CN108998443A - A kind of Testis Caprae seu Ovis fibroblast film system yeast cDNA library and construction method - Google Patents
A kind of Testis Caprae seu Ovis fibroblast film system yeast cDNA library and construction method Download PDFInfo
- Publication number
- CN108998443A CN108998443A CN201810928386.0A CN201810928386A CN108998443A CN 108998443 A CN108998443 A CN 108998443A CN 201810928386 A CN201810928386 A CN 201810928386A CN 108998443 A CN108998443 A CN 108998443A
- Authority
- CN
- China
- Prior art keywords
- caprae seu
- seu ovis
- fibroblast
- cdna library
- testis caprae
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
- C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Crystallography & Structural Chemistry (AREA)
- Bioinformatics & Computational Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a kind of preparation methods of Testis Caprae seu Ovis fibroblast film system yeast cDNA library, including prepare Testis Caprae seu Ovis fibroblast;Extract Testis Caprae seu Ovis fibroblast RNA;CDNA is synthesized, cDNA library homogenization is carried out;CDNA is connect with pPR3-N carrier, and connection product converts host cell DH5 α, obtains Testis Caprae seu Ovis fibroblast film system yeast cDNA library, and carry out clone's verifying;Screening Testis Caprae seu Ovis fibroblast film system yeast cDNA library and etc..CDNA storage capacity of the invention is 7.5 × 105, the size of segment is 200-2000bp, and average length 1000bp, the recombination fraction in library is 100%.By being screened using the memebrane protein of sheep of virus to library, it was demonstrated that the library is the library of a high quality.
Description
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of Testis Caprae seu Ovis fibroblast film system yeast cDNA library
And its construction method and purposes.
Background technique
Sore mouth virus (orf) is also known as sheep infective warts, sheep infective impetiginous dermatitis, is by sheep of virus (orf virus
ORFV a kind of stronger zoonosis of infectiousness caused by).ORFV is Poxviridae (Poxviridae), parapoxvirus category
(Parapoxvirus) one of representative;Virion is ellipse, long 250~280nm, wide 170~200nm;Cause sheep
A kind of viral infectious can also infect people.It infects the Productive Performance of Sheep decline of sheep of virus, search for food difficult, syntexis simultaneously
Long-term band poison, carrys out serious harm to sheep husbandry and the health care belt of keeper.The disease almost spreads over all sheep raisings in the whole world
Countries and regions, and China is the popular serious country of the disease, and the annual sheep for infecting ORFV is no less than 5,000,000.
Some researcher's discoveries, there are many kinds of primary cell and the cell lines that can be used to be separately cultured ORFV, nineteen fifty-seven sheep
Blue tongue virus is successfully, reproduced this virus on sheep embryo's primary cell, but cytopathy is not fairly obvious.Hereafter calf testis is used
Ball primary cell, lamb testis primary cell successful proliferation sheep of virus, and observed typical cytopathy reaction.
But Testis Caprae seu Ovis cell (LT) is derived from lamb testis, primary cell made of being dissected, shredded, digested, being cultivated, this is thin
Intracellular growth is slow, can stop growing after breeding certain algebra, and passage number is limited, with the raising of passage number, cell viability
It reducing, cellular morphology also therewith worse and worse, can not finally be passed on, therefore, the quality of the quality of Testis Caprae seu Ovis cell culture,
Separation and culture for ORFV are highly important, and Testis Caprae seu Ovis cell becomes and interacts between research ORFV and host
Platform.
Summary of the invention
Traditional yeast two-hybrid library can only detect the protein-protein interaction occurred in core, can not detect after birth
Protein-protein interaction, can not detect some protein need to pass through the egg of posttranscriptional modification in endoplasmic reticulum or cytoplasm
White matter, in view of this, the purpose of the present invention is to provide a kind of systems of Testis Caprae seu Ovis fibroblast film system yeast cDNA library
Preparation Method overcomes traditional yeast double cross by the Testis Caprae seu Ovis fibroblast film system yeast cDNA library that this method constructs
The limitation in library can be used for detecting the interaction between memebrane protein.
I.e. the first aspect of the present invention is to provide a kind of system of Testis Caprae seu Ovis fibroblast film system yeast cDNA library
Preparation Method, comprising the following steps:
1) Testis Caprae seu Ovis fibroblast is prepared;
2) Testis Caprae seu Ovis fibroblast RNA is extracted;
3) cDNA is synthesized, cDNA library homogenization is carried out;
4) cDNA is connect with pPR3-N carrier, and connection product converts host cell DH5 α, obtains Testis Caprae seu Ovis fibroblast
Film system yeast cDNA library, and carry out clone's verifying;
5) Testis Caprae seu Ovis fibroblast film system yeast cDNA library is screened.
Preferably, in the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library of the present invention, institute
Stating the fibroblastic preparation method of Testis Caprae seu Ovis includes:
1) sterile to take out nascent healthy lamb testis, it is washed 2-3 times with Hank ' s liquid, after rejecting sheath, tunica albuginea, then rinses 2-
3 times;
2) parenchyma of testis is cut into the tissue block of 1-2mm size, 0.25% pancreatin digestive juice of 4 times of amounts is added, with 37 DEG C
It is digested 30-40 minutes in water-bath;
3) cell suspension is made with the nutrient solution containing 10% calf serum, sets in 25mm Tissue Culture Flask, 37 DEG C, 5%CO2
Culture, 3-4 days cells grow up to fine and close cell monolayer;
4) it is then washed 2 times using PBS, adds 1ml pancreatin, 37 DEG C, 5%CO2 placement 2min are added culture medium and press certain ratio
Example splits other cell bottles, so passes 5-6 generation, and cell growth is stablized.
Preferably, in the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library of the present invention, institute
Stating the method for extracting Testis Caprae seu Ovis fibroblast RNA is that will utilize after step 1) the Testis Caprae seu Ovis Fibroblast cell-culture 5-6 generation
Trizol reagent method, which is extracted, to be obtained.
Preferably, in the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library of the present invention, institute
Stating synthesis cDNA includes that reverse transcription method synthesis the first chain of cDNA synthesizes the second chain of cDNA with LD PCR.
Preferably, in the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library of the present invention, institute
Stating cDNA library homogenization includes hybridization processing, the amplification of DSN digestion process, twice PCR, and amplifies twice to PCR and carry out Sfi I
The step of digestion.
Preferably, in the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library of the present invention, institute
Stating host cell is DH5 α competent cell.
Preferably, in the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library of the present invention, institute
Stating screening Testis Caprae seu Ovis fibroblast film system yeast cDNA library includes building bait carrier, identification bait plasmid and screening sheep
Testis fibroblast film system yeast cDNA library.
Preferably, in the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library of the present invention, institute
Stating screening Testis Caprae seu Ovis fibroblast film system yeast cDNA library is the memebrane protein ORF047 GeneScreen using sheep of virus
Choosing.
Another aspect of the invention is above-mentioned preparation methods to obtain Testis Caprae seu Ovis fibroblast film system yeast cDNA library.
Preferably, Testis Caprae seu Ovis fibroblast film system yeast cDNA library of the present invention, the cDNA storage capacity
It is 7.5 × 105, the size of segment is 200-2000bp, and average length 1000bp, the recombination fraction in library is 100%.
The present invention selects the lamb sheep being just born, and takes testis tissue, is washed 2 times using sterile Hank ' s, utilizes eye scissors
Knife shreds, and after being digested with pancreatin, is diluted using complete DMEM culture medium, sets in 25mm Tissue Culture Flask and cultivate.Equal cells cover with
It passes on again afterwards, to cell passage to 5-6 generation, collects cell, RT-PCR obtains cDNA after extracting RNA, carries out cDNA homogenization, benefit
It is recycled with the product utilization Sfi I digestion of PCR amplification, amplification, rear cDNA is connect with pPR3-N carrier, transformed competence colibacillus host strain
DH5 α is calculated storage capacity, and the multiple clones of random picking, is expanded using vector primer, verify the size of Insert Fragment.Utilize sheep
The memebrane protein of blue tongue virus screens library, filters out three albumen with the protein-interacting, demonstrates the library
It is the library of a high quality.
Compared with prior art, main for the quality of Testis Caprae seu Ovis fibroblast film system yeast cDNA library of the present invention
It embodies are as follows: storage capacity is 7.5 × 105, the size of segment is 200-2000bp, average length 1000bp, the recombination fraction in library
It is 100%.Using the memebrane protein ORF047 genescreen of sheep of virus, the host protein interacted therewith can be screened.
Detailed description of the invention
Fig. 1 is the Testis Caprae seu Ovis fibroblast figure prepared in one embodiment of the invention;
Fig. 2 is that cDNA library constructs qualification figure in one embodiment of the invention;
Fig. 3 is that original bacterium solution spread plate counts figure in one embodiment of the invention;
Fig. 4 is that the pBT3-N-ORF-047 bait carrier constructed in one embodiment of the invention carries out self-activation and poison
Property detection figure;
Fig. 5 is bait plasmid pBT3-N-ORF047 and the library yeast cDNAlibrary in one embodiment of the invention
Blue and white screening figure after painting SD/-leu/-trp/-his/-ade/X-gal plate after plasmid cotransformation NMY51 bacterium;
Fig. 6 is ORF-047 and PABPC4, SEPR1, FLC interaction Westb- in one embodiment of the invention
Loting qualification figure.
Specific embodiment
Below in conjunction with the embodiment in the present invention, the technical solution in the present invention is clearly and completely described.It is aobvious
So, described embodiments are only a part of the embodiments of the present invention, instead of all the embodiments.Based on the reality in the present invention
Example is applied, every other embodiment obtained by those of ordinary skill in the art without making creative efforts all belongs to
In the scope of protection of the invention.
The preparation of 1 Testis Caprae seu Ovis fibroblast film system yeast cDNA library of embodiment
1.1 materials and methods
1.1.1 experimental animal
The Gansu pasture Nong Zhi Co., Ltd provides newborn lamb sheep 3
1.1.2 reagent
It is not particularly illustrated, related reagent of the invention or drug are that city is available, wherein easy gram of library construction
From Dualsystem Biotech company, restriction enzyme is purchased from for grand normolized cDNA library building kit and related reagent
NEB company, plasmid are purchased from QIAquick company, and pPR3-N, pBT3-N, pBT3-STE, pTSu2-APP and pNubG-Fe65 are carried
Body, NMY51 are purchased from Dualsystem Biotech company, SD agar medium, SD culture medium ,-trp SDO ,-leu/trp
DDO ,-his/-leu/-trp TDO ,-ade/-his/-leu/-trp QDO, SD-his/-leu/-trp, SD-ade/-his/-
Clontech company is purchased from leu/-trp solid medium.Co-immunoprecipitation related kit is public purchased from Thermo Fisher
Department, Anti-Flagantibody, Anti-HA antibody are purchased from Sigma company.
1.2 method
1.2.1 the preparation of Testis Caprae seu Ovis cell (referring to Fig. 1)
1) sterile to take out nascent healthy lamb testis, it is washed 2-3 times with Hank ' s liquid, after rejecting sheath, tunica albuginea, then rinses 2-
3 times;
2) parenchyma of testis is cut into the tissue block of 1-2mm size, 0.25% pancreatin digestive juice of 4 times of amounts is added, with 37 DEG C
It is digested 30-40 minutes in water-bath;
3) cell suspension is made with the nutrient solution containing 10% calf serum, with sodium bicarbonate tune PH to 7.0 or so, sets 25mm
In Tissue Culture Flask, 37 DEG C, 5%CO2 culture, 3-4 days cells grow up to fine and close cell monolayer;
4) it is then washed 2 times using PBS, adds 1ml pancreatin, 37 DEG C, 5%CO2 placement 2min are added culture medium and press certain ratio
Example splits other cell bottles, so passes 5-6 generation, and cell growth is stablized.
1.2.2 the building in library
1.2.1RNA extraction
It in the Testis Caprae seu Ovis fibroblast 5-6 generation of culture, is counted using trypsin digestion cell, takes 1 × 107A cell is added
The Trizol reagent of 1ml, oscillation mix, and are stored at room temperature the abundant lytic cell of 10min;The chloroform of 2ml is added, acutely shakes 15s,
It is stored at room temperature 5min;12,000g, 4 DEG C, it is centrifuged 15min;It takes supernatant into new RNase free centrifuge tube, is added isometric different
Propyl alcohol is mixed by inversion, and is stored at room temperature 5min;12,000 × g, is centrifuged 10min by 4 DEG C;Supernatant is abandoned, 75% ethyl alcohol that 1ml is added is washed
Wash precipitating, 12,000 high speed refrigerated centrifuge 5min;Supernatant is abandoned, dry RNA precipitate is then dissolved in 50ul DEPC water.
1.2.2cDNA the first chain synthesizes
It is added following reagent in 0.25ml PCR pipe: total RNA (1 μ g) 3 μ l, PlugOligo-3M 1 μ l, CDS-
1 μ l of 3M, total volume are 5 μ l, 72 DEG C of warm bath 2min, ice bath 2min;Centrifugation continuously adds following reagent: 5 × First-Strand
1 μ l, EasyClone Reverse Transcriptase1 μ of Buffer, 2.0 1 μ l, dNTP Mix (10mM) of μ l, DTT (20mM)
L, total volume 10ul, 42 DEG C of warm bath 1h.
1.2.3LD PCR (long range PCR)
It is added following reagent in 0.25ml reaction tube, total volume is 100 μ l: above-mentioned 3.0 μ l of the first chain of cDNA product,
ddH2O 79μl、10×Advantage 2PCR Buffer 10μl、50×dNTP Mix2.0μl、PCR Primer M1 4.0
μl,50×Advantage Polymerase Mix 2.0μl;After brief centrifugation mixes, with 95 DEG C of following programs, 1min, 95 DEG C
15s, 66 DEG C of 20s, 72 DEG C of 4min carry out 18 circulations, obtain double-strand cDNA.
1.2.4 resulting PCR product protease K digesting
The double-strand cDNA of 100 μ l PCR amplifications is added in 0.5ml reaction tube, is added 4 μ l Proteinase Ks (20 μ g/ μ l), mixes
Even and of short duration centrifugation;45 DEG C of warm bath 20min;Isometric phenol: chloroform is added: isoamyl alcohol acutely shakes 1-2min;14,000rpm from
Heart 5min;Take supernatant liquid into another clean centrifuge tube, in another clean centrifuge tube;The 3M acetic acid of 1/10 volume is added
Sodium, the ethyl alcohol of 2.5 times of volumes 95%, room temperature 14,000rpm are centrifuged 20min;Supernatant is abandoned, it is heavy with 100 μ l, 80% ethanol washing
It forms sediment;Dry sediment about 10min;Add the deionized water dissolving of 25 μ l.
1.2.5 library uniforms
1.2.5.1 hybridization
Be added in 0.2ml PCR pipe: 3 μ l of above-mentioned ds cDNA (1 μ g), 2 × Hybridization buffer, 8 μ l,
ddH2O 4μl;Total volume is 16 μ l;Above-mentioned solution is divided into 4 parts, is placed in 0.2ml PCR pipe;By PCR pipe in PCR instrument
Upper 98 DEG C are placed 2 minutes;It is quickly transferred to be ready to afterwards, acts on 5h in 68 DEG C of PCR instruments.
1.2.5.2DSN digestion
It is separately added into 4 PCR pipes labeled as DSNP1,1/2DSNP1,1/4DSNP1 and controlP1: above-mentioned miscellaneous
After friendship 4 μ l of cDNA, 2 × DSN master buffer (68 DEG C preheating) 5 μ l, DSN solution (respectively DSN, 1/
2DSN, 1/4DSN, control) 1 μ l, total volume is 10 μ l, is mixed gently;By 4 PCR pipes, 68 DEG C of reaction 25min;In each pipe
10 μ l 2 × DSN stop buffer of middle addition are mixed;It is placed at room temperature for 5min, 20 DEG C of preservations.
1.2.5.3DSN twice PCR amplification amplification after digestion
A. amplify for the first time
In 1.2.5.2 labeled as in DSNP1,1/2DSNP1,1/4DSNP1 and controlP14 PCR pipes, successively distinguish
Following reagent: ddH is added2O 40.5μl、10×Advantage 2PCR Buffer 5μl、50×dNTP Mix 1μl、
1 μ l of product, total volume after Primer M11.5 μ l, 50 × Advantage 2Polymerase Mix, 1 μ l, 1.2.5.2 digestion
For 50 μ l.
Start PCR:95 DEG C of 1min, 95 DEG C of 15s, 66 DEG C of 20s, 72 DEG C of 3min, 11 circulations, from each pipe by following program
5 μ l electrophoresis are taken respectively, according to electrophoresis result, are selected suitable product (such as 1/4DSN) to carry out second for template and are amplified.
B. amplify for second
A. it is sequentially added in two PCR pipes: ddH2O 80μl、10×Advantage 2PCR Buffer Mix 10μ
L, 50 × dNTP, 2 μ l, 4 μ l, 50 × Advantage 2Polymerase Mix2 μ l of Primer M2, mixing, first after dilution
Secondary 2 μ l of amplification product (i.e. 1/4DSN P1, controlP1), every pipe total volume are 100 μ l, are respectively labeled as 1/4DSNP2,
controlP2;
PCR instrument is set in mixing, starts PCR:95 DEG C of 1min, 95 DEG C of 15s, 66 DEG C of 20s, 72 DEG C of 3min, 12 by following program
Circulation, after carry out 64 DEG C of 20s, 72 DEG C of 3min, 1 circulation again, 5 μ l electrophoresis, detection homogenization effect are taken after PCR respectively
Fruit.
1.2.6Sfi I digests
To secondary widened PCR product purification and recovery, after reagent is added in 0.5ml centrifuge tube: ds cDNA (2 μ g) 79 μ
L, 10 × Sfi Buffer, 10 μ l, 10 μ l of Sfi I Enzyme, 100 × BSA, 1 μ l total volume are 100 μ l, are mixed well, 50
DEG C warm bath 2h;Utilize phenol: chloroform drawer recycles Sfi I digestion product.
1.2.7cDNA it is connect with pPR3-N carrier
Be added in reaction tube following reagent: 10 μ l of ds cDNA, 2 μ l of pPR3-N Vector (50ng/ml), 10 ×
Ligation Buffer 2μl、ATP(10mM)2μl、T4DNA Ligase 2μl、ddH2O2 μ l, 10 μ l of total volume, 4 DEG C of connections
12-16h.Connection product converts BL21 competence, and bacterium solution dilutes 10 times and is coated on (Amp+/IPTG/x-gal on 15cm culture dish
LB solid medium), 37 DEG C are overnight, and calculate storage capacity.
The calculation formula of every milliliter of Escherichia coli library bacterium solution storage capacity is:
Volume × original bacterium solution extension rate × bacterium solution of bacterium solution is coated on clone's number/plate on CFU/ml=plate
Volume number
1.2.8 clone identification
1) positive colony of picking blue 24,37 DEG C of 200rpm overnight incubations take 1 μ l bacterium solution as pcr template.It presses
Following system sequentially adds reagent in PCR pipe: ddH2O 19.5μl、10×PCR Buffer2.5μl、50×dNTP Mix
0.5 μ l, 0.5 μ l of pPR3-N F, 0.5 μ l of pPR3-N R, 0.5 rTag μ l, 1 PCR μ l template mix, and total volume is 25 μ l.
Start PCR:94 DEG C of 3min by following program, 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 36 circulations, 72 DEG C,
5min takes 5ul electrophoresis respectively from each pipe, detects the segment of amplification.
2) in order to verify the quality in library, 50 monoclonals of random picking send biotech firm to be sequenced, the ESTs sequence of acquisition
BLAST compares analysis.
1.3 result
1.3.1 lamb Testis Caprae seu Ovis fibroblast (Fig. 1, the lamb Testis Caprae seu Ovis Fibroblast cell-culture 4-5 generation of preparation are prepared
Afterwards), and with trypsin digestion cell, RNA is extracted, the results showed that the RNA: concentration of extraction is 0.1295 μ g/ μ l, A260/280 value
2.05,28S/18S 1.5, the RNA of extraction meet the requirements (Fig. 2A, Testis Caprae seu Ovis cell total rna extract), the synthesis of the first chain of cDNA,
Different size of external source cDNA (Fig. 2 B, the ds cDNA of purifying) is amplified using universal primer, utilizes Dualsystem
Biotech kit successfully constructs Testis Caprae seu Ovis fibroblast film system yeast two-hybrid library, storage capacity are as follows: 7.5 ×
105, the segment of amplification is 200bp-2000bp;Average length: 1000bp, 24 clones have the band of specificity;Recombination fraction:
24/24*100%=100%, recombination fraction are that 100% (augmentation detection is as a result, Fig. 2 D cDNA library after the homogenization of the library Fig. 2 C
Insert Fragment detects, and the M in nucleic acid electrophoresis is DL2000).
1.3.2 after original bacterium solution dilutes 10 times, the product bacterium solution (shared 30ml) of cotransformation is taken, by 1/10,1/100 and 1/
1000 dilutions apply the plate of 100ul dilution to 15mm respectively, and 37 DEG C of inversion culture 3d are until clone occurs, at this time to growth
Single colonie count, according to above counting;Clump count on 15mm plate is 2500, obtains library according to method of counting
Storage capacity are as follows: 2500/1.0 × 10 × 30=7.5 × 105(referring to Fig. 3).
3) 91.11% ESTs is shared in the Random clones that the cloning and sequencing selected at random is selected as the result is shown is and sheep
Theoretical protein or mRNA be it is homologous, show to prepare Library Quality higher.
Embodiment 2: the screening of Testis Caprae seu Ovis fibroblast film system yeast cDNA library
2.1.1 the building of bait carrier
Utilize the upstream primer pBT3-N-ORF047- (SEQ ID NO1) of design:
5'ATTAACAAGGCCATTACGGCCGGGGCCGCCGCCAGCATCCAGACCACC 3',
The downstream pBT3-N-ORF047- (SEQ ID NO2):
5'-GACGGACGGCGGAAATTCCGTAAAGGGGCCGCCTCGGCCATCAGTT 3', with PCR from this laboratory
(Chen Guohua etc., sheep infective pustule virus ORF047 gene expression and its albumen are in cell by the pGEM-ORF-047 constructed
Positioning analysis, Chinese Amphixenosis's journal, 2018.2,34 (2): 67~70) plasmid amplification purpose product ORF-O47 gene
(ORF-O47 gene order SEQ ID NO3) recycles amplified fragments with DNA QIAquick Gel Extraction Kit, and limits with pBT3-N plasmid
Property I digestion of restriction endonuclease Sfi, the connection of T4DNA ligase, target fragment is successively cloned into pBT3-N bait carrier, conversion to DH5 α,
Positive colony is selected, sequencing is carried out, it is pBT3-N-ORF047 that correct clone designation, which is sequenced,.
2.1.2 the identification of bait plasmid
The bait carrier that sequencing identification is built, prepares plasmid, converts in a small amount with reference to yeast two-hybrid specification and yeast
Step prepares NMY51 competent yeast, by pTSu2-APP and pNubG-Fe65, pTSu2-APP and pPR3-N, and pBT3-N-
ORF047 and pOst1-NubI, pBT3-N-ORF047 and pPR3-N bait plasmid difference transformed yeast NMY51 competence, every group
Cell is resuspended in 0.9% NaCl that conversion reaction finally uses 450 μ l sterile, and draws 150 μ L re-suspension liquids respectively and be coated on SD-
On trp-leu, SD-trp-leu-his, SD-trp-leu-his-ade medium agar plate, 30 DEG C of constant temperature carton upside down cultures 3~
4d observes bacterium colony growing state on plate, and whether there is or not self-excitation is activity and toxic effect for test bait plasmid.
2.1.3 the screening in library
By the Testis Caprae seu Ovis fibroblast film system yeast cDNA of the pBT3-N-ORF047 bait carrier built and building
It after Library plasmid cotransformation NMY51, cultivates, cultivates on screening and culturing medium SD-leu/-trp/-his/-ade/X-gal plate
4d has multiple clones to become blue after colour developing.Whole pickings shake bacterium, extract yeast plasmid, are sequenced after converting Escherichia coli,
And 3 positive interacting genes, sequencing point are obtained after carrying out AD plasmid and the one-to-one interaction verifying of BD plasmid revolution NMY51 saccharomycete
It Wei not ovis aries FLC, sheep poly A binding protein (ovis aries poly (A) binding protein4, PABPC4)
With sheep er stress relevant molecule (ovis aries Stress-associated endoplasmic reticulum,
SEPR1) related gene.
2.1.4 the interaction of co-immunoprecipitation verifying ORF-047 gene and sieved gene
Utilize the FLC- upstream primer (SEQ ID NO4) of design: 5'AAGCTTATGAGCTCCCAGATTCGTCAG3'
(HindIII), FLC- downstream primer (SEQ ID NO5): 5'GGATCCCTAGTCGTGCTTGAGGGTAAGC3'(BamHI);
PABPC4:- upstream primer (SEQ ID NO6): 5'AAGCTTATGAACGCTGCGGCCAGCAGC3'(HindIII),
PABPC4:- downstream primer (SEQ ID NO7): 5'GCGGCCGCCTAAGAGGTAGCAGCAGCAAC3'(NotI);ovis
SEPR1- upstream primer (SEQ ID NO8): 5'AAGCTTATGGTCGCCAAGCAGCGGATC3'(HindIII), ovis
SEPR1- upstream primer (SEQ ID NO9): 5'GAATTCTCACATGCCCATCCTGATAC3'(EcoRI) pass through from sheep RNA
RT-PCR technology expands ABPC4 (No. Genbank: XM 004001826.3);FLC (No. Genbank: XM 013106228);
The full-length gene of SERP1 (No. Genbank: XP014948090) this 3 molecules recycles amplified fragments with DNA QIAquick Gel Extraction Kit,
By the segment of recycling and pcDNA3.1-Flag plasmid digestion with restriction enzyme corresponding in above-mentioned primer, T4DNA ligase
Connection, target fragment are successively cloned into pcDNA3.1-Flag carrier, and positive colony is selected in conversion to DH5 α, carry out sequence survey
It is fixed, correct clone designation, PABPC4-pcDNA3.1-Flag, FLC-pcDNA3.1-Flag, SEPR1-pcDNA3.1- is sequenced
Flag, while ORF-047-pcDNA3.1-HA recombinant plasmid is constructed according to the above method.
ORF-047-pcDNA3.1-HA plasmid respectively with PABPC4-pcDNA3.1-Flag, FLC-pcDNA3.1-Flag,
SEPR1-pcDNA3.1-Flag plasmid co-transfection 293T cell, 37 DEG C, 5%CO2 incubator;Cell is collected after culture 45h, benefit
Cell is handled with cell pyrolysis liquid, collects supernatant;Supernatant a part carries out SDS-PAGE for doing control, utilizes anti-HA
Antibody West-bloting detection see whether the ORF-047-pcDNA3.1-HA of corotation and other plasmids express, another part with
It is marked with the co-immunoprecipitation magnetic bead combination 14h of anti-Flag antibody, then rear washing, denaturation, SDS-PAGE utilize anti-
HA and anti-Flag antibody carry out West-bloting detection, specify ORF-047 gene expression albumen and PABPC4, FLC,
Whether play the role of between the albumen of SEPR1 expression mutual.Co-immunoprecipitation the result shows that sheep of virus memebrane protein ORF-
There is interaction between 047 and host protein PABPC, SEPR1, FLC.
2.2 result
2.2.1 after carrier system positive controls pTSU2-APP+pNubG-Fe65 plasmid corotation competent yeast, in SD-
There are a large amount of bacterium colonies to grow on trp-leu, SD-his-leu-trp, SD-ade-his-leu-trp plate, but in SD-his-
The 10-100% (AP in figure) being grown on leu-trp, SD-ade-his-leu-trp on SD-trp-leu;Carrier system is negative
Control group pTSU2-APP+pPR3-N group has a large amount of bacterium colonies to grow on SD-trp-leu plate, in SD-his-leu-trp,
There are a small amount of bacterium colony growth or sterile length (AN in figure) of being born on SD-ade-his-leu-trp plate, illustrates that our conversion is that have
Effect.And the pBT3-N-ORF047+pOst1-NubI positive controls (BP in figure) and negative control group pBT3-N- of experimental group
After the plasmid transformed yeast bacterium of ORF047+pPR3-N (BN in figure), the case where the spot of growth and the result of quantity and carrier system
It is consistent, this illustrates that pBT3-N-ORF047 bait plasmid without self-activation and toxic effect, can be used for subsequent library screening
(such as Fig. 4, wherein AP:pTSU2-APP+pNubG-Fe65, AN:pTSU2-APP+pPR3-N;BP:pTSU2-APP+pPR3-N,
BN:pBT3-N-ORF047+pPR3-N.A:SD-leu-trp culture medium;B:SD-his-leu-trp culture medium;c:SD-ade-
His-leu-trp culture medium).
2.2.2 library screening culture 4d, after have multiple positive colonies become after colour developing it is blue (see Fig. 5, wherein positive colony
Blue, negative clone is white, schemes A, schemes B).
Co-immunoprecipitation is the result shows that have interaction between ORF-047 and host protein PABPC, SEPR1, FLC;Such as figure
Shown in 6, the ORF-047-pcDNA3.1-HA plasmid of building respectively with PABPC4-pcDNA3.1-Flag, FLC-pcDNA3.1--
Flag, SEPR-pcDNA3.1-Flag, pcDNA3.1-Flag recombinant plasmid cotransfection 293T cell are collected carefully after cultivating 45h
Born of the same parents, and with lysate lytic cell, supernatant is collected, a part utilizes Anti-HA antibody Western- as control SDA-PAGE
Blotting detection shows that the plasmid of cotransfection can express in cell, predominantly detects ORF-047-pcDNA3.1-HA table
The band reached is about 28KD (figure A);Another part after 14h, is washed in conjunction with label anti-Flag antibody mediated immunity co-precipitation magnetic bead
It washs, SDS-PAGE after denaturation, then carries out Western-blotting testing result using anti-HA antibody and show: using anti-
Flag antibody can will be mutual with PABPC4-pcDNA3.1-Flag, FLC-pcDNA3.1-Flag and SEPR-pcDNA3.1-Flag
The ORF-047-pcDNA3.1-HA albumen precipitation of effect gets off (figure B), ORF-047 expression all occurs in each group of cotransfection
Band 28KD, next using anti-Flag antibody Western-blotting detect, show PABPC4-pcDNA3.1-
The albumen of Flag, FLC-pcDNA3.1-Flag, SEPR-pcDNA3.1-Flag expression is correctly expressed (figure C), is schemed in C
PABPC4-Flag purpose band about 75KD, FLC-Flag purpose band are about 25KD, and SEPR-Flag purpose band is about 15KD.
A, B, C figure show and interact between PABPC, SEPR1, FLC gene of screening and ORF-047, illustrate the quality in the library compared with
It is good.
CDNA library provided by the invention theoretically contains the full gene information in host's sheep cell, screens for after
Research is provided for the albumen with Sheep-Associated virus such as sheep of virus, capripox virus memebrane protein and host cell interaction
Material.The library that the present invention constructs is that a kind of biological activity is good, storage capacity is big, the library of informative, study from now on
The host protein that sheep interacts between the sheep virus membrane antigen of host provides platform.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art
For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Sequence table
<110>Lanzhou Veterinary Inst., Chinese Acedemy of Agaricultural Sciences
<120>a kind of Testis Caprae seu Ovis fibroblast film system yeast cDNA library and construction method
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 48
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
attaacaagg ccattacggc cggggccgcc gccagcatcc agaccacc 48
<210> 2
<211> 46
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
gacggacggc ggaaattccg taaaggggcc gcctcggcca tcagtt 46
<210> 3
<211> 735
<212> DNA
<213> Parapoxvirus
<400> 3
atgggggccg ccgccagcat ccagaccacc gtgaccaccg tcagcgagcg catccgcaac 60
gagctcgagc agagcgcgag cgctagcgcg accgccgact gcgacgtcac catcgggagt 120
ctgattatcc gcaagaacct gggatgcagc gtttccgtcc ggaacatgtg ctcggccaac 180
gccggcgcgc agctggacgc cgtcatgaag gccgtgagca gcaccttcaa cgacctctcg 240
tcggaccaga aggcctacgt gcccgggctg ctcacggccg cgctcaacat ccagaccacg 300
gtgaacaccg ccgtcaagga cttcgagacg tacatgaagc agacctgcac ggcggacgca 360
gtcattcaca acaaaatcaa gatccaaaac atcgtcatgg aagagtgcgc ctctctgcca 420
gggagtccgg cctcgcacct ggagtttgtg aacaccggca cggccgcggg caactgcggc 480
gtgaaggccg tgatggacgt gctcgcgaag gccagcacca ccgtgcgcaa cgaccaggag 540
gccggcaagg gctaccagac catcatcatc gcgatcgtgg tcgccatcct ggcggccatc 600
ttcgcctggt acgcgcggca catgctattc atgtccacct ccgacaaaat caagctcgag 660
ctcgccaaga agcccgtggt gcactggacc acctacctgg acaccttctt tacggaattt 720
ccgccgtccg tctag 735
<210> 4
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
aagcttatga gctcccagat tcgtcag 27
<210> 5
<211> 28
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
ggatccctag tcgtgcttga gggtaagc 28
<210> 6
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
aagcttatga acgctgcggc cagcagc 27
<210> 7
<211> 29
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
gcggccgcct aagaggtagc agcagcaac 29
<210> 8
<211> 27
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 8
aagcttatgg tcgccaagca gcggatc 27
<210> 9
<211> 26
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 9
gaattctcac atgcccatcc tgatac 26
Claims (9)
1. a kind of preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library, comprising the following steps:
1) Testis Caprae seu Ovis fibroblast is prepared;
2) Testis Caprae seu Ovis fibroblast RNA is extracted;
3) cDNA is synthesized, cDNA library homogenization is carried out;
4) cDNA is connect with pPR3-N carrier, and connection product converts host cell DH5 α, obtains Testis Caprae seu Ovis fibroblast membrane body
It is yeast cDNA library, and carries out clone's verifying;
5) Testis Caprae seu Ovis fibroblast film system yeast cDNA library is screened.
2. the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library according to claim 1, feature
It is, the fibroblastic preparation method of Testis Caprae seu Ovis includes:
1) sterile to take out nascent Healthy Sheep lamb testis, it is washed 2-3 times with Hank ' s liquid, after rejecting sheath, tunica albuginea, then rinses 2-3
It is secondary;
2) parenchyma of testis is cut into the tissue block of 1-2mm size, 0.25% pancreatin digestive juice of 4 times of amounts is added, with 37 DEG C of water-baths
Middle digestion 30-40 minutes;
3) cell suspension is made with the nutrient solution containing 10% calf serum, with sodium bicarbonate tune pH to 7.0 or so, sets 25mm cell
In culture bottle, 37 DEG C, 5%CO2Culture, 3-4 days cells grow up to fine and close cell monolayer;
4) it is then washed 2 times using PBS, adds 1ml pancreatin, 37 DEG C, 5%CO2 placement 2min are added culture medium and divide according to a certain percentage
Other cell bottles are set, 5-6 generation is so passed, cell growth is stablized.
3. the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library according to claim 1, feature
It is, the method for extracting Testis Caprae seu Ovis fibroblast RNA is by step 1) the Testis Caprae seu Ovis Fibroblast cell-culture 5-6 generation
It is extracted and is obtained using Trizol reagent method afterwards.
4. the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library according to claim 1, feature
It is, the synthesis cDNA includes that reverse transcription method synthesis the first chain of cDNA synthesizes the second chain of cDNA with LD PCR.
5. the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library according to claim 1, feature
It is, the cDNA library homogenization includes hybridization processing, the amplification amplification of DSN digestion process, twice PCR, and is put twice to PCR
Big the step of carrying out Sfi I digestion.
6. the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library according to claim 1, feature
It is, the host cell DH5 α is host cell DH5 α competent cell.
7. the preparation method of Testis Caprae seu Ovis fibroblast film system yeast cDNA library according to claim 1, feature
It is, the screening Testis Caprae seu Ovis fibroblast film system yeast cDNA library includes building bait carrier, identification bait plasmid
With screening Testis Caprae seu Ovis fibroblast film system yeast cDNA library.
8. preparation method described in any one obtains Testis Caprae seu Ovis fibroblast film system yeast according to claim 1~7
CDNA library.
9. Testis Caprae seu Ovis fibroblast film system yeast cDNA library according to claim 8, which is characterized in that the library
Capacity is 7.5 × 105, the size of segment is 200-2000bp, and average length 1000bp, the recombination fraction in library is 100%.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810928386.0A CN108998443B (en) | 2018-08-15 | 2018-08-15 | Goat testis fibroblast membrane system yeast cDNA library and construction method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810928386.0A CN108998443B (en) | 2018-08-15 | 2018-08-15 | Goat testis fibroblast membrane system yeast cDNA library and construction method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN108998443A true CN108998443A (en) | 2018-12-14 |
CN108998443B CN108998443B (en) | 2021-02-02 |
Family
ID=64592927
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810928386.0A Active CN108998443B (en) | 2018-08-15 | 2018-08-15 | Goat testis fibroblast membrane system yeast cDNA library and construction method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108998443B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109680344A (en) * | 2018-12-19 | 2019-04-26 | 塔里木大学 | A kind of sheepskin skin tissue yeast cDNA library and its construction method |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103774241B (en) * | 2012-10-18 | 2015-04-08 | 华中农业大学 | Library versus library yeast two-hybrid massive interaction protein screening method |
-
2018
- 2018-08-15 CN CN201810928386.0A patent/CN108998443B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103774241B (en) * | 2012-10-18 | 2015-04-08 | 华中农业大学 | Library versus library yeast two-hybrid massive interaction protein screening method |
Non-Patent Citations (3)
Title |
---|
左兆云: "日粮维生素E对绵羊睾丸繁殖机能影响的分子机制初探", 《中国博士学位论文全文数据库农业科技辑》 * |
郑泽微: "羊口疮病毒编码的一种新型NF-kB核抑制剂002蛋白的分子机制", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 * |
陈国华等: "羊传染性脓疱病毒ORF047基因表达及其蛋白在细胞中的定位分析", 《中国人兽共患病学报》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109680344A (en) * | 2018-12-19 | 2019-04-26 | 塔里木大学 | A kind of sheepskin skin tissue yeast cDNA library and its construction method |
Also Published As
Publication number | Publication date |
---|---|
CN108998443B (en) | 2021-02-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10766949B2 (en) | Method for preparing whole bovine-derived broadly neutralizing antibody against serotype O foot-and-mouth disease virus | |
CN107058634A (en) | The type of Ana 1 aviadenovirus 2 and Ana 1 aviadenovirus A type double PCR detection primers and kit | |
CN107630024B (en) | Gene for coding H5 subtype avian influenza virus hemagglutinin protein and application thereof | |
CN107937349A (en) | Stablize cell line and its preparation and application of expression African swine fever virus P54 albumen | |
CN102864172B (en) | Leukemia mouse model based on gene co-transfection technology and preparation method thereof | |
WO2020224394A1 (en) | Fluorescent probe, primer pair, fluorescent quantitative pcr kit and detection method for detecting lentivirus | |
CN110157737A (en) | A kind of recombinant baculovirus for expressing African swine fever CD2V albumen in SF9 cell | |
CN107012261A (en) | Ana 1 aviadenovirus A types and the dual EvaGreen real-time fluorescence quantitative PCRs detection primer of 2 types | |
CN111471089A (en) | Recombinant African swine fever virus CD2V subunit protein and preparation method and application thereof | |
CN107533066A (en) | Mk system, particularly for baculovirus expression subunit antigen Mk system | |
CN108998443A (en) | A kind of Testis Caprae seu Ovis fibroblast film system yeast cDNA library and construction method | |
CN114107311A (en) | Target participating in porcine transmissible gastroenteritis virus infection and application thereof | |
Liu et al. | Engineered human mesenchymal stem cells as new vaccine platform for COVID-19 | |
CN109943576A (en) | A kind of recombinant rabies virus of chimeric canine distemper virus principal immune gene and its application | |
CN112779262B (en) | Application of pig RagC gene | |
CN110904056B (en) | Infectious bronchitis virus rH120-YZS1 delta 5a and construction method and application thereof | |
CN107018955A (en) | A kind of transgene pig of the type of resisting porcine circovirus 2 | |
CN117229421B (en) | African swine fever virus outer envelope protein CD2v extracellular domain target antigen specific epitope, antibody and application thereof | |
CN110878379A (en) | Matched identification and detection method for attenuated live vaccine similar to NADC30 PRRSV and application thereof | |
CN106800600B (en) | System for detecting tick-borne encephalitis virus infection | |
CN107881152A (en) | A kind of cell line and its construction method and application for being used to detect hepatitis A virus titre | |
CN116555456B (en) | Detection method and application of mycobacterium tuberculosis Ag85B mRNA | |
CN116479016B (en) | Bovine parainfluenza virus 3 full-length infectious clone and construction method and application thereof | |
CN113527463B (en) | Application of IFITM3 protein related substance in preparation of medicine for treating diseases caused by avian reovirus | |
CN116855503B (en) | Stable transgenic cell strain over-expressing MRGPRX2 and construction method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |