CN108982848A - A kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers - Google Patents
A kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers Download PDFInfo
- Publication number
- CN108982848A CN108982848A CN201810944925.XA CN201810944925A CN108982848A CN 108982848 A CN108982848 A CN 108982848A CN 201810944925 A CN201810944925 A CN 201810944925A CN 108982848 A CN108982848 A CN 108982848A
- Authority
- CN
- China
- Prior art keywords
- aptamers
- staphylococcus aureus
- methicillin
- resistant staphylococcus
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56938—Staphylococcus
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Urology & Nephrology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
Abstract
The methicillin-resistant staphylococcus aureus fluorescence detection method and its application that the invention discloses a kind of based on aptamers, detecting step includes: that the coated magnetic nano particle of IgG antibody, sample to be examined 1. will be sequentially added in container, it is incubated for after mixing, combines the coated magnetic nano particle of antibody sufficiently with the staphylococcus aureus in sample；2. collecting magnetic nano particle by externally-applied magnetic field, staphylococcus aureus lytic reagent is added after washing, is incubated for a period of time, under the action of an external magnetic field, collects bacterial lysate；3. bacterial lysate is added in the PBP2a albumen aptamers of fluorescent marker and the aptamers complementary dna chain hybrid product of quenching group label, it is incubated for after mixing；4. aptamers and its change in fluorescence of complementary dna chain hybrid product before and after bacterial lysate is added in measurement, PBP2a presence or absence is judged according to fluorescence change, can be realized the quick detection of methicillin-resistant staphylococcus aureus in clinical sample.
Description
Technical field
The present invention relates to drug tolerant bacteria detection fields, and in particular to a kind of methicillin-resistant staphylococcus based on aptamers
Staphylococcus fluorescence detection method and application.
Background technique
Staphylococcus aureus is that Hospitals at Present infects one of most common pathogenic bacteria, can cause skin and soft tissue sense
The serious diseases such as dye, bacteremia, endocarditis, pneumonia, bone and the infection of joint and central nervous system infection.Resist in recent years
Unreasonable use of raw element causes the quantity of methicillin-resistant staphylococcus aureus (MRSA) to be continuously increased.Since MRSA is passed
It is fast to broadcast speed, Epidemic Scope is wide, in addition to methicillin resistance, to other beta-lactams and the equal drug resistance of cephalosporin analog antibiotic,
Aminoglycoside, macrolides, Tetracyclines, fluorine quinolione class, sulfamido, rifampin are also generated different degrees of resistance to
Medicine causes its caused treatment of infection difficult, it has also become serious clinical and public health problem.It is golden yellow with methicillin-sensitivity
Color staphylococcus (MSSA) is compared, and the bacteremia death rate caused by MRSA is higher.Vancomycin is the last for the treatment of MRSA infection
One of defence line.However, the MSSA bacteremia death rate for receiving vancomycin treatment is higher compared with Beta-lactam medicine.Cause
This, Rapid identification MRSA is of great significance for reasonably selecting antibacterials.Methicillin resistance is by chromosome mapping
MecA gene mediated, which encodes a kind of new penicillin binding protein PBP2a, PBP2a and bacterium others penicillin
Binding protein equally has the function of synthesis bacteria cell wall, but very low to the affinity of Beta-lactam medicine, therefore even if
Can also staphylococcus be made to survive in the beta-lactam antibiotic of high concentration.
Having been developed at present a variety of includes that phenotypic susceptibility tests (cefoxitin, oxacillin meat soup
Dilution method), detection mecA gene molecular biology method (PCR is goldstandard), detect PBP2a albumen enzyme linked immunological inhale
A variety of methods such as adhesion test (ELISA) and latex agglutination test, for detecting MRSA.Phenotypic susceptibility test operation is simple, at
This is low, but due to needing to carry out being separately cultured for bacterium, generally requires longer detection cycle (24 hours or more).Round pcr
High sensitivity, high specificity, but since a part of mecA gene is cryptiogene, mecA gene product PBP2a is not expressed, because
There are the possibility of false positive for this, and when, there are when mixed infection, the specificity of detection can also reduce in sample.ELISA method and
Although Latex Agglutination shortens detection cycle, but since staphylococcal protein A can be with mammal IgG antibody
Fc segment combine, in order to specifically detect PBP2a, it is necessary to extract PBP2a albumen from bacterium, and in kit
Monoclonal antibody preparation process used is cumbersome, higher cost.Latex agglutination kit also relies on import at present, and price is high
It is expensive.Therefore, it needs to develop a kind of sensitive, quick, easy MRSA detection method.
Aptamers are a kind of oligonucleotide fragments that can be specifically bound with target molecule, and aptamers are substituted traditional immunization
Antibody used in detection method is learned, can be avoided staphylococcal protein A and mammal IgG antibody Fc segment knot
The problem of antibody caused by conjunction and S. aureus L-forms non-specific binding, and aptamers are easily prepared and mark, therefore aptamers can
Make up the deficiency of existing MRSA immunological detection method.
Summary of the invention
It is an object of the invention to a kind of resistance to methoxy west based on aptamers is provided in place of overcome the deficiencies in the prior art
Woods staphylococcus aureus fluorescence detection method, including following detecting step:
(1) the coated magnetic nano particle of IgG antibody, sample to be examined will be sequentially added in container, 25 DEG C~40 after mixing
15 min~60min is reacted in DEG C temperature, keeps the coated magnetic nano particle of antibody and the staphylococcus aureus in sample abundant
In conjunction with；
(2) magnetic nano particle is collected by externally-applied magnetic field, staphylococcus aureus lytic reagent is added after washing, at 25 DEG C
15min-60min is reacted in~40 DEG C of temperature, under the action of an external magnetic field, collects bacterial lysate；
(3) by step (2) bacterial lysate be added to fluorescent marker PBP2a albumen aptamers and quenching group label
In aptamers complementary DNA chain hybrid product, 15min~60min is reacted in 22 DEG C~40 DEG C temperature；
(4) aptamers and its change in fluorescence of complementary dna chain hybrid product before and after bacterial lysate is added in measurement, according to glimmering
Light changing value judges PBP2a existence.
Preferably, in step (1), the antibody can be with the institute in conjunction with staphylococcal protein A for its Fc segment
There is IgG class antibody.
Preferably, in step (2), the staphylococcus aureus lytic reagent is containing can make staphylococcus aureus
The solution of the biological enzyme of cell wall cracking.
Preferably, in step (3), the aptamers are all aptamers of energy specific recognition PBP2a albumen.
Preferably, in step (3), the PBP2a albumen aptamers of the fluorescent marker, the fluorophor for label can
To be all fluorophors that can be used for nucleic acid marking including fluorescein isothiocynate (FITC).
Preferably, in step (3), the PBP2a albumen aptamers of the fluorescent marker are adapted to what quenching group marked
The concentration ratio of body complementary dna chain is 1:(1~3).
Preferably, in step (4), FITC fluorescence detection excitation wavelength is 485nm, launch wavelength 520nm, to test sample
This fluorescence change measures change in fluorescence average value more than negative control three times and three times standard deviation is added to be the PBP2a positive.
Preferably, the different complementary dna chain dosages that the fluorescent marker aptamers are marked from quenching group are 100 μ
L, concentration are 100 nmol/L, and hybridization conditions are 25 DEG C of reaction 1h, and the concentration of methicillin-resistant staphylococcus aureus N315 is
108CFU/mL。
Preferably, the externally-applied magnetic field is to pass through BeyoMagTMMagneto separate frame (12 hole) realizes that magnetic nanoparticle is carboxylic
The magnetic nano-particle of the partial size 800nm of base modification, staphylococcus aureus lytic reagent are 50 μ g/mL.
Preferably, the detection method uses the methicillin-resistant staphylococcus aureus fluorescence detection side based on aptamers
Method detects PBS (Fig. 4) and simulates various concentration methicillin-resistant staphylococcus aureus N315 in oropharyngeal swab specimen (Fig. 5)
Fluorescence change；Wherein simulation oropharyngeal swab specimen is detected as negative healthy volunteer's throat swab use by staphylococcus aureus
Various concentration is added in sterile PBS methicillin-resistant staphylococcus aureus N315 after diluting 10 times is made, PBS and simulation pharynx
Staphylococcus aureus concentration in swab specimen is from 10 to 108CFU/mL。
The used PBP2a aptamers of the present invention, are purchased from Sangon Biotech (Shanghai) Co., Ltd., address: Shanghai
Songjiang District of city road Xiang Min 698, deposit number: M23.
The PBP2a aptamers sequence are as follows:
5’-CCATCCACACTCCGCAAGGGTGCCCCGGGGGGCTGTTCAGCGTGGTGGTGGGATGCCGTTTTGGTC
CTTAGTCTCCGTCGTCGGCTGCCTCTACAT-3 ', 5 ' end mark fluorophor FITC；
Preferably, the aptamers complementary dna chain sequence is respectively as follows:
5’-GCGGAGTGTGGATGG-DABCYL-3’(Q-DNA-1),5’-CCTTGCGGAGTGTGG-DABCYL-3’(Q-
DNA-2) and 5 '-CACCCTTGCGGAGTG-DABCYL-3 ' (Q-DNA-3), 3 ' ends mark quenching group DABCYL.
Preferably, the externally-applied magnetic field is to pass through BeyoMagTMMagneto separate frame (12 hole) realizes that staphylococcus aureus is split
Solution reagent is 50 μ g/mL.
In addition, the present invention also provides a kind of methicillin-resistant staphylococcus aureus fluorescence detection side based on aptamers
The application of method.
The present invention is enriched with the staphylococcus aureus in sample by magnetic separation technique, cracks bacterium to discharge PBP2a egg
It is white；After the aptamers complementary dna chain hybridization of PBP2a albumen aptamers and the quenching group label of fluorescent marker, aptamers subscript
The fluorescence of note is quenched, and after staphylococcus aureus pyrolysis product is added, the PBP2a of MRSA release can be with aptamers spy
Strange land combines, and the aptamers complementary DNA chain for marking quenching group is dissociated from aptamers, and the fluorescence marked in aptamers obtains
To restore, the quick detection for being able to achieve MRSA in sample there is no need to extract PBP2a.
The invention has the following advantages that
(1) present invention solves golden yellow with antibody used in PBP2a aptamers substitution traditional immunization detection method
Staphylococcal protein A in conjunction with mammal IgG antibody Fc segment caused by antibody and S. aureus L-forms non-specific binding ask
Topic, and aptamers are easily prepared and mark, therefore this invention simplifies PBP2a cumbersome in PBP2a immunology detection to extract
The preparation of journey and monoclonal antibody reduces the cost of PBP2a detection.
(2) staphylococcus aureus that the present invention is enriched in sample by the way that magnetic separation technique is immunized, simplifies conventional bacteria
Bacterium is separately cultured step in sensitivity tests, shortens detection cycle, while the spirit of detection is improved by enrichment process
Sensitivity.
In order to which the object of the invention, technical solution and advantage is more clearly understood, with reference to the accompanying drawings and embodiments, to this
Invention is further elaborated.It should be appreciated that described herein, specific examples are only used to explain the present invention, not
For limiting the present invention.
Detailed description of the invention
Fig. 1 is the fluorescent value and addition after the different complementary dna chains hybridization that fluorescent marker aptamers are marked from quenching group
Fluorescent value after methicillin-resistant staphylococcus aureus lysate, wherein fluorescent marker aptamers and quenching group mark
Different complementary dna chain dosages are 100 μ L, and concentration 100nmol/L, hybridization conditions are 25 DEG C of reaction 1h, methicillin-resistant gold
The concentration of staphylococcus aureus N315 is 108CFU/mL；
When Fig. 2 is that fluorescent marker aptamers are different from the best complementary dna chain hybridization of various concentration that quenching group marks
Between after fluorescent value, wherein fluorescent marker aptamers dosage be 100 μ L, concentration 100nmol/L, quenching group label it is mutual
Benefit DNA chain dosage is 100 μ L, and concentration is respectively 100,150,200 and 300nmol/L, reaction time 1h, is surveyed every 5min
Determine first order fluorescence value；
Fig. 3 is that addition methicillin-resistant is golden yellow after fluorescent marker aptamers hybridize with the complementary dna chain that quenching group marks
The fluorescent value of different time is reacted after color staphylolytic liquid, wherein fluorescent marker aptamers mark mutual with quenching group
Mending DNA chain dosage is 100 μ L, and concentration is respectively 100nmol/L and 200nmol/L, methicillin-resistant staphylococcus aureus
The concentration of N315 is 108CFU/mL, reaction time 1h measure first order fluorescence value every 5min.
Fig. 4 is that detection method of the embodiment of the present invention uses the methicillin-resistant staphylococcus aureus fluorescence based on aptamers
Detection method detects various concentration methicillin-resistant staphylococcus aureus in PBS (Fig. 4) and simulation oropharyngeal swab specimen (Fig. 5)
The fluorescence change of N315.Wherein simulation oropharyngeal swab specimen is detected as negative healthy volunteer's pharynx by staphylococcus aureus
Swab with sterile PBS dilute 10 times after be added various concentration methicillin-resistant staphylococcus aureus N315 be made, PBS and
Staphylococcus aureus concentration in simulation oropharyngeal swab specimen is from 10 to 108CFU/mL.Interior illustration is embodiment detection method
Detect the range of linearity of methicillin-resistant staphylococcus aureus N315 and the curvilinear equation of fitting.
Fig. 5 is 10 to 10 in present invention method measurement simulation oropharyngeal swab specimen8Resistance to methoxy west in CFU/mL concentration range
The fluorescence intensity change value of woods staphylococcus aureus N315, while with the methicillin-sensitivity golden yellow grape of same concentrations
Coccus AB91118 increases as control, fluorescence intensity change value with the increase of N315 concentration, and 103To 105CFU/mL
Good linear relationship is presented in concentration range, negative control group fluorescence intensity change value is without significant change.Result above is abundant
Illustrate the present invention design had based on the fluorescence detection method of aptamers to methicillin-resistant staphylococcus aureus it is good
Response, and not by thallus in addition to PBP2a other drive members interference, to PBP2a have well selectivity.
Fig. 6 is that detection method of the embodiment of the present invention uses the methicillin-resistant staphylococcus aureus fluorescence based on aptamers
Change in fluorescence of the detection method detection from the simulation oropharyngeal swab specimen of different clinical samples staphylococcus aureus separation strains
Value.Healthy volunteer's throat swab that wherein simulation oropharyngeal swab specimen is detected as feminine gender by staphylococcus aureus is dilute with sterile PBS
10 are separately added into after releasing 10 times4The S. atreus clinical separation strains of CFU/mL are made.
Fig. 7 is the methicillin-resistant staphylococcus aureus fluorescence detection method flow chart of steps of aptamers of the present invention.
Fig. 8 is the fluorescent value after fluorescent marker aptamers (aptamers M25) hybridize with the complementary dna chain that quenching group marks
And the fluorescent value after methicillin-resistant staphylococcus aureus lysate, wherein fluorescent marker aptamers and quenching group is added
The complementary dna chain dosage of label is 100 μ L, and concentration 100nmol/L, hybridization conditions are 25 DEG C of reaction 1h, methicillin-resistant
The concentration of staphylococcus aureus N315 is 108 CFU/mL。
Specific embodiment
Combined with specific embodiments below and figure is further explained explanation to the present invention, it should be appreciated that these embodiments are only
For illustrating the present invention rather than limiting the scope of the invention.In addition, it should also be understood that, the scope of the present invention is not limited thereto, readding
After having read the content of the invention lectured, those skilled in the art can make various modifications or changes to the present invention, these are of equal value
Form is also fallen within the scope of the appended claims of the present application.
In the present embodiment, microplate reader used in fluoremetry is the multi-functional micropore board detector of Tecan, model
SPARK。
Embodiment 1
(1) magnetic nanoparticle used in the embodiment of the present invention is the magnetic nano particle of the partial size 800nm of carboxyl modified
Son is purchased from Wuhan Jia Yuan technology of quantum dots Development Co., Ltd.PBP2a aptamers, by raw work bioengineering (Shanghai) stock
The synthesis of part Co., Ltd, address: the Shanghai Songjiang area road Xiang Min 698, deposit number: M23
PBP2a aptamers sequence are as follows:
5’-CCATCCACACTCCGCAAGGGTGCCCCGGGGGGCTGTTCAGCGTGGTGGTGGGATGCCGTTTTGGTC
CTTAGTCTCCGTCGTCGGCTGCCTCTACAT-3 ', 5 ' end mark fluorophor FITC；
Aptamers complementary dna chain sequence is respectively as follows: 5 '-GCGGAGTGTGGATGG-DABCYL-3 ' (Q-DNA-1),
5 '-CCTTGCGGAGTGTGG-DABCYL-3 ' (Q-DNA-2) and
5 '-CACCCTTGCGGAGTG-DABCYL-3 ' (Q-DNA-3), 3 ' ends mark quenching group DABCYL.
(2) aptamers that the present embodiment is marked based on the fluorescent marker PBP2a aptamers and quenching group of above-mentioned synthesis are mutual
DNA chain is mended, establishes highly sensitive, highly selective fluorescent detection system, the detection for MRSA PBP2a.
Detecting step includes:
1. the coated magnetic nano particle of IgG antibody, sample to be examined will be sequentially added in container, reacted after mixing at 37 DEG C
30min combines the coated magnetic nano particle of antibody sufficiently with the staphylococcus aureus in sample；
2. collecting magnetic nano particle by externally-applied magnetic field, staphylococcus aureus lytic reagent is added after washing, 37 DEG C anti-
30min is answered, under the action of an external magnetic field, collects bacterial lysate；
3. the aptamers that bacterial lysate is added to the PBP2a albumen aptamers of fluorescent marker and quenching group marks are mutual
It mends in DNA chain hybrid product, 37 DEG C of reaction 30min；
4. aptamers and its change in fluorescence of complementary dna chain hybrid product before and after bacterial lysate is added in measurement, according to glimmering
Light changing value judges PBP2a presence or absence.
Step 1. in, the coated magnetic nano particle dosage of IgG antibody be 10 μ L (10mg/mL), sample to be examined be 100 μ L
Concentration is 105The staphylococcus aureus N315 bacterial strain of CFU/mL.
Step 2. in, externally-applied magnetic field be the green skies Bioisystech Co., Ltd in Shanghai BeyoMagTMMagneto separate frame (12
Hole), staphylococcus aureus lytic reagent is the production of 50 Wuhan μ g/mL Sai Sirui Microbial Technics Ltd
staphylococci lysine。
Step 3. in, the aptamers complementary dna chain of the PBP2a albumen aptamers and quenching group of fluorescent marker label is used
Amount is respectively 100 nmol/L and 200nmol/L, and hybridization conditions are 25 DEG C of reaction 30min.
Step 4. in, fluorescence detection excitation wavelength be 485nm, launch wavelength 520nm, sample to be tested fluorescence change
Measuring change in fluorescence average value three times more than negative control adds three times standard deviation to be the PBP2a positive.
(3) the methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers is applied, through this embodiment
Condition detect staphylococcus aureus methicillin-susceptible, specific flow chart as shown in fig. 7, result as shown in figures 1 to 6:
The result shows that present invention design can effectively realize, methicillin-resistant staphylococcus aureus is highly sensitive, Gao Xuan
The detection of selecting property.
1) as shown in Figure 1, Figure 2, Figure 3 shows, in order to preferably realizing the effective of methicillin-resistant staphylococcus aureus
Detection, the present invention have studied quenching group label different aptamers complementary dna chains, fluorescent marker PBP2a aptamers and quench
The aptamers complementary dna chain dosage and hybridization conditions of the group that goes out label, methicillin-resistant staphylococcus aureus lysate and suitable
The influence of ligand and its complementary dna chain hybrid product action time to testing result.Optimum results show that detection architecture is best
Aptamers complementary dna chain is Q-DNA-2, the aptamers complementary DNA of PBP2a aptamers and the quenching group label of fluorescent marker
Chain optium concentration is respectively 100nM and 200nM, and hybridization conditions are 25 DEG C of 30 min of reaction, methicillin-resistant staphylococcus grape ball
Bacterial lysate and aptamers and its complementary dna chain hybrid product reaction time are 25min.
2) detection of PBS and various concentration methicillin-resistant staphylococcus aureus N315 in simulation oropharyngeal swab specimen.?
Under the optimum reaction condition of optimization, measured respectively using present invention method a series of in PBS and simulation oropharyngeal swab specimen
The methicillin-resistant staphylococcus aureus N315 of various concentration, as a result as shown in Figure 4, Figure 5.Fig. 4 shows implementation of the present invention
10 to 10 in example method measurement PBS8The fluorescence intensity of methicillin-resistant staphylococcus aureus N315 in CFU/mL concentration range
Changing value, while using the Methicillin Sensitive Staphylococcus aureus AB91118 of same concentrations as control, fluorescence intensity becomes
Change value increases with the increase of N315 concentration, and 103To 105Good linear relationship is presented in CFU/mL concentration range,
Negative control group fluorescence intensity change value is without significant change；Fig. 5 shows present invention method measurement simulation throat swab mark
10 to 10 in this8The fluorescence intensity change value of methicillin-resistant staphylococcus aureus N315 in CFU/mL concentration range, simultaneously
Using the Methicillin Sensitive Staphylococcus aureus AB91118 of same concentrations as control, fluorescence intensity change value is dense with N315
The increase of degree and increase, and 103To 105Good linear relationship is presented in CFU/mL concentration range, negative control group is glimmering
Intensity variation value is without significant change.Result above has absolutely proved the fluorescence detection side based on aptamers of the invention designed
Method has good response to methicillin-resistant staphylococcus aureus, and not by thallus in addition to PBP2a other drive members
Interference, to PBP2a have well selectivity.
3) clinical sample is analyzed.Different clinical samples Staphylococcus aureus are derived from using present invention method measurement
The fluorescence change of the simulation oropharyngeal swab specimen of bacterium separation strains, measurement result and Mei Liai VITEK2Compact automatic bacterial
It identifies and Analysis of Drug Susceptibility network analysis result consistency is 100%.The above results explanations, the present invention design in aptamers
Fluorescence detection new method can effectively realize methicillin-resistant staphylococcus aureus in people's oropharyngeal swab specimen it is highly sensitive,
Highly selective detection, and preparation and the extracting of PBP2a albumen without monoclonal antibody, are in efficient detection clinical sample
Methicillin-resistant staphylococcus aureus provide effective way, have potential application.
1 clinical sample information of table and the identification of Mei Liai VITEK2Compact automatic bacterial and Analysis of Drug Susceptibility network analysis
As a result
aThe present embodiment measures clinical sample using the full-automatic Analysis of Drug Susceptibility system cooperation GP-AST card of VITEK2Compact
Staphylococcus aureus in this is to the sensibility of a variety of antibacterials including oxacillin, wherein oxacillin
Concentration range is 0.25-4 μ g/mL, is MSSA as the μ g/mL of staphylococcus aureus MIC≤2, as the μ g/mL of MIC >=4,
For MRSA.
Embodiment 2
(1) magnetic nanoparticle used in the embodiment of the present invention is the magnetic nano particle of the partial size 800nm of carboxyl modified
Son is purchased from Wuhan Jia Yuan technology of quantum dots Development Co., Ltd.PBP2a aptamers, by raw work bioengineering (Shanghai) stock
The synthesis of part Co., Ltd, address: the Shanghai Songjiang area road Xiang Min 698, deposit number: M25.
PBP2a aptamers sequence are as follows:
5’-CCATCCACACTCCGCAAGGGTCGGTCTTCCCCTTCAGCTTGATGGGGTCCTGGGTGCCGGGATTTG
GTTGCTGGTCTTCGTCGGCTGCCTCTACAT-3 ', 5 ' end mark fluorophor FITC；Aptamers complementary dna chain sequence
Are as follows: 5-CCTTGCGGAGTGTGG-DABCYL-3 ' (Q-DNA-2), 3 ' end mark quenching group DABCYL.
(2) aptamers that the present embodiment is marked based on the fluorescent marker PBP2a aptamers and quenching group of above-mentioned synthesis are mutual
DNA chain is mended, establishes highly sensitive, highly selective fluorescent detection system, the detection for MRSA PBP2a.
Detecting step includes:
1. the coated magnetic nano particle of IgG antibody, sample to be examined will be sequentially added in container, reacted after mixing at 25 DEG C
60min combines the coated magnetic nano particle of antibody sufficiently with the staphylococcus aureus in sample；
2. collecting magnetic nano particle by externally-applied magnetic field, staphylococcus aureus lytic reagent is added after washing, 25 DEG C anti-
60min is answered, under the action of an external magnetic field, collects bacterial lysate；
3. bacterial lysate to be added to the PBP2a albumen aptamers (aptamers M25) and quenching group mark of fluorescent marker
In the aptamers complementary dna chain hybrid product of note, 25 DEG C of reaction 60min；
4. aptamers and its change in fluorescence of complementary dna chain hybrid product before and after bacterial lysate is added in measurement, according to glimmering
Light changing value judges PBP2a presence or absence.
Step 1. in, the coated magnetic nano particle dosage of IgG antibody be 10 μ L (10mg/mL), sample to be examined be 100 μ L
Concentration is 108The staphylococcus aureus N315 bacterial strain of CFU/mL.
Step 2. in, externally-applied magnetic field be the green skies Bioisystech Co., Ltd in Shanghai BeyoMagTMMagneto separate frame (12
Hole), staphylococcus aureus lytic reagent is the production of 50 Wuhan μ g/mL Sai Sirui Microbial Technics Ltd
staphylococci lysine。
Step 3. in, the aptamers complementary dna chain of the PBP2a albumen aptamers and quenching group of fluorescent marker label is used
Amount is respectively 100 nmol/L and 200nmol/L, and hybridization conditions are 25 DEG C of reaction 30min.
Step 4. in, fluorescence detection excitation wavelength be 485nm, launch wavelength 520nm, sample to be tested fluorescence change
Measuring change in fluorescence average value three times more than negative control adds three times standard deviation to be the PBP2a positive.
(3) the methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers is applied, through this embodiment
Condition detect staphylococcus aureus methicillin-susceptible, specific flow chart as shown in fig. 7, measurement fluorescent value, as a result with figure
1-6 is similar, and the fluorescent value and addition after wherein fluorescent marker aptamers M25 hybridizes with the complementary dna chain that quenching group marks are resistance to
Fluorescent value result after the staphylococcus aureus lysate of methicillin is as shown in Figure 8:
The result shows that present invention design can effectively realize, methicillin-resistant staphylococcus aureus is highly sensitive, Gao Xuan
The detection of selecting property.
Embodiment 3
(1) magnetic nanoparticle used in the embodiment of the present invention is the magnetic nano particle of the partial size 800nm of carboxyl modified
Son is purchased from Wuhan Jia Yuan technology of quantum dots Development Co., Ltd.PBP2a aptamers, by raw work bioengineering (Shanghai) stock
The synthesis of part Co., Ltd, address: the Shanghai Songjiang area road Xiang Min 698, deposit number: M23
PBP2a aptamers sequence are as follows:
5’-CCATCCACACTCCGCAAGGGTGCCCCGGGGGGCTGTTCAGCGTGGTGGTGGGATGCCGTTTTGGTC
CTTAGTCTCCGTCGTCGGCTGCCTCTACAT-3 ', 5 ' end mark fluorophor FITC；
Aptamers complementary dna chain sequence is respectively as follows: 5 '-GCGGAGTGTGGATGG-DABCYL-3 ' (Q-DNA-1),
5 '-CCTTGCGGAGTGTGG-DABCYL-3 ' (Q-DNA-2) and
5 '-CACCCTTGCGGAGTG-DABCYL-3 ' (Q-DNA-3), 3 ' ends mark quenching group DABCYL.
(2) aptamers that the present embodiment is marked based on the fluorescent marker PBP2a aptamers and quenching group of above-mentioned synthesis are mutual
DNA chain is mended, establishes highly sensitive, highly selective fluorescent detection system, the detection for MRSA PBP2a.
Detecting step includes:
1. the coated magnetic nano particle of IgG antibody, sample to be examined will be sequentially added in container, reacted after mixing at 40 DEG C
15min combines the coated magnetic nano particle of antibody sufficiently with the staphylococcus aureus in sample；
2. collecting magnetic nano particle by externally-applied magnetic field, staphylococcus aureus lytic reagent is added after washing, 40 DEG C anti-
15min is answered, under the action of an external magnetic field, collects bacterial lysate；
3. bacterial lysate to be added to the PBP2a albumen aptamers (aptamers M23) and quenching group mark of fluorescent marker
In the aptamers complementary dna chain hybrid product of note, 40 DEG C of reaction 15min；
4. aptamers and its change in fluorescence of complementary dna chain hybrid product before and after bacterial lysate is added in measurement, according to glimmering
Light changing value judges PBP2a presence or absence.
Step 1. in, the coated magnetic nano particle dosage of IgG antibody be 10 μ L (10mg/mL), sample to be examined be 100 μ L
Concentration is 108The staphylococcus aureus N315 bacterial strain of CFU/mL.
Step 2. in, externally-applied magnetic field be the green skies Bioisystech Co., Ltd in Shanghai BeyoMagTMMagneto separate frame (12
Hole), staphylococcus aureus lytic reagent is the production of 50 Wuhan μ g/mL Sai Sirui Microbial Technics Ltd
staphylococci lysine。
Step 3. in, the aptamers complementary dna chain of the PBP2a albumen aptamers and quenching group of fluorescent marker label is used
Amount is respectively 100 nmol/L and 300nmol/L, and hybridization conditions are 25 DEG C of reaction 60min.
Step 4. in, fluorescence detection excitation wavelength be 485nm, launch wavelength 520nm, sample to be tested fluorescence change
Measuring change in fluorescence average value three times more than negative control adds three times standard deviation to be the PBP2a positive.
(3) the methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers is applied, through this embodiment
Condition detect staphylococcus aureus methicillin-susceptible, specific flow chart as shown in fig. 7, measurement fluorescent value, as a result with figure
8 is similar.
The result shows that present invention design can effectively realize, methicillin-resistant staphylococcus aureus is highly sensitive, Gao Xuan
The detection of selecting property.
Embodiment 4
(1) magnetic nanoparticle used in the embodiment of the present invention is the magnetic nano particle of the partial size 800nm of carboxyl modified
Son is purchased from Wuhan Jia Yuan technology of quantum dots Development Co., Ltd.PBP2a aptamers, by raw work bioengineering (Shanghai) stock
The synthesis of part Co., Ltd, address: the Shanghai Songjiang area road Xiang Min 698, deposit number: M23
PBP2a aptamers sequence are as follows:
5’-CCATCCACACTCCGCAAGGGTGCCCCGGGGGGCTGTTCAGCGTGGTGGTGGGATGCCGTTTTGGTC
CTTAGTCTCCGTCGTCGGCTGCCTCTACAT-3 ', 5 ' end mark fluorophor FITC；
Aptamers complementary dna chain sequence is respectively as follows: 5 '-GCGGAGTGTGGATGG-DABCYL-3 ' (Q-DNA-1),
5 '-CCTTGCGGAGTGTGG-DABCYL-3 ' (Q-DNA-2) and
5 '-CACCCTTGCGGAGTG-DABCYL-3 ' (Q-DNA-3), 3 ' ends mark quenching group DABCYL.
(2) aptamers that the present embodiment is marked based on the fluorescent marker PBP2a aptamers and quenching group of above-mentioned synthesis are mutual
DNA chain is mended, establishes highly sensitive, highly selective fluorescent detection system, the detection for MRSA PBP2a.
Detecting step includes:
1. the coated magnetic nano particle of IgG antibody, sample to be examined will be sequentially added in container, reacted after mixing at 37 DEG C
45min combines the coated magnetic nano particle of antibody sufficiently with the staphylococcus aureus in sample；
2. collecting magnetic nano particle by externally-applied magnetic field, staphylococcus aureus lytic reagent is added after washing, 37 DEG C anti-
30min is answered, under the action of an external magnetic field, collects bacterial lysate；
3. the aptamers that bacterial lysate is added to the PBP2a albumen aptamers of fluorescent marker and quenching group marks are mutual
It mends in DNA chain hybrid product, 22 DEG C of reaction 60min；
4. aptamers and its change in fluorescence of complementary dna chain hybrid product before and after bacterial lysate is added in measurement, according to glimmering
Light changing value judges PBP2a presence or absence.
Step 1. in, the coated magnetic nano particle dosage of IgG antibody be 10 μ L (10mg/mL), sample to be examined be 100 μ L
Concentration is 105The staphylococcus aureus N315 bacterial strain of CFU/mL.
Step 2. in, externally-applied magnetic field be the green skies Bioisystech Co., Ltd in Shanghai BeyoMagTMMagneto separate frame (12
Hole), staphylococcus aureus lytic reagent is the production of 50 Wuhan μ g/mL Sai Sirui Microbial Technics Ltd
staphylococci lysine。
Step 3. in, the aptamers complementary dna chain of the PBP2a albumen aptamers and quenching group of fluorescent marker label is used
Amount is respectively 100 nmol/L and 100nmol/L, and hybridization conditions are 25 DEG C of reaction 30min.
Step 4. in, fluorescence detection excitation wavelength be 485nm, launch wavelength 520nm, sample to be tested fluorescence change
Measuring change in fluorescence average value three times more than negative control adds three times standard deviation to be the PBP2a positive.
(3) the methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers is applied, through this embodiment
Condition detects staphylococcus aureus methicillin-susceptible, and specific flow chart is as shown in fig. 7, result such as Fig. 1-6 is similar:
Although the present invention has been described in detail, it will be understood by those skilled in the art that in spirit and scope of the invention
Modification will be apparent.However, it should be understood that various aspects, different specific embodiment that the present invention records
Each section and the various features enumerated can be combined or all or part of exchange.In above-mentioned each specific embodiment,
Those can suitably be combined with other embodiment with reference to the embodiment of another embodiment, this is will be by ability
Field technique personnel are to understand.In addition, it will be understood to those of skill in the art that the description of front is only exemplary mode, and
It is not intended to be limited to the present invention.
Claims (10)
1. a kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers, it is characterised in that: including with
Lower detecting step:
(1) the coated magnetic nano particle of IgG antibody, sample to be examined will be sequentially added in container, in 25 DEG C~40 DEG C temperature after mixing
15min~60min is reacted in degree, combines the coated magnetic nano particle of antibody sufficiently with the staphylococcus aureus in sample；
(2) magnetic nano particle is collected by externally-applied magnetic field, staphylococcus aureus lytic reagent is added after washing, 25 DEG C~40
15min-60min is reacted in DEG C temperature, under the action of an external magnetic field, collects bacterial lysate；
(3) step (2) bacterial lysate is added to the PBP2a albumen aptamers of fluorescent marker and the adaptation of quenching group label
In body complementary dna chain hybrid product, 15min~60min is reacted in 22 DEG C~40 DEG C temperature；
(4) aptamers and its change in fluorescence of complementary dna chain hybrid product before and after bacterial lysate is added in measurement, is become according to fluorescence
Change value judges PBP2a existence.
2. a kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers according to claim 1,
It is characterized by: in step (1), the antibody is that its Fc segment can all IgG in conjunction with staphylococcal protein A
Class antibody.
3. a kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers according to claim 1,
It is characterized by: in step (2), the staphylococcus aureus lytic reagent is containing can make aureus cell
The solution of the biological enzyme of wall cracking.
4. a kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers according to claim 1,
It is characterized by: the aptamers are all aptamers of energy specific recognition PBP2a albumen in step (3).
5. a kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers according to claim 1,
It is characterized by: the PBP2a albumen aptamers of the fluorescent marker, the fluorophor for label can be in step (3)
All fluorophors that can be used for nucleic acid marking including fluorescein isothiocynate (FITC).
6. a kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers according to claim 1,
It is characterized by: the aptamers that PBP2a albumen aptamers and the quenching group of the fluorescent marker mark are mutual in step (3)
The concentration ratio for mending DNA chain is 1:(1~3).
7. a kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers according to claim 1,
It is characterized by: in step (4), FITC fluorescence detection excitation wavelength is 485nm, launch wavelength 520nm, and sample to be tested is glimmering
Light changing value measures change in fluorescence average value more than negative control three times and three times standard deviation is added to be the PBP2a positive.
8. a kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers according to claim 1,
It is characterized by: the different complementary dna chain dosages that fluorescent marker aptamers are marked from quenching group are 100 μ L, concentration is
100nmol/L, hybridization conditions are 25 DEG C of reaction 1h.
9. a kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers according to claim 1,
It is characterized by: externally-applied magnetic field is to pass through BeyoMagTMMagneto separate frame (12 hole) realizes that magnetic nanoparticle is carboxyl modified
The magnetic nano-particle of partial size 800nm, staphylococcus aureus lytic reagent are 50 μ g/mL.
10. any one of -9 a kind of methicillin-resistant staphylococcus aureus fluorescence based on aptamers according to claim 1
The application of detection method, it is characterised in that: detection method is glimmering using the methicillin-resistant staphylococcus aureus based on aptamers
Light detection method detects various concentration methicillin-resistant staphylococcus aureus in PBS (Fig. 4) and simulation oropharyngeal swab specimen (Fig. 5)
The fluorescence change of N315；
Healthy volunteer's throat swab that wherein simulation oropharyngeal swab specimen is detected as feminine gender by staphylococcus aureus is dilute with sterile PBS
The methicillin-resistant staphylococcus aureus N315 that various concentration is added after releasing 10 times is made, in PBS and simulation oropharyngeal swab specimen
Staphylococcus aureus concentration from 10 to 108CFU/mL。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810944925.XA CN108982848B (en) | 2018-08-19 | 2018-08-19 | Fluorescent detection method for methicillin-resistant staphylococcus aureus based on aptamer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810944925.XA CN108982848B (en) | 2018-08-19 | 2018-08-19 | Fluorescent detection method for methicillin-resistant staphylococcus aureus based on aptamer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108982848A true CN108982848A (en) | 2018-12-11 |
| CN108982848B CN108982848B (en) | 2021-08-20 |
Family
ID=64553415
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810944925.XA Active CN108982848B (en) | 2018-08-19 | 2018-08-19 | Fluorescent detection method for methicillin-resistant staphylococcus aureus based on aptamer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108982848B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110658338A (en) * | 2019-09-12 | 2020-01-07 | 武汉大学 | Portable mastitis pathogen MRSA detection method in lactation period |
| CN113030032A (en) * | 2019-12-24 | 2021-06-25 | Tcl集团股份有限公司 | Detection method of tetracycline |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101665821A (en) * | 2008-09-01 | 2010-03-10 | 中国人民解放军军事医学科学院基础医学研究所 | Oligonucleotide aptamer group for specifically identifying staphylococcus aureus and use thereof |
| CN102426229A (en) * | 2011-09-26 | 2012-04-25 | 广东海洋大学 | Preparation method of human IgG immunomagnetic bead for staphylococcus aureus enrichment |
| CN102590506A (en) * | 2012-02-16 | 2012-07-18 | 上海师范大学 | Method for rapidly detecting and screening staphylococcus aureus |
| US20150316545A1 (en) * | 2014-05-02 | 2015-11-05 | Academia Sinica | Ultrasensitive detection of a biological target by aptamer-conjugated gold nanoparticles |
-
2018
- 2018-08-19 CN CN201810944925.XA patent/CN108982848B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101665821A (en) * | 2008-09-01 | 2010-03-10 | 中国人民解放军军事医学科学院基础医学研究所 | Oligonucleotide aptamer group for specifically identifying staphylococcus aureus and use thereof |
| CN102426229A (en) * | 2011-09-26 | 2012-04-25 | 广东海洋大学 | Preparation method of human IgG immunomagnetic bead for staphylococcus aureus enrichment |
| CN102590506A (en) * | 2012-02-16 | 2012-07-18 | 上海师范大学 | Method for rapidly detecting and screening staphylococcus aureus |
| US20150316545A1 (en) * | 2014-05-02 | 2015-11-05 | Academia Sinica | Ultrasensitive detection of a biological target by aptamer-conjugated gold nanoparticles |
Non-Patent Citations (3)
| Title |
|---|
| KEJUN FENG: "an aptamer-based competitive flurescence quenching assay for IgE", 《ANALYTICAL LETTERS》 * |
| 唐晓华: "重组PBP2a转肽酶区蛋白核酸适配体的筛选及鉴定", 《重庆医学》 * |
| 马洪玉: "针对青霉素结合蛋白2a适配子的筛选及初步应用", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110658338A (en) * | 2019-09-12 | 2020-01-07 | 武汉大学 | Portable mastitis pathogen MRSA detection method in lactation period |
| CN113030032A (en) * | 2019-12-24 | 2021-06-25 | Tcl集团股份有限公司 | Detection method of tetracycline |
| CN113030032B (en) * | 2019-12-24 | 2022-06-24 | Tcl科技集团股份有限公司 | Detection method of tetracycline |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108982848B (en) | 2021-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6225046B1 (en) | Method for detecting microorganisms | |
| EP2255015B1 (en) | Methods of producing homogeneous plastic-adherent aptamer-magnetic bead-fluorophore sandwich assays | |
| Wang et al. | Lanthanide-labeled fluorescent-nanoparticle immunochromatographic strips enable rapid and quantitative detection of Escherichia coli O157: H7 in food samples | |
| CN102928606B (en) | The Procalcitonin quick detection kit of multispecific antibody mark | |
| JP5670207B2 (en) | A method for real-time detection of microorganisms in liquid media by agglutination | |
| Wang et al. | Magnetic relaxation switch immunosensor for the rapid detection of the foodborne pathogen Salmonella enterica in milk samples | |
| CN102253193A (en) | Magnetic fluorescent kit for rapidly detecting microbes as well as preparation method and use method thereof | |
| CN107422115A (en) | Method and system for microorganism detection | |
| CN107389919A (en) | A kind of label-free fluorescence aptamer sensor and its preparation method and application | |
| Sun et al. | A nonenzymatic optical immunoassay strategy for detection of Salmonella infection based on blue silica nanoparticles | |
| Seo et al. | Engineered nanoconstructs for the multiplexed and sensitive detection of high-risk pathogens | |
| Xu et al. | Ultrasensitive and rapid count of Escherichia coli using magnetic nanoparticle probe under dark-field microscope | |
| CN108982430A (en) | Mark kit, method, the bacteria flora with fluorescent marker and its application of bacteria flora sample | |
| Xiao et al. | Smartphone-assisted biosensor based on broom-like bacteria-specific magnetic enrichment platform for colorimetric detection of Listeria monocytogenes | |
| CN108982848A (en) | A kind of methicillin-resistant staphylococcus aureus fluorescence detection method based on aptamers | |
| Zhang et al. | Rapid, visual detection of Klebsiella pneumoniae using magnetic nanoparticles and an horseradish peroxidase-probe based immunosensor | |
| CN111088380A (en) | Brucella LF-RPA detection primer, probe and detection kit | |
| Ge et al. | Lateral flow immunoassay for visible detection of human brucellosis based on blue silica nanoparticles | |
| Chen et al. | Rapid and sensitive detection of Shigella flexneri using fluorescent microspheres as label for immunochromatographic test strip | |
| CN109929912A (en) | The methods for intersecting constant-temperature amplification combination nano-biosensing detection mycoplasma pneumoniae more | |
| CN109804081A (en) | A kind of compound target-tumour serum aptamer detection method and kit | |
| JP2016536592A (en) | Bacteria diagnosis | |
| Stroot et al. | Capture antibody targeted fluorescence in situ hybridization (CAT-FISH): Dual labeling allows for increased specificity in complex samples | |
| Carter et al. | Rapid, multiplexed characterization of Shiga toxin-producing Escherichia coli (STEC) isolates using suspension array technology | |
| Nosaz et al. | Development of a DNA aptamer to detect Brucella abortus and Brucella melitensis through cell SELEX |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |