 37 DEG C of water baths effect 4h.It is immediately placed in after 4h 80 DEG C of 10~15min of incubation terminate reaction in water bath, and recycle to PCR digestion products and pET-30a (+) plasmid pure Change.

3, the connection of PET30a (+) carrier and Tp0971 gene

Reaction system is as follows:

The Tp0971 gene PCR product of digestion after purification	4μL
		The plasmid pET30a (+) of digestion after purification	3μL
T4Buffer	2.5μL
		T4 ligase	0.5μL
total	10μL

The above operation carries out on ice, and gently oscillation is put after mixing from making sample be sunken to tube bottom, 22 DEG C of companies in PCR instrument 2.5h is met, 80 DEG C of incubation 10min are in water bath to prevent connection from reacting.Connection product is used directly for converting, and can also first put It is spare in 4 DEG C of refrigerators.

4, the conversion of connection product

(1) it takes 10 μ L to inactivate the connection product of 10min through 65 DEG C under superclean bench, is added to 200 μ L competent cells In (clone bacterium JM109), gently piping and druming is mixed, ice bath 30min；

(2) mixed bacteria liquid is put into hot 1.5min in 42 DEG C of water baths, horse back ice bath 2min；

(3) it is added 800 μ L LB feminine gender fluid nutrient mediums into mixed liquor, 37 DEG C, 180rpm shaken cultivation 45min, room temperature Lower 13000rpm is centrifuged 1min, and 200 μ L supernatants is stayed to break up thallus；

(4) containing 50 μ g/mL Kan⁺Solid medium on even spread bacterium solution, and put it into 37 DEG C of constant temperature incubations First forward direction puts about 2h in case, after the solidification of solid medium surface liquid, is inverted plate, overnight incubation, screening positive clone. The positive control of pET-30a (+) plasmid is done simultaneously and the negative control of DNA is not added.

5, the screening and identification of positive colony

(1) screening of positive colony

After being incubated overnight, the single bacterium colony that observation LB solid medium is grown on (containing Kana), from picking 5 on conversion plate The single bacterium colony of~10 suitable sizes is inoculated in 1mL Kan respectively⁺In the EP pipe of LB liquid medium, 37 DEG C, 220rpm vibration Swing 3~4h of culture.

(2) identification of positive colony

Template is done with bacterium solution, respectively using P1, P2 of Tp0971 gene as primer progress PCR amplification identification, operating procedure, together Before, it takes 5 μ L of pcr amplification product to carry out 1.0% agarose gel electrophoresis, electrophoresis is carried out under conditions of 100V, 90mA, about It can stop electrophoresis after 30min, observed in gel imaging system and save result；The bacterium solution of the PCR primary dcreening operation positive is expanded into training simultaneously It supports, extracts recombinant plasmid and carry out double digestion identification, 1.0% agarose gel electrophoresis simultaneously observes result.As a result such as 2 institute of attached drawing Show.

The Tp0971 gene order that the sequencing result of recombinant plasmid is announced with GenBank is carried out BLAST to compare, is as a result shown The corresponding sequence coincidence rate for showing that pET-30a (+)/Tp0971 recombinant plasmid gene Tp0971 and GenBank of building is announced is 100%, show construction of recombinant plasmid success.

Embodiment 2: expression, purifying and identification of the recombinant protein in E.coli BL21 (DE3)

1, pET-30a (+)/Tp0971 is in E.coli BL21 (DE3)/Rosetta (DE3) conversion and identification

(1) will be sequenced correct recombinant plasmid pET-30a (+)/Tp0971 convert to E.coli BL21 (DE3)/ Rosetta (DE3) is expressed in bacterium (the same E.coliJM109 of preparation method)；

(2) simultaneously using bacterium solution PCR identification and respective restriction enzymes double zyme cutting to from reformer plate picking it is single The bacterium solution that bacterium colony expands culture is identified, determines whether recombinant plasmid is successfully transferred to E.coliBL21 (DE3)/Rosetta (DE3) in.

2, pronuclear recombination expression vector pET-30a (+)/Tp0971 inducing expression

(1) picking individually recombinates bacterium colony and is inoculated in 3mL LB liquid medium (containing 50 μ g/mL kanamycins and 34 μ g/mL Chloramphenicol) in test tube, places 220rpm shake culture in 37 DEG C of shaking tables and stay overnight；

(2) the above-mentioned recombination bacterium solution of overnight incubation is transferred in 1: 100 ratio in (50 μ of LB liquid medium containing 3mL G/mL kanamycins and 34 μ g/mL chloramphenicol) in test tube, places 220rpm in 37 DEG C of shaking tables and increase 3~4h of bacterium, make its OD₆₀₀= 0.6 or so；

(3) culture medium is taken out, the IPTG that concentration is 1M is added into culture medium respectively under sterile working makes its final concentration For 0.1mM, 0.5mM and 1mM, at the same with not plus IPTG induction, empty bacterium and empty plasmid bacterium feminine gender compare；It is added different The bacterium solution of IPTG concentration is respectively put into the shaking table that temperature is 20 DEG C, 25 DEG C, 30 DEG C and 37 DEG C 4 different temperatures again with 180rpm Revolving speed shake culture, and from taking 1mL bacterium solution to do in the bacterium solution of 2h, 4h, 6h and 8h after induction in the EP pipe of 1.5mL respectively Subsequent identification；

(4) by above-mentioned EP pipe, 12000rpm is centrifuged 1min at room temperature respectively, outwells supernatant and collects bacterium solution precipitating, then to each 800 μ LPBS (PH7.4) are added in EP pipe, precipitating is resuspended, precipitating is stayed in centrifugation, is repeated 2~3 times, is added 100 μ L's in EP pipe PBS (PH7.4) dispels precipitating；

(5) above-mentioned mixed liquor is ultrasonic on ice, continue the interval 5s 5s, repeats about 10 times.4 DEG C, 13000g/min centrifugation 10min collects supernatant precipitating respectively；

(6) it precipitates molten with 100 μ L solubilization of inclusion bodies liquid (8M Urea, 50mM Tris-HCl, 150mM NaCl, PH8.0) Solution, is uniformly mixed in the ratio sample and 5 × SDS-PAGE sample-loading buffer of 1:4, boiling water bath 5~10min, 10000rpm centrifugation 10min；

(7) it is detected with the SDS-PAGE protein adhesive of 12% (W/V), glue is concentrated with 80V electrophoresis, separation gel is with 120V electrophoresis.

(8) it is cut after SDS-PAGE after glue is placed in Coomassie brilliant blue 2~3h of low speed concussion dyeing, with rear decoloring 4h, Make its background to white.It takes glue to place to observe under the ultraviolet light of white background, gel imaging system is taken pictures preservation.

Grope albumen optimum condition of the expression by temperature, IPTG concentration and the time when changing induction, to recombinant plasmid Tp0971-pET30a (+) gropes E.coli Rostta (DE3) expression condition, when 37 DEG C of increasing bacterium to bacteriums reach logarithmic phase When, it is 0.5mmol/L that recombinant protein Tp0971, which expresses optimum condition, and 37 DEG C, 180rpm induces 4h；As a result as shown in Figure 3.

2, the Western blot identification of recombinant protein

(1) glue: polyacrylamide gel is prepared: concentration glue 5%, separation gel 12%；

(2) sample preparation: taking 20 μ L protein samples uniformly to mix with 4 μ L albumen sample-loading buffers, 5~10min of boiling water, 10000rpm is centrifuged 10min, and 10 μ L of loading；

(3) electrophoresis: concentration glue 80V, 30min；Separation gel 120V, 60min；

(4) transferring film: after electrophoresis stops, according to standard pre-dyed albumen Marker, extra gel is cut, obtains destination protein item Band place gel, transferring film buffer impregnate 5min.Suitable two filter paper of size and Kynoar (PVDF) film are sheared, PVDF, which is put into methanol, impregnates 1min, is then put into together with filter paper in transferring film buffer and impregnates 5min；With tweezers by filter paper, Pvdf membrane, separating gel, filter paper from top to bottom sequence completed in half-dried transferring film slot according to layer, driven away on filter paper with glass bar Bubble, constant current 100mV, 30min；

(5) close: preparing 5% skim milk with TBST, pvdf membrane is put into, room temperature closes 2~4h；

(6) it incubates primary antibody: washing film 3 times with suitable TBST, every time 10~15min.With 5% skim milk with 1: 100 dilution HIS tag antibody, syphilis standard positive and negative serum, 4 DEG C of overnight incubations；

(7) it washs: TBST and washes film 3 times, every time 15~20min；

(8) incubate secondary antibody: the goat anti-human igg's difference for being marked the HRP sheep anti-mouse igg marked and HRP with 5% skim milk is dilute 1000 times are released, 37 DEG C of incubation 1h；

(9) it washs: TBST and washes film 3 times, every time 15~20min；

(10) develop: developing on gel imaging visualizer, as a result as shown in Figure 4.

3, the large scale preparation of recombinant protein

3.1 recombinant protein purification reagents

(1) lysozyme (Rysozyme): weighing lysozyme 100mg, distilled water 2.5mL, makes its final concentration of 40mg/mL, It is ready-to-use.

(2) bacterial lysate (Lysis Buffer): weigh NaCL17.55g, Tris 6.057g, Imidazole0.68g measures TritonX-100 10mL, is put into beaker, adds about 800mL deionized water, all dissolves to it PH value is PH 8.43 (being usually higher than 2 value left and right of albumen isoelectric point), is finally settled to 1000mL.

(3) protein purification cleaning solution (Wash Buffer) pH value be PH 8.43: weigh respectively 4 parts of NaCL17.55g, Tris 6.057g is in beaker, every part be separately added into imidazole be 0.68g, 1.36g, 2.04g, 3.4g, add about 800mL to go Ionized water, it is PH 8.43 that it, all pH value is adjusted in dissolution, is finally settled to 1000mL.Every bottle of concentration is 10mM, 20mM, 30mM And 50mM.

(4) protein purification eluent (Elution Buffer) pH value be PH 8.43: weigh respectively 3 parts of NaCL17.55g, Tris 6.057g is in beaker, every part be separately added into imidazole be 6.8g, 10.2g, 13.6g, add about 800mL deionization Water, it is PH 8.43 that it, all pH value is adjusted in dissolution, is finally settled to 1000mL.Every bottle of concentration is 100mM, 150mM, 200mM.

(5) TBST solution: weighing NaCL8.8g, Tris6.0g, after adding about 900mL deionized water, is settled to 1000mL, so Tween 20 is added with 1:1000 ratio afterwards.

3.2Ni²⁺The processing of-NTA affinity column

The Ni that will newly buy²⁺The bottle of-NTA resin, which gently overturns, mixes resin, and 2mL is taken to be fitted into chromatographic column, flows out nothing Water-ethanol makes resin natural subsidence, after adding 4mL aseptic water washing resin 2~3 times, then it is spare with LysisBuffer flushing resin.

The purifying of 3.3 soluble recombinant proteins

(1) Lysis Buffer (every 50mL adds 2mLLysis Buffer) is added in the precipitating of collection and lysozyme is (every 50mL adds 0.2mL Lysozyme) thallus is resuspended, 2h (or 4 DEG C overnight) is cracked in ice chest；

(2) on ice ultrasonic (ultrasonic 10s stops 10s, repeats about 30 times to bacterium solution clarification), multiple 2mL in advance to the cold are gone to EP pipe in, 4 DEG C, 13000rpm be centrifuged 15min；

(3) it takes the supernatant of centrifugation to be added in the chromatographic column equipped with 2mL resin, mixes, concussion is incubated for 3h on ice, takes out chromatography Column is placed on bracket and stands, and coutroi velocity waits for that liquid all flows out；

(4) foreign protein is washed with the imidazole wash liquid of various concentration, is stood after gently shaking 15min on ice, and collect Efflux；

(5) it uses elution destination protein 2 times, is stood after gently shaking 15min on ice, and collect whole outflows Liquid；

(6) after eluting, 0.5M NaOH 2mL is added in chromatographic column, adds 30% after standing 30min trickle Ethyl alcohol lid crosses Ni²⁺- NTA resin liquid level, 4 DEG C save backup；

(7) a small amount of efflux is taken to detect purification effect for SDS-PAGE, as a result as shown in figure 5, after a large amount of inducing expressions, By the supernatant of the recombinant protein Tp0971 after ultrasound cracking through Ni²⁺- NTA affinity chromatography column purification, SDS-PAGE analysis, using not After the elution of concentration imidazoles, correspondence has an apparent single slice in 40kDa or so and purity is 85% or more.

(8) a large amount of inducing expression recombinant proteins, Ni-NTA affinity column purified expression product, Western-blot identification The antigentic specificity of recombinant protein, BCA kit (Pierce, Rockford, USA) surveys protein concentration, after purification and through concentration The recombinant protein of measurement is tested for subsequent ELISA.

4, clinical detection Specimen origin

2138 parts of serum samples from affiliated hospital of University Of Nanhua in September, 2014~2016 year September inpatient (see Table 1).Wherein 1075 parts of samples are to be made a definite diagnosis by clinician according to the clinical manifestation, laboratory inspection and property contact history of patient Syphilis positive sample；Other 1063 parts of serum is syphilis ' negative ' specimens: pregnant woman 316, physical examination 314, and Leptospirosis 20, Epstein-Barr virus (EBV) infects 154, rheumatism 182, typhoid fever 77.Signed informed consent form before drawing blood. In syphilis positive sample, it is divided into I phase syphilis 231, II phase syphilis 263, III syphilis 81, latent syphilis 470, tire and passes plum Malicious 30 (being shown in Table -1).Each phase controller used in syphilis diagnosis is carried out according to professional standard.The diagnostic criteria of I phase syphilis is: infection history, typically Chancre and/or inguinal lymphadenopathy, laboratory check that (dark-field microscope, serology etc.) is positive.II phase syphilis Diagnostic criteria is: infection history, the fash and/or mucosa lesions of general hair, laboratory check positive.The diagnostic criteria of III syphilis is: History is infected, can there is I phase syphilis and II phase syphilis, the course of disease 2 years or more.Complicated clinical manifestation involves multiple organ and system.Common knot Section property fash, jeanselme nodules and skin, mucous membrane, bone gumme.Cardiovascular system involvement is scorching with simple aortic, main Artery valvular incompetence and aortic aneurysm are common.Neurological involvement is more with syphilitic meningitis, tabetic crisis and general paresis See, laboratory checks positive.The diagnostic criteria of latent syphilis is: there is an infection history, but without any syphilis clinical symptoms and sign, Non-syphilitic leptospira antigen test 2 times, brains positive (excluding biologic fale-positive) with the test of positive or TP antigen Spinal fluid checks negative.It is early latent syphilis in stadium 2 years；The above are advanced stage latent syphilis within 2 years.This experiment strictly observes Nanhua University Hospital ethics and " Declaration of Helsinki " relevant regulations carry out.

Table 1 is used for the serum sample (n=2138) of this experiment

5, the foundation of Tp0971-ELISA, TPPA test, beautiful pearl syphilis primary dcreening operation ELISA test and RPR test.

(1) it is antigen coat in 96 orifice plate of ELISA (Costar, USA) using Tp0971, is groped repeatedly, optimal conditions, The peridium concentration for determining Tp0971 is 5 μ g/ml.

(2) it is closed for 24 hours under the conditions of 4 DEG C using 5% skim milk (5.0g skimmed milk power is dissolved in 100mLPBS), PBST (PBS of 0.05%Tween 20) board-washing 3 times.

(3) 2138 parts of serum samples are primary antibody (1:100 is diluted with 5% skim milk), and every 100 μ L of hole is incubated in 37 DEG C Educate 1h, PBST (PBS of 0.05%Tween 20) board-washing 5 times.

(4) goat anti-human IgG antibodies (Proteintech) of HRP label are secondary antibody (1:10000, with 5% degreasing ox Milk dilution), 100 μ L of every hole, 37 DEG C incubation 30min, PBST (PBS of 0.05%Tween 20) board-washing 5 times.

(5) 37 DEG C of TMB colour developing 20min, add terminate liquid (2mol/L H2SO4) to terminate reaction, in full-automatic enzyme mark detector It is read under 450nm on (Multiskan MK3), records result.

(6) TPPA test (Japanese fuji is carried out according to the operational manual of kit respectively to this 2138 parts of serum simultaneously Rui Biou Co., Ltd.), a kind of ELISA kit (Zhuhai Lizhu Reagent Co., Ltd) for being commercially for syphilis primary dcreening operation It is detected with RPR (Shanghai Kehua Bio-engineering Co., Ltd).All sample replications 3 times, are averaged.All results It is as shown in the table:

Table 2 differently detects the positive rate syphilopathy serum (n=1075) of 2138 parts of serum

The display of table 3 is based on the Tp0971 ELISA method detection clinical serum sample results established and beautiful pearl Tp-ELISA, TPPA Testing result comparison of coherence statistics indicate that: based on Tp0971 establish ELISA method and beautiful pearl Tp-ELISA, TPPA clinical serum Pattern detection result has very high consistency.

Table 3 compares Tp0971-ELISA detection and TPPA, LiZhu^TMThe consistency (n=2138) of Tp-ELISA detection

By sensitivity, specificity, positive predictive value and the negative predictive value of the ELISA method established based on Tp0971, with TPPA testing result compares (table 4) as the result is shown: the ELISA method based on Tp0971 foundation is when diagnosing each phase treponema pallidum agglutination sample All have higher sensitivity and specificity.

Table 4Tp0971-ELISA method with TPPA Diagnosis of Syphilis compared with non-treponema pallidum agglutination (n=1075, TPPA+) and (n=1063, TPPA-)

6, the variation of antibody absorbance value and RPR detection titre variation at 450nm based on the ELISA method detection of Tp0971 Correlation analysis

The pretherapy and post-treatment RPR result titre of 5 treponema pallidum agglutination sample of table and ELISA detection Δ OD450nm variation

# Δ OD450nm, the difference OD450nm value between the follow up samples

During the experiment, it has been found that a phenomenon: the absorbance at its 450nm of the ELISA method of Tp0971 foundation Value difference between different clinical serums is obvious.Speculate this may in serum antibody level individual difference and therapy intervention have It closes.In order to confirm this guess, we devise following experiment: collecting 60 groups of serum before and after clinical treatment in couples, respectively With Tp0971, (Tp0768, Tp0462 and Tp92 albumen compare) Tp0768, Tp0462 and Tp92ELISA method detects its treatment Absorbance value of the front and back antibody at 45nm, and compared with RPR testing result (specific detection numerical value is as shown in table 5).

It is as shown in Figure 6: Tp0971 and the variation of reference protein Tp0768 antibody absorbance value and RPR titre variation presentation positive Pass relationship, related coefficient are respectively 0.82 and 0.52 (Fig. 6 A, Fig. 6 B), as a result have statistical significance (* P < 0.05.).So And reference protein Tp0462 and Tp92, antibody absorbance change and the variation of RPR titre are not significantly related to relationship, related coefficient point Not Jin Wei 0.12 and -0.15 (Fig. 6 C, Fig. 6 D), as a result without obvious statistical significance (P > 0.05.).It to sum up analyzes, we determine The Tp0971 specific antibody of Tp0971 and Tp0768ELISA, especially Tp0971-ELISA, detection are pretherapy and post-treatment in syphilis Strong be positively correlated is presented in the potency variation with the variation of pretherapy and post-treatment treponema pallidum agglutination RPR titre of absorbance value at 450nm.Namely Say based on the infection dependence antigen Tp0971 ELISA established there is clinical syphilis to sentence and be more worth.

7, statistical analysis

Statistical analysis (version: 18.0) is carried out to data using SPSS software.ELISA result indicates with mean, RPR drop For degree with fraction representation, RPR titre is ranked data, and ELISA result is the approximate measurement data in normal distribution.Make Tp0971- ELISA and the correlation analysis of RPR titre are using Spearman rank correlation analysis.Tp0971-ELISA and TPPA, beautiful pearl syphilis ELISA preliminary screening agent, Shanghai China of section RPR detection reagent coincidence rate compare to be analyzed using cross tabulation.

Serological test based on non-syphilitic leptospira mainly has TRUST test, RPR test and VDRL, generally not For the diagnosis of syphilis, because their measurements is reagin.This antigen contains lecithin, cholesterol, cuorin, and this Substances are not specific after infection by Treponema pallidum a bit, in hepatitis, systemic loupus erythematosus and rheumatoid joint It is also frequently present in scorching patient and some the elderlys, thus usually will appear false positive.The sensibility of RPR and VDRL depends on disease The process of disease, it has been reported that the sensibility both in primary syphilis is respectively 86% and 78%, and both in mesosyphilis Sensibility can reach 100%.Although the sensibility of ELISA is considered very high, it has been reported that certain ELISA reagents are in a phase Sensibility in syphilis, which may be not so good as RPR, should be vigilant merging if separately there is scholar to find the very high words of ocular syphilis patient RPR titre HIV infection.Cerebrospinal fluid VDRL is the standard serological method in cerebrospinal fluid, in the case where excluding serum contamination, if cerebrospinal fluid It is positive to there is VDRL, that is, is considered as neurolues.However, neurolues person's cerebrospinal fluid VDRL also can be negative.According to WHO The prevalence of report, neurolues is also in rising trend in recent years.The major significance of RPR/TRUST is to evaluate the treatment effect of syphilis Fruit and judgement for syphilitic reinfection.RPR experiment also achieves automatic detection, and is able to satisfy clinical diagnostic requirements. Foreign countries have scholar researching and developing using saliva as the RPR reagent of sample.At present, it is believed that a trend of controller used in syphilis diagnosis is letter Just, fast, accurately.

If the advantage that can the higher ELISA of sensibility and specificity be tested and is used for the judgement of syphilis curative effect combines, seek Find certain albumen, not only can be used for the diagnosis of syphilis, but can as the ELISA test that syphilis therapeutic effect is judged, no matter from Controller used in syphilis diagnosis still all will be a kind of Gospel from reducing for the cost that syphilis is treated.The Tp0971 albumen that the present invention screens exists Good diagnosis performance is all had compared with TPPA test and beautiful pearl syphilis primary dcreening operation ELISA kit.Beautiful pearl syphilis primary dcreening operation ELISA Kit is 100% to the sensitivity of this 2138 parts of serum, and its specificity is 92.8%, reflects it and tries as syphilis primary dcreening operation The high sensitivity of agent box, main purpose is to prevent missing inspection, but passes through Spearman rank correlation analysis, OD value and RPR It as a result is uncorrelated.And the A450 value for the Tp0971-ELISA that the present invention establishes is to 60 parts of pretherapy and post-treatment treponema pallidum agglutination samples Detecting the variation of A450 titer and the pretherapy and post-treatment titre variation related coefficient of RPR testing result is 0.82, Tp0971-ELISA A450 value and RPR titre related coefficient have it is strong be positively correlated, Tp0971-ELISA, which meets to sentence as syphilis, more to be tested The imagination of method.

The above content is a further detailed description of the present invention in conjunction with specific preferred embodiments, and it cannot be said that Specific implementation of the invention is only limited to these instructions.For those of ordinary skill in the art to which the present invention belongs, exist Under the premise of not departing from present inventive concept, a number of simple deductions or replacements can also be made, all shall be regarded as belonging to of the invention Protection scope.

Sequence table

<110>University Of Nanhua

<120>expression and purification of microspironema pallidum recombinant protein Tp0971 and application

<130> 2018

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 204

<212> PRT

<213>microspironema pallidum (TreponemaPallidun)

<400> 1

Met Lys Arg Val Ser Leu Leu Gly Ser Ala Ala Ile Phe Ala Leu Val

1 5 10 15

Phe Ser Ala Cys Gly Gly Gly Gly Glu His Gln His Gly Glu Glu Met

20 25 30

Met Ala Ala Val Pro Ala Pro Asp Ala Glu Gly Ala Ala Gly Phe Asp

35 40 45

Glu Phe Pro Ile Gly Glu Asp Arg Asp Val Gly Pro Leu His Val Gly

50 55 60

Gly Val Tyr Phe Gln Pro Val Glu Met His Pro Ala Pro Gly Ala Gln

65 70 75 80

Pro Ser Lys Glu Glu Ala Asp Cys His Ile Glu Ala Asp Ile His Ala

85 90 95

Asn Glu Ala Gly Lys Asp Leu Gly Tyr Gly Val Gly Asp Phe Val Pro

100 105 110

Tyr Leu Arg Val Val Ala Phe Leu Gln Lys His Gly Ser Glu Lys Val

115 120 125

Gln Lys Val Met Phe Ala Pro Met Asn Ala Gly Asp Gly Pro His Tyr

130 135 140

Gly Ala Asn Val Lys Phe Glu Glu Gly Leu Gly Thr Tyr Lys Val Arg

145 150 155 160

Phe Glu Ile Ala Ala Pro Ser His Asp Glu Tyr Ser Leu His Ile Asp

165 170 175

Glu Gln Thr Gly Val Ser Gly Arg Phe Trp Ser Glu Pro Leu Val Ala

180 185 190

Glu Trp Asp Asp Phe Glu Trp Lys Gly Pro Gln Trp

195 200

<210> 2

<211> 615

<212> DNA

<213>microspironema pallidum (TreponemaPallidun)

<400> 2

atgaagaggg tgagtttgct cgggagcgca gccatttttg cgttggtttt ttccgcgtgc 60

gggggcggtg gagagcatca gcacggtgag gagatgatgg ccgccgttcc tgctccagat 120

gcagaggggg cggccggttt tgatgagttt cctataggcg aggatcggga tgtggggccc 180

ttgcatgtgg gaggggtgta ttttcagccg gttgagatgc atccggctcc aggagcacag 240

ccgtcgaagg aagaggcgga ctgtcacata gaagcggata tccacgcaaa tgaggcgggt 300

aaagatttag ggtatggagt cggggatttt gtgccgtatc tccgagttgt tgctttcctc 360

cagaagcatg gctctgagaa ggtgcaaaag gtgatgtttg cgcccatgaa cgcaggggac 420

ggtccgcatt atggggcgaa cgtgaagttt gaagaggggc ttggtacgta caaggtacgt 480

ttcgagatcg ctgcaccctc gcatgatgag tactcgctac atattgatga gcaaactggg 540

gtttccggaa ggttctggag cgagccatta gttgcagagt gggatgattt tgaatggaag 600

gggcctcagt ggtag 615

<210> 3

<211> 21

<212> DNA

<213>microspironema pallidum (TreponemaPallidun)

<400> 3

atgaagaggg tgagtttgct c 21

<210> 4

<211> 19

<212> DNA

<213>microspironema pallidum (TreponemaPallidun)

<400> 4

ctaccactga ggccccttc 19

<210> 5

<211> 30

<212> DNA

<213>microspironema pallidum (TreponemaPallidun)

<400> 5

cgcggatcca tgaagagggt gagtttgctc 30

<210> 6

<211> 28

<212> DNA

<213>microspironema pallidum (TreponemaPallidun)

<400> 6

ccgctcgagc taccactgag gccccttc 28

Claims

1. microspironema pallidum recombinant protein Tp0971, it is characterised in that: the microspironema pallidum recombinant protein rTp0971 amino acid For sequence as shown in SEQ ID NO.1, the microspironema pallidum recombinant protein Tp0971 is used for the diagnosis of syphilis.

2. microspironema pallidum recombinant protein Tp0971, it is characterised in that: the microspironema pallidum recombinant protein rTp0971 amino acid As shown in SEQ ID NO.1, the microspironema pallidum recombinant protein Tp0971 sentences more sequence for syphilis.

3. a kind of preparation method of the described in any item microspironema pallidum recombinant protein Tp0971 of claims 1 or 2, feature exist In, comprising: using microspironema pallidum genomic DNA as template, with upstream primer P1:5 ' CGCGGATCC ATGAAGAGGGTGAGTTTGCTC 3 ' and downstream primer P2:5 ' CCGCTCGAGCTACCACTGAGGCCCCTTC 3 ' amplification is complete Sequence, prokaryotic plasrnid PET30a (+) is with target gene Tp0971 double digestion and after purification, by PET30a (+) carrier and Tp0971 Gene connection, constructs recombinant expression plasmid pET30a (﹢)-Tp0971, is transformed into E.coli BL21 (DE3) and is used in combination IPTG inducing expression gives expression to its corresponding recombination fusion protein respectively, and the recombination egg of purifying is obtained after nickel column affinity purification It is white.

4. a kind of described in any item microspironema pallidum recombinant protein Tp0971 of claims 1 or 2 are preparing controller used in syphilis diagnosis reagent In purposes.

5. a kind of described in any item microspironema pallidum recombinant protein Tp0971 of claim 2 or 2 sentence more reagent in preparation syphilis In purposes.

6. a kind of for expressing the prokaryotic expression weight of any one of claims 1 or 2 microspironema pallidum recombinant protein Tp0971 Group carrier, it is characterised in that the prokaryotic expression recombinant vector is pET30a (﹢)-Tp0971.

It include coating buffer, cleaning solution, confining liquid, terminate liquid in the kit 7. a kind of ELISA kit, which is characterized in that Also include following components: microspironema pallidum recombinant protein Tp0971, amino acid sequence is as shown in SEQ ID NO.1；It is described ELISA kit is used for the diagnosis of syphilis.

It include coating buffer, cleaning solution, confining liquid, terminate liquid in the kit 8. a kind of ELISA kit, which is characterized in that Also include following components: microspironema pallidum recombinant protein Tp0971, amino acid sequence is as shown in SEQ ID NO.1；It is described ELISA kit is sentenced more for syphilis.

9. according to the described in any item ELISA kits of claim 7 or 8, it is characterised in that: the coating buffer is 0.05M's Carbonate buffer solution, pH 9.6；The cleaning solution be the PBST buffer containing 0.05%Tween-20, pH 7.6, The confining liquid is the PBS buffer solution containing 5%BSA, and the terminate liquid is the H of 2mol/L₂SO₄Solution.

10. ELISA kit described in claim 9 is preparing controller used in syphilis diagnosis reagent and is sentencing the application in more reagent.