CN108969774A - A kind of reagent and method of diagnosing atherosclerotic Vulnerable plaque - Google Patents

Abstract

The present invention provides the reagents and method of a kind of diagnosing atherosclerotic Vulnerable plaque.Especially by will specific recognition atherosclerosis Vulnerable plaque protein core with detection label be marked, realize Vulnerable plaque in body Sensitive Detection.The present invention also provides the methods that Vulnerable plaque is detected based on this diagnostic reagent.

Description

A kind of reagent and method of diagnosing atherosclerotic Vulnerable plaque

Invention field

The invention belongs to area of medical diagnostics, and in particular to using the radiodiagnosis technology of nano material, especially relate to And the method for diagnosing atherosclerotic Vulnerable plaque.

Background technique

It is located at first of each fatal disease [1] currently, cardiovascular and cerebrovascular disease alreadys exceed cancer.It is reported that in the U.S., often Year just there are about 800,000 people to die of cardiovascular and cerebrovascular diseases, just have in average about 6 dead crowds one it is related [1] with cardiovascular and cerebrovascular diseases. Atherosclerosis is the most common and most important induction of cardiovascular and cerebrovascular diseases and lethal sexual factor [2].It is considered that artery is athero- Hardening induced Acute the events of heart attack is derived mainly from the narrow of coronary artery；However, recent researches are found, acute myocardial infarction, cerebral infarction are suffered from Person's radiography lesions showed blood vessel only has slight narrow, and has greatly asymptomatic coronary atherosclerosis patient sudden cardiac Disease or cerebral infarction are dead, dead preceding without any performance [3].Studies have shown that being originated from caused by Plaque Disrupt or vulnerable plaque rupture Thrombosis and embolism are arch-criminal [4,5].Contemporary cardiovascular and cerebrovascular diseases are committed to how preventing acute fatal disease event Generation, technological break-through depends on the diagnosis and identification of unstability or vulnerable plaque.

Current clinically used angiography method is only able to display luminal stenosis degree in diagnosing atherosclerotic, and The Pathological Physiology property of patch cannot be effectively reacted, it is helpless for the lesion vessels of non-obstructivity.Surpass in intravascular Sound and optical coherence tomography imaging have huge advantage to showing and assessing lesion coronary artery tube wall, but because of invasive test mode And clinical application is limited [6,7].A kind of inspection method of ideal non-intrusion type shows biggish application space [6].CT and MRI can show lumen and tube wall variation simultaneously, can be used for diagnosing fat deposition, fibrous cap, capilary in patch and assessment patch The situations [8,9] such as formation and calcification.However, CT and MRI is limited to the condition evaluations ability such as patch inner metabolism and inflammation, and this A little an important factor for exactly indicating unstable patches and degree of danger, cause it limited to the predictive ability of cardiac risk event [2,4].In contrast, based on radioactive probe carry out metabolism and functional imaging PET and SPECT show it is unique excellent Gesture.PET and SPECT is high to the detection sensibility of targeted molecular, up to picomole quantities (pm), it is sufficient to reflect molecular level in patch Pathological Physiology variation；And it is high just because of PET and SPECT sensibility, cause the dosage of contrast medium be also significantly lower than CT and MRI[10].But clinical diagnosis still lacks the nuclear medicine probe for high-risk plaques at present, commonly¹⁸F-FDG is that diagnosis is dynamic The goldstandard of arteries and veins patch, but due to its myocardium high-selenium corn, the signal-to-noise ratio for causing it to detect is low, clinical diagnosis Vulnerable plaque by Limit.Therefore, it is badly in need of developing a kind of probe highly sensitive for high-risk artery plaque, prevents the generation of acute fatal disease event.

Bibliography:

[1]Go AS,Mozaffarian D,Roger VL,et al.Heart disease and stroke statistics--2014update:a report from the American Heart Association[J] .Circulation,2014,129(3):e28-e292.

[2]Lairez O,Fayad ZA.Imaging of atherosclerosis:Can molecular imaging Do more? [J] .Archives of Cardiovascular Diseases, 2013,106 (11): 551-553.

[3]Stone GW,Marso SP,Parise H,et al.A prospective natural-history study of coronary atherosclerosis[J].The New England journal of medicine, 2011,364(3):226-235.

[4]Fleg JL,Stone GW,Fayad ZA,et al.Detection of high-risk atherosclerotic plaque:report of the NHLBI Working Group on current status and future directions[J].JACC Cardiovasc Imaging,2012,5(9):941-955.

[5]Naghavi M,Libby P,Falk E,et al.From vulnerable plaque to vulnerable patient:a call for new definitions and risk assessment strategies: Part I[J].Circulation,2003,108(14):1664-1672.

[6]Pre-Clinical and Clinical Evaluation of Nuclear Tracers for the Molecular Imaging of Vulnerable Atheroclerosis:An Overview[J].2009.

[7]Schaar JA,Mastik F,Regar E,et al.Current diagnostic modalities for vulnerable plaque detection[J].Curr Pharm Des,2007,13(10):995-1001.

[8]Hoffmann U,Moselewski F,Nieman K,et al.Noninvasive assessment of plaque morphology and composition in culprit and stable lesions in acute coronary syndrome and stable lesions in stable angina by multidetector computed tomography[J].J Am Coll Cardiol,2006,47(8):1655-1662.

[9]Versteylen MO,Kietselaer BL,Dagnelie PC,et al.Additive value of semiautomated quantification of coronary artery disease using cardiac computed tomographic angiography to predict future acute coronary syndrome [J].J Am Coll Cardiol,2013,61(22):2296-2305.

[10]Rudd JHF,Hyafil F,Fayad ZA.Inflammation Imaging in Atherosclerosis[J].Arteriosclerosis,Thrombosis,and Vascular Biology,2009,29 (7):1009-1016.

Summary of the invention

In order to overcome the above problem, the present invention provides reagent and the side of a kind of diagnosing atherosclerotic Vulnerable plaque Method.

Specifically, one aspect of the present invention provides a kind of reagent for diagnosing atherosclerotic Vulnerable plaque, institute Stating reagent includes the protein core for capableing of specific recognition atherosclerosis Vulnerable plaque and label in the protein core Detection label in the heart.

What another aspect of the present invention provided that the label on protein core has a label being capable of specific recognition artery congee The protein core of sample hardening Vulnerable plaque is used to prepare the purposes of the kit of diagnosing atherosclerotic Vulnerable plaque.

In preferred embodiments, the protein core for capableing of specific recognition atherosclerosis Vulnerable plaque Selected from ferritin, heat shock protein (Heat Shock Proteins, HSPs), Dps albumen, (DNA is protected under cell starvation Albumen, DNA binding protein from starved cells) or virus protein shell with lar nanometric cavities structure.

Another aspect of the present invention provides ferritin, heat shock protein (Heat Shock Proteins, HSPs), Dps egg White (DNA protected protein, DNA binding protein from starved cells under cell starvation) or have receive The purposes of the selectively targeted atherosclerosis Vulnerable plaque of virus protein shell of rice cavity structure.

A kind of targeting agent is provided in another aspect of this invention, and the targeting agent targets atherosclerosis unstable plaque Block, include protein core, the protein core be selected from ferritin, heat shock protein (Heat Shock Proteins, HSPs), Dps albumen (DNA protected protein, DNA binding protein from starved under cell starvation ) or the virus protein shell with lar nanometric cavities structure cells.

In preferred embodiments, the protein core for capableing of specific recognition atherosclerosis Vulnerable plaque It is ferritin, preferred apoferritin.

In preferred embodiments, the apoferritin is natural or genetic recombination.

In preferred embodiments, the protein core for capableing of specific recognition atherosclerosis Vulnerable plaque It is the full heavy chain subunit ferritin (hereinafter also referred to as H- ferritin) of genetic recombination, encodes its nucleotide sequence such as SEQ ID Shown in NO:1.

As known to those skilled in the art, ferritin by 24 heavy chains (H) and light chain (L) subunit high-sequential self assembly and At, the spherical structure albumen with lar nanometric cavities structure, the referred to as full heavy chain subunit ferritin when all heavy chains of 24 subunits (H- ferritin).There are iron ion channels on ferritin surface, can be by Fe extra in vivo by the ion channel²⁺It is stored in iron In protein shell, and the ferric oxide nano kernel that can be stabilized in vivo is oxidized on internal catalysis oxidation site. The referred to as apoferritin when not being loaded with iron core in ferritin shell.

In preferred embodiments, the apoferritin can derive from eucaryote or prokaryotes, the eukaryon Biology is preferably mammal.

In preferred embodiments, the detection label includes antibody, polypeptide, aptamer or radionuclide.

In preferred embodiments, the detection marks and is capable of specific recognition atherosclerosis Vulnerable plaque Protein core is connected by chemical coupling or Gene Fusion.

In preferred embodiments, the radionuclide is selected from for PET, (PET-Positron emission computed tomography is aobvious Picture) diagnosis nucleic or be used for SPECT (single photon emission computerized tomography,SPECT) diagnosis nucleic.

In preferred embodiments, the nucleic of the diagnosis for PET includes but is not limited to¹⁸F、¹²⁴I、⁶⁴Cu etc..

In preferred embodiments, the nucleic for SPECT diagnosis includes but is not limited to^99mTc、¹¹¹In、⁶⁷Ga 、¹²³I etc..

In preferred embodiments, the detection label is the nucleic for SPECT diagnosis^99mTc。

Another aspect of the present invention provides a kind of kit for diagnosing atherosclerotic Vulnerable plaque, the examination Agent box includes:

A. heretofore described reagent；

B. the device of the reagent is injected；

C. the device of the detection label in the reagent is detected.

Another aspect of the present invention provides a kind of method of diagnosing atherosclerotic Vulnerable plaque, the method includes Following steps:

A. diagnostic reagent of the present invention is injected into subject's body,

B. it is determined whether there is using the device or technology of the detection label detected in the diagnostic reagent described unstable Patch.

In preferred embodiments, the subject includes human or animal, preferably suffers from atherosclerosis or has trouble There is the human or animal of the risk of atherosclerosis.

In preferred embodiments, the device of the detection label in the detection diagnostic reagent or technology include using SPECT-CT or PET-CT carries out animal whole body imaging.

In preferred embodiments, described to be imaged on coronary artery and arteria carotis progress.

The reagent and method of this diagnosing atherosclerotic Vulnerable plaque provided by the invention have huge society Benefit and economic benefit, it may have good application prospect.

Detailed description of the invention

Fig. 1^99mTc label ferritin (^99mTc-HFn) route map

(a)^99mTc-HFn preparation route

(b) TLC is detected^99mRadiochemicsl purity > 98% of Tc-HFn.

The successful building of Fig. 2 atherosclerotic plaque mouse

(a) formation of oil red O stain identification rat aorta patch；

(b) plaque area of quantitative detection atherosclerotic plaque mouse；

Fig. 3^99mTc-HFn diagnostic reagent detects living body Vulnerable plaque.

(a)^99mThe representative legend of Tc-HFn in-vivo imaging diagnosis mouse Vulnerable plaque；

(b) size of quantitative detection rat aorta patch；

(c) external image checking rat aorta patch；

Specific embodiment

The description of the following example is not meant to limit the scope of the invention merely to illustration purpose.

Embodiment 1^99mThe Radio-synthesis of Tc-HFn

The expression and purification of H- ferritin: with the Hela cell line of high expression H- ferritin (referred to herein as HFn) CDNA is template, and the overall length primer of designer's H- ferritin, by the cDNA of people's H- ferritin, 552bp is building up to expression vector On pET30a (Novagen)；Then prokaryotic expression system is utilized, HFn-pET30a is transformed into expression bacterial strain BL21 (DE3) (Novagen), using IPTG inducing expression, people's HFn albumen is purified later (about people's H- ferritin molecule construction, Expression and purifying refer to Nature Nanotech.2012 and Chinese invention patent application 201110122433.0).

The nucleotide coding sequence of H- ferritin is as follows:

ATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAA CCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCCTTGAAGAACT TTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGA GGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCGATGGAGTG TGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCC ATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACC AACTTGCGCAAGATGGGAGCGCCCGAATCCGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGA TAATGAAAGCTAG (SEQIDNO:1)

^99mThe Radio-synthesis of Tc-HFn: small molecule chelators NHS-MAG₃It is synthesized according to following method reported in the literature (Nature protocols,2006,1(3):1477-1480.).Radionuclide^99mTcO₄ ^-Have purchased from the glad section's medicine in Shanghai Limit company, synthetic route are as shown in Figure 1.We are by the NHS-MAG of preparation₃It is incubated at room temperature with H- ferritin, albumen is dense Degree is 5mg/mL, and reaction solution is the carbonic acid buffer of pH 8.0, and PBS dialyses after reaction 2 hours, removes unlabelled small molecule NHS-MAG₃Afterwards, by the MAG of 100 μ g₃- HFn is placed in the ammonium acetate solution of 45 μ L, be added 15 μ L tartrate buffer and The radionuclide of 37MBq^99mTcO₄ ^-, the freshly prepared 1mg/mL SnCl of 4 μ L is added after mixing₂·2H₂O solution, mixture Room temperature reaction 1 hour, final radiochemicsl purity is accredited as > 98% (Fig. 1) through ITLC (Bioscan)

Embodiment 2^99mThe research of Tc-HFn detection Vulnerable plaque

Apoe-/- mouse (being purchased from Department Of Medicine, Peking University's Experimental Animal Center) purchase every group 8, carries out high fat diet and (contains 10% fat, 2% cholesterol and 0.5% sodium taurocholate), respectively feed 12 weeks, 20 weeks and 33 weeks, form different degrees of size Atherosclerotic plaque carry out image checking (experimental group), Fig. 2 a identifies the small of high fat diet different times with oil red O stain Mouse is formed by artery plaque, Fig. 2 b quantitative detection plaque area of atherosclerotic plaque mouse.The C57 health of wild type is small For mouse as disease control, wild-type mice does not have the formation (Fig. 2) of artery plaque.Experimental group and control group mice intravenous injection Amount is 500 μ Ci's^99mTc-HFn diagnostic reagent, carries out SPECT/CT radiography after two hours, imaging system used is Bioscan Nano-SPECT/CT imaging system, SPECT and CT image reconstruction is with InVivoScope (Version 1.43, Bioscan). As shown in Figure 3a, the artery site of atherosclerotic plaque test mouse is presented apparent emission signal, and control group mice only have it is micro- Weak emission signal, with the progress of atherosclerosis, the artery site signal of experimental mice quantifies 1.659 from 12 weeks ± 0.526%ID/ml, 20 weeks 1.659 ± 0.526%ID/ml to 33 weeks 2.767 ± 0.379%ID/ml, emission signal (r=0.87, P=0.001) is positively correlated with the plaque area of oil red O dye, the results showed that^99mThe detection of Tc-HFn diagnostic reagent is dynamic The feasibility of arteries and veins atheromatous plaque.After in-vivo imaging, mouse is put to death, and takes out complete rat aorta pipe, while being carried out external SPECT-CT imaging and oil red O stain, as shown in Figure 3c, rat aorta pipe radiation absorption position is fully located in oil red O stain Plaque location, as a result surface experimental mouse in body emission signal from artery plaque, demonstrate again that^99mTc-HFn diagnosis examination Agent is able to detect atherosclerotic plaque.

Claims (10)

1. a kind of reagent for diagnosing atherosclerotic Vulnerable plaque, the reagent includes being capable of specific recognition artery congee Sample hardens the detection label of the protein core and label of Vulnerable plaque in the protein core in the heart.

2. reagent according to claim 1, the protein core is selected from ferritin, heat shock protein, Dps albumen or tool There are the virus protein shell of lar nanometric cavities structure, preferably ferritin, more preferably apoferritin, most preferably full heavy chain subunit iron Albumen.

3. reagent according to claim 2, the apoferritin is natural or genetic recombination.

4. reagent according to claim 2, the apoferritin can derive from eucaryote or prokaryotes, described true Core biology is preferably mammal.

5. reagent according to claim 1, the detection marks and being capable of specific recognition atherosclerosis unstable plaque The protein core of block is connected by chemical coupling or Gene Fusion.

6. reagent according to claim 1, the detection label includes antibody, polypeptide, aptamer or radioactive nucleus Element.

7. reagent according to claim 6, the radionuclide is selected from the diagnosis nucleic for PET or is used for SPECT Diagnosis nucleic.

8. reagent according to claim 7, the diagnosis nucleic for PET include¹⁸F、¹²⁴I、⁶⁴Cu。

9. reagent according to claim 7, described to include for SPECT diagnosis nucleic^99mTc、¹¹¹In、⁶⁷Ga、¹²³I。

10. a kind of kit for diagnosing atherosclerotic Vulnerable plaque, the kit include:

A. reagent of any of claims 1-9；

B. the device of the reagent is injected；

C. the device of the detection label in the reagent is detected.