CN108950045A - The relevant molecular labeling of bitter taste phenotype and its application before a kind of citrus fruits - Google Patents
The relevant molecular labeling of bitter taste phenotype and its application before a kind of citrus fruits Download PDFInfo
- Publication number
- CN108950045A CN108950045A CN201810811804.8A CN201810811804A CN108950045A CN 108950045 A CN108950045 A CN 108950045A CN 201810811804 A CN201810811804 A CN 201810811804A CN 108950045 A CN108950045 A CN 108950045A
- Authority
- CN
- China
- Prior art keywords
- citrus
- bitter taste
- molecular labeling
- seq
- germplasm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention relates to the relevant molecular labeling of bitter taste phenotype and its applications before a kind of citrus fruits.Wherein, the nucleotide sequence of the molecular labeling is as shown in SEQ ID NO:1.The preceding bitter taste phenotype of molecular labeling and citrus fruits of the invention is closely related, can be and at low cost, easy to operate, accurate and reliable effective for the identification of bitter taste phenotype before each germplasm fruit of Citrus and the screening of the weak bitter taste elite germplasm of Citrus.
Description
Technical field
The present invention relates to molecular labeling and its applications.In particular it relates to which bitter taste phenotype is related before citrus fruits
Molecular labeling, the primer pair for detecting the molecular labeling and kit, previous molecular label, primer pair, kit answer
With.
Background technique
Bitter taste is the important quality trait of one kind of citrus fruits, drastically influences consumer to different citrus fruits
Acceptance level.Citrus bitter taste is caused by two different metabolites: one is by based on limonin and Nomilin element etc.
Limonoids causes, because the increase of content frequently results in the rear hardships of citrus fruits to limonin after fruit is hurt
Taste, it is another then caused by the flavanone glycoside class in flavonoids, it is corresponding with rear bitter taste, induce the preceding hardship of citrusfruit
Taste.
Flavanone glycoside class is the most abundant flavonoids of content in citrusfruit, and is broadly divided into two major classes.One kind is nothing
The rutinose glycoside of bitter taste, one kind are that have the neohesperidoside class of significant bitter taste, the former in citrus with narirutin and
Content of hesperidin occupies height, and the latter is had comparative advantage with aurantiin and neohesperidin.
Studies have shown that the composition of flavanone glycoside class two major classes substance has apparent germplasm special in each germplasm citrusfruit
Property.For example, the neohesperidoside class of bitter taste is only accumulated, in germplasm such as tangerine, sweet orange, citrons in the germplasm such as shaddock and big hill mandarin orange
In, the rutinose glycoside of no bitter taste is only accumulated, in part citrus hybrid such as grape fruit, bitter orange germplasm, is then metabolized shape simultaneously
At two major classes substance；And in golden mandarin orange and mountain gold mandarin orange, two major classes substance can not accumulate.
Due to belonging to the metabolism branch of flavonoid class substance, the biosynthesis of flavanone glycoside is also originated from phenylpropyl alcohol in citrus
Alkane metabolism.In citrus, the naringenin and other flavanone glycosides that are catalyzed through chalcone synthase and enzyme, namely chalcone isomerase
With base class, flavanones -7-O- glucoside is formed under the catalytic action of flavonoids -7-O- glycosyltransferase, after pass through
The catalytic action for crossing 1,2- rhamnoside transferase (1,2RhaT) forms the neohesperidoside with bitter taste in the germplasm such as shaddock
Class；Flavanones -7-O- glucoside or the catalytic action for passing through 1,6- rhamnoside transferase, the shape in the germplasm such as tangerine, sweet orange
At the rutinose glycoside of no bitter taste.Therefore, it is analyzed through forefathers' research and metabolic pathway, new orange peel in part citrus germplasm such as sweet orange
The metabolic disruption of glycoside is particularly likely that caused by the afunction of 1,2RhaT albumen.
Therefore, reasonable 1,2- rhamnoside transferase molecular labeling is started to develop, it is excellent to weak bitter taste in citrus breeding
The preliminary screening of germplasm has important scientific meaning and economic value.
Summary of the invention
The technical problem to be solved by the present invention is to the known array according to 1,2RhaT gene, acquisition and citrus fruits
The relevant molecular labeling of preceding bitter taste character.
The technical scheme to solve the above technical problems is that
According to an aspect of the present invention, the present invention provides a kind of relevant molecule marks of bitter taste phenotype before citrus fruits
Note, for the nucleotide sequence of the molecular labeling as shown in SEQ ID NO:1, SEQ ID NO:1 nucleotide sequence is as follows
(461bp):
ATCCAAGAACCTACCTTCAAGGAAGATGATACAAAGATCATGGACTGGCTGAGCCAAAAGGAGCCTCGTTCAGTCGT
GTATGCATCCTTTGGCAGTGAGTACTTTCCTTCCAAGGATGAAATACATGAGATAGCTAGTGGGTTATTGCTCAGCG
AGGTTAATTTTATATGGGCTTTCAGATTACATCCTGATGAAAAAATGACTATCGAGGAGGCACTGCCTCAGGGCTTT
GCTGAGGAGATTGAAAGGAATAATAAGGGAATGATAGTACAAGGTTGGGTTCCGCAGGCTAAAATTTTAAGGCATGG
AAGCATCGGCGGATTTTTGAGTCATTGTGGTTGGGGCTCGGTGGTTGAGGGGATGGTTTTCGGGGTACCAATCATAG
GTGTGCCAATGGCATATGAGCAGCCAAGCAATGCCAAGGTGGTGGTTGACAATGGTATGGGCATGGTCGTTCCAAG。
According to an embodiment of the invention, the citrus plant individual with nucleotide sequence shown in SEQ ID NO:1, fruit
Show as that there is preceding bitter taste feature in fact；Lack the citrus plant individual of nucleotide sequence shown in SEQ ID NO:1, fruit table
It is now unmatched bitter taste feature.
According to another aspect of the present invention, the present invention also provides a kind of for detecting drawing for mentioned-above molecular labeling
Object pair, the primer pair are respectively provided with nucleotide sequence shown in SEQ ID NO:2 and SEQ ID NO:3.Specifically, of the invention
Primer pair sequence it is as follows:
5’-ATCCAAGAACCTACCTTCAAG-3’(SEQ ID NO:2)
5’-CTTGGAACGACCATGCCCATACCAT-3’(SEQ ID NO:3)
PCR amplification is carried out to citrus plant genomic DNA to be measured using the primer pair and detects the length of amplified fragments
Degree: when that can amplify the amplified fragments of 461bp, the citrus plant to be measured has nucleotides sequence shown in SEQ ID NO:1
Column, fruit display are with preceding bitter taste feature；When this nucleic acid fragment cannot be amplified, the citrus plant missing to be measured
Nucleotide sequence shown in SEQ ID NO:1, fruit display are unmatched bitter taste feature, which has specificity, Wu Fakuo
Increase the segment of other length out.
According to an embodiment of the invention, detecting whether there is amplification piece using the preferred agarose gel electrophoresis of gel electrophoresis
The length of section and amplified fragments.
According to another aspect of the invention, the present invention also provides a kind of for detecting the reagent of molecular labeling noted earlier
Box, the kit include the primer pair for being previously used for detecting molecular labeling of the invention.
According to another aspect of the invention, the present invention also provides mentioned-above molecular labelings of the invention in Citrus
Application before each germplasm fruit in the identification of bitter taste phenotype or the screening of the weak bitter taste elite germplasm of Citrus.
In accordance with a further aspect of the present invention, it is each in Citrus that the present invention also provides mentioned-above primer pairs of the invention
Application before germplasm fruit in the identification of bitter taste phenotype or Citrus weak bitter taste elite germplasm screening.
In accordance with a further aspect of the present invention, it is each in Citrus that the present invention also provides mentioned-above kits of the invention
Application before germplasm fruit in the identification of bitter taste phenotype or Citrus weak bitter taste elite germplasm screening.
It should be noted that molecular labeling relevant to bitter taste before citrus fruits of the invention and its application are with as follows
Advantage:
(1) before citrus fruits provided by the invention the relevant molecular labeling of bitter taste phenotype not by the limit in fruit tree growth stage
System, can be used for the early stage breeding and screening of Citrus germplasm, and then can be realized short time, low cost, the breeding of high accuracy ground
Filter out weak bitter taste elite germplasm；
(2) detect citrus fruits before the relevant molecular labeling of bitter taste phenotype method, it is accurately and reliably, easy to operate.
Detailed description of the invention
Fig. 1 is that aurantiin and neohesperidin metabolism isolate result in molecular labeling of the present invention and each citrus fruits.Its
In, the molecular labeling of each cultivar passes through congealed fat sugar agar-agar electrophoresis detection；Aurantiin and neohesperidin pass through HPLC in fruit
It is detected with LC-MS, the chromatographic peak in upper broken line frame positioned at 25.974 minutes represents aurantiin and accumulates, in lower broken line frame
Chromatographic peak positioned at 28.901 minutes represents neohesperidin accumulation.
Specific embodiment
Principles and features of the present invention are described below in conjunction with drawings and the specific embodiments, example is served only for solving
The present invention is released, is not intended to limit the scope of the present invention.
Embodiment 1: molecular markers development
The preceding bitter taste of citrusfruit derives from the accumulation of neohesperidoside class, analyzes by metabolic pathway, part citrus kind
The metabolic disruption of neohesperidoside class is particularly likely that caused by the afunction of 1,2RhaT albumen in matter fruit, shaddock Cm1,2RhaT
The nucleotide sequence of gene (GenBank accession:AY048882) is as shown in SEQ ID NO:4:
ATGGATACCAAGCATCAAGATAAGCCAAGCATTCTCATGTTACCATGGCTAGCTCATGGGCACATAGCTCCACACCT
TGAACTTGCCAAGAAGCTTTCACAGAAAAACTTCCACATATATTTCTGCTCTACTCCCAACAATCTACAATCCTTCG
GCAGAAATGTTGAAAAAAACTTCTCATCTTCAATACAACTCATAGAACTGCAACTTCCCAATACATTCCCTGAACTT
CCTTCACAAAATCAGACCACAAAAAACCTTCCTCCCCATCTTATTTATACTCTCGTGGGAGCATTTGAAGATGCAAA
ACCTGCTTTTTGCAACATCTTGGAGACGCTTAAACCAACCCTTGTTATGTATGATTTGTTCCAACCATGGGCAGCAG
AGGCAGCTTACCAGTATGACATAGCTGCTATTTTGTTCTTACCCTTATCTGCAGTAGCCTGCTCTTTCTTGCTGCAC
AATATCGTAAATCCCAGCCTGAAATACCCTTTCTTTGAATCTGATTACCAAGATAGAGAAAGCAAGAACATCAATTA
CTTCCTGCATCTTACTGCCAATGGCACCTTAAACAAAGACAGGTTCTTAAAAGCTTTCGAACTATCTTGCAAATTTG
TGTTCATCAAAACATCAAGAGAGATTGAATCCAAGTACTTGGATTATTTTCCTTCTTTAATGGGAAATGAAATAATT
CCAGTAGGGCCTCTAATCCAAGAACCTACCTTCAAGGAAGATGATACAAAGATCATGGACTGGCTGAGCCAAAAGGA
GCCTCGTTCAGTCGTGTATGCATCCTTTGGCAGTGAGTACTTTCCTTCCAAGGATGAAATACATGAGATAGCTAGTG
GGTTATTGCTCAGCGAGGTTAATTTTATATGGGCTTTCAGATTACATCCTGATGAAAAAATGACTATCGAGGAGGCA
CTGCCTCAGGGCTTTGCTGAGGAGATTGAAAGGAATAATAAGGGAATGATAGTACAAGGTTGGGTTCCGCAGGCTAA
AATTTTAAGGCATGGAAGCATCGGCGGATTTTTGAGTCATTGTGGTTGGGGCTCGGTGGTTGAGGGGATGGTTTTCG
GGGTACCAATCATAGGTGTGCCAATGGCATATGAGCAGCCAAGCAATGCCAAGGTGGTGGTTGACAATGGTATGGGC
ATGGTCGTTCCAAGAGATAAGATCAATCAAAGACTTGGAGGAGAGGAGGTGGCGAGGGTCATTAAACATGTTGTGCT
GCAAGAAGAAGCGAAGCAAATAAGAAGAAAAGCTAATGAAATTAGTGAGAGTATGAAGAAGATAGGGGACGCAGAGA
TGAGTGTGGTGGTGGAGAAGCTGCTGCAGCTTGTCAAGAAATCTGAATAA。
It compares and finds through gene cloning and whole genome sequence, there are one in part Citrus germplasm such as sweet orange, shaddock
With shaddock Cm1, the gene order that 2RhaT gene nucleotide series homology is 92% is named as dGlcT-1, sweet orange
The nucleotide sequence of dGlcT-1 gene (CsdGlcT-1) is as shown in SEQ ID NO:5:
ATGGATACCAAGCATCAAGATAAGCCAAGCATTCTCATGTTACCATGGCTAGCTCATGGGCACATATCTACATACCT
TGAACTTACCAAGAAGCTTTCACAGAAAAACTTTCACATATATTTCTGCTCTACTCCCATCAATCTACAATCCATCA
GCAAAAATGATGAAGAAAACTTCTTATCTTCAATACAACTCATAGAACTGCAACTTCCCAATACATTCCCTGAACTT
CCTCCACAAAATCACACCACAAAAAACCTTCCTCCCCATCTTATTTTACTCTCGTGGCAGCATTTGAAGATGCAAAA
CCAGCATTTTGCAACATCCTGGAGACGCTTAAACCAACCCTTGTTATGTATGATTTATTCCAACCATGGGCAGCAGA
GGCAGCTTACCAGTATCACATAGCTGCTGTTTTGTTCTTAACCATATCTGCAGTAGCCGGTTCTTACTTGCTGCACA
ATATCATAAATCCCAGCCTGAAGTACCCTTTCTTTGAATCTGACTTCCTCGATAGAGAAAACAAGAAAATCAACCGC
TTCATGCATCCTACTGCCAATGGCACCTTAAACAAAGACAGGAACTTAAAAGCTTTTGAACTATCTTGCAAATTTGT
GTTCATCAAAACATCAAGAGAGATCGAATCCAAGTACTTGGATTATTTTCCTTCTTTGATGGAAAATGAAATAGTTC
CAGTTGGGCCTCTAGTTCAAGAATCTATATTCAAAGAAGATGATACGAAGATTATGGACTGGCTGAGCCAAAAGGAG
CCTTGGTCAGTAGTGTTTGTATCATTTGGCAGTGAGTACTTTCTTTCCAAGGATGAAATGCATGAGATAGCCAGTGG
GTTATTGCTCAGCGAGGTTAGTTTTATACGGGTTTTGAGATTACATCCTGATGAAAAAATTACTATCGAGGAGGCAC
TGCCTCAAGGCTTTGCTGAGGAGATTGAAAGGAATAATAAGGGAATGTTAGTACAAGGTTGGGTTCCGCAGGCTAAA
ATTTTAAGGCATGGAAGGATCGGCGGTTTTTTGAGTCATTGTGGTTGGGGTTCGGCAGTTGAAGGGATGGTGTTCGG
GGTACCAATCATAGCTATGCCAATGGTATATGAGCAGTCAAGGAATGCCAAAGTGGTGGTTGATATCGGTATGGGCA
TGGACGTGCCGAGAGATAAGATCAATCAAAGACTTAGAAGAGAGGAGGTGGCAAGGGTCATTAAACATGTTTTGCTG
CAAGAAGAAGGGAAGCAAATAAGAAGAAAAGCTAAAGAAATGAGTGAGAGGATGAGAAGATAGGAGACTCAGAGATG
AATGTGGTAGTGGAGAAGCTGCTGCTGCTTGTTAAGAAATCTGAATAA。
The nucleotide sequence of shaddock dGlcT-1 gene (CmdGlcT-1) is as shown in SEQ ID NO:6:
ATGGATACCAAGCATCAAGATAAGCCAAGTATTCTCATGTTACCATGGCTAGCTCATGGGCACATATCTACATACCT
TGAACTTACCAAGAAGCTTTCACAGAAAAACTTTCACATATATTTCTGCTCTACTCCCATCAATCTACAATCCATCA
GCAAAAATGATGAAGAAAACTTCTCATCTTCAATACAACTCATAGAACTGCAACTTCCCAATACATTCCCTGAACTT
CCTCCACAAAATCACACCACAAAAAACCTTCCTCCCCATCTTATTTTTACTCTCATGGCAGCATTTGAAGATGCAAA
ACCAGCATTTTGCAACATCCTGGAGACGCTTAAACCAACCCTTGTTATGTATGGTTTATTCCAACCATGGGCAGCAG
AGGCGGCTTACCAGTATCACATAGCTGCTGTTTTGTTCTTAACCATATCTGCAGTAGCCGGTTCTTACTTGCTGCAC
AATATCATAAATCCCAGCCTGAAGTACCCTTTCTTTGAATCTGACTTCCTCGATAGAGAAAACAAGAAAATCAACCG
CTTCATGCATCGTACTGCCAATGGCACCTTAAACAAAGACAGGAACTTAAAAGCTTTTGAACTATCTTGCAAATTTG
TGTTCATCAAAACATCAAGAGAGATCGAATCCAAGTACTTGGATTATTTTCCTTCTTTGATGGAAAATGAAATAGTT
CCAGTTGGGCCTCTAGTTCAAGAATCTATATTCAAAGAAGATGATACGAAGATTATGGACTGGCTGAGTCAAAAGGA
GCCTTGGTCAGTAGTGTTTGTATCATTTGGCAGCGAGTACTTTCTTTCCAAGGATGAAATGCATGAGATAGCCAGTG
GGTTATTGCTCAGCGAGGTTAGTTTTATATGGGTTTTGAGATTACATCCTGATGAAAAAATTACTATCGAGGAGGCA
CTGCCTCAAGGCTTTGCTGAGGAGATTGAAAGGAATAATAAGGGAATGTTAGTACAAGGTTGGGTTCCGCAGGCTAA
AATTTTAAGGCATGGAAGGATCGGCGGATTTTTGAGTCATTGTGGTTGGGGTTCGGCAGTTGAAGGGATGGTGTTCG
GGGTACCAATCATAGCTATGCCAATGGTATATGAGCAGTCAGGGAATGCCAAAGTGGTGGTTGATATCGGTATGGGC
ATGGACGTGCCGACAGATAAGATCAATCAAAGACTTAGAAGAGAGGAGGTGGCAAGGGTCATTAAACATGTTGTGCT
GCAAGAAGAAGGGAAGCAAATAAGAAGAAAAGCTAAAGAAATGAGTGAGAGGATGAAGAAGATAGGAGACTCAGAGA
TGAATGTGGTAGTGGAGAAGCTGCTGCAGCTTGTTAAGAAATCTGAATAA。
It is found by genetic transformation BY-2 tobacco cell suspension system bound substrates transformation experiment, dGlcT-1 is catalyzed flavanones-
7-O- glucoside forms flavanones two-glucoside of -7-O- of non-hardship, and 1,2RhaT is then catalyzed same substrate and forms hardship
The neohesperidoside class of taste, the two homology is high but catalytic capability is completely different.
Therefore, the relevant molecular labeling of bitter taste phenotype should develop the molecule of 1,2RhaT gene before exploitation citrus fruits
Label, while should be avoided and the interference of the dGlcT-1 gene of 1,2RhaT gene high homology.Pass through Clustal and GeneDoc3.2
Software carry out the comparison of 1,2RhaT gene and shaddock CmdGlcT-1 gene and sweet orange CsdGlcT-1 gene and find Fragment Differential compared with
Molecular labeling is designed in big part, and sequence is as shown in SEQ ID NO:1:
ATCCAAGAACCTACCTTCAAGGAAGATGATACAAAGATCATGGACTGGCTGAGCCAAAAGGAGCCTCGTTCAGTCGT
GTATGCATCCTTTGGCAGTGAGTACTTTCCTTCCAAGGATGAAATACATGAGATAGCTAGTGGGTTATTGCTCAGCG
AGGTTAATTTTATATGGGCTTTCAGATTACATCCTGATGAAAAAATGACTATCGAGGAGGCACTGCCTCAGGGCTTT
GCTGAGGAGATTGAAAGGAATAATAAGGGAATGATAGTACAAGGTTGGGTTCCGCAGGCTAAAATTTTAAGGCATGG
AAGCATCGGCGGATTTTTGAGTCATTGTGGTTGGGGCTCGGTGGTTGAGGGGATGGTTTTCGGGGTACCAATCATAG
GTGTGCCAATGGCATATGAGCAGCCAAGCAATGCCAAGGTGGTGGTTGACAATGGTATGGGCATGGTCGTTCCAAG。
Embodiment 2: bitter taste phenotype relevance verification before the fruit of molecular labeling
To the relevant molecular labeling of bitter taste phenotype (core shown in SEQ ID NO:1 before the citrusfruit determined in embodiment 1
Nucleotide sequence) it is verified, specific as follows:
For above-mentioned molecular labeling design primer, primer sequence is as follows:
Forward primer: 5 '-ATCCAAGAACCTACCTTCAAG-3 ' (SEQ ID NO:2)；
Reverse primer: 5 '-CTTGGAACGACCATGCCCATACCAT-3 ' (SEQ ID NO:3).
Using above-mentioned primer, the polymorphism and expansion of the label are verified by PCR amplification and agarose gel electrophoresis detection
Increase stability.
2.1 experimental material
As shown in table 1, the ripening fruits and young leaflet tablet material of 88 citriculture kinds of Citrus are collected altogether.Including
24 kinds of shaddock classes, 24 kinds wide skin tangerine class, 24 kinds of orange classes, 9 kinds of citron classes, 2 kinds big wing orange and 5 kinds of Ichang papedas, each cultivar
Abbreviation is as shown in table 1.The juice born of the same parents of ripening fruits are for carrying out flavonoids metabolic analysis, and young leaflet tablet is for carrying out genome
The extraction of DNA, all material carry out liquid nitrogen frozen immediately after processing, and be stored in -80 DEG C it is spare.
Table 1
The extraction and qualitative analysis of flavanone glycoside class in 2.2 citrusfruits
The fruit freeze-dried powder 0.1g of 88 citriculture kinds is taken to be added in the centrifuge tube containing 80% methanol of 5ml respectively,
40 DEG C of isothermal vibration 60min in FS60 ultrasonic extraction instrument (Fisher Scientific, Pittsburgh, PA).Each sample
Extraction product after being centrifuged, take 1ml supernatant carried out after 0.22 μm of filtering with microporous membrane HPLC and LC-MS etc. analysis.
Using HPLC system (1525 double base gradient pumps, 717 autosamplers combine 2996PDA detector) to flavonoids into
Row is detected and is analyzed, and C18Hypersil GOLD chromatographic column (4.6 × 250mm, 5 μm, Thermo scientific, USA) is used to
Separate flavonoids.The formic acid that mobile phase A is 0.1%, Mobile phase B are the acetonitrile containing 0.1% formic acid.Mobile phase elution requirement
Are as follows: 0-20min 10-20%B；20-35min 20-25%B；35-55min 25-35%B；55-65min 35-55%B；65-
70min 55-75%B；70-75min 75%B；75-78min 75-10%B；78-80min 10%B.In entirely detection rank
Section, flow velocity 1ml/min, sampling volume is 10 μ l, and column temperature maintains 35 DEG C.Ultraviolet detection range is 210-400nm, detection
Wavelength is 280nm.Using 1200 serial high-resolution HPLC systems series connection QTOF6520 mass spectrograph (Agilent
Technologies, Palo Alto, CA, USA) carry out flavonoids qualitative analysis.Utilize Zorbax Eclipse Plus C18
Reverse chromatograms column (2.1 × 100mm, 1.8mm Agilent Technologies, USA) carries out flavonoids separation, and sample volume
For 2 μ l.Wherein, the formic acid that mobile phase A is 0.1%, Mobile phase B are the acetonitrile containing 0.1% formic acid.Mobile phase elution requirement
Are as follows: 0min -10%B；20min -95%B；22min -95%B；22.1min -10%B；30min -10%B.In entirely detection rank
Section, mobile phase flow rate is set to 0.3ml/min, and column temperature maintains 35 DEG C.In addition, electro-spray ionization source is according to following item
Part is set: for gas temperature as 350 DEG C, dry gas flow rate is 10ml/min, atomizing pressure 40psig；Under positive ion mode
Capillary voltage be 3.5kV, collision voltage 135V, Skimmer voltage is 65V.
In citrus, content flavonoids the most abundant is flavanone glycoside class, and flavanone glycoside class includes having hardship again
The neohesperidoside class of taste, and the rutinose glycoside without bitter taste.Wherein neohesperidoside class is mainly by new eriocitrin, shaddock ped
Glycosides, neohesperidin and Poncirus glycosides are constituted, and the abundantest with aurantiin and neohesperidin content；And rutinose glycoside then mainly by
Eriocitrin, narirutin, aurantiamarin and fragrant breeze grass glycosides are constituted, and based on narirutin and aurantiamarin.This eight kinds of Huangs
Retention time and ultraviolet spectra of the alkanone glucosides substance in HPLC absorb, and the key in LC/MS under positive ion mode is disconnected
It splits regular as shown in table 2.Software for being analyzed by mass spectrometry is Agilent MassHunter Qualitative
Analysis(Agilent Corporation,MA,USA)。
| Retention time (Min) | Ultraviolet spectra absorbs (UV-Vis) | Key Fracture (parent ion, fragment ion) | |
| Eriocitrin | 19.545 | 284,328 | 597[M+H]+,289[M+H-rhamnosy-glucosyl]+ |
| New eriocitrin | 21.191 | 284,332.7 | 597[M+H]+,289[M+H-rhamnosy-glucosyl]+ |
| Narirutin | 24.276 | 282.8,330.4 | 581[M+H]+,273[M+H-rhamnosy-glucosyl]+ |
| Aurantiin | 25.974 | 283.1,330.5 | 581[M+H]+,273[M+H-rhamnosy-glucosyl]+ |
| Aurantiamarin | 27.082 | 284.3,328.2 | 611[M+H]+,303[M+H-rhamnosy-glucosyl]+ |
| Neohesperidin | 28.901 | 284.3,332.8 | 611[M+H]+,303[M+H-rhamnosy-glucosyl]+ |
| Fragrant breeze grass glycosides | 40.607 | 282.8,329.2 | 595[M+H]+,287[M+H-rhamnosy-glucosyl]+ |
| Poncirus glycosides | 41.523 | 284.3,332.9 | 595[M+H]+,287[M+H-rhamnosy-glucosyl]+ |
Table 2
Each flavonoid metabolite is by comparing the retention time of corresponding commercial standard, ultraviolet spectra absorb (UV-Vis) and
Its key Fracture is precisely qualitative to carry out, in combination with mass spectrometry database (http://www.massbank.jp) or even document
Report assist qualitative.
The extraction and molecular labeling amplification of 2.3 different citrus germplasm genomic DNAs
Use novel plant DNA extraction kit (DN-Plant DNA Mini Kit；Aidlab, China) it completes to adopting
Collection 88 kinds of citrus germplasm young leaflet tablet genomic DNA extraction, using above-mentioned molecular labeling specific primer to point
It is other that PCR amplification, PCR response procedures are as follows: 95 DEG C of initial denaturation 3min are carried out to different materials；95 DEG C of denaturation 30s, 57 DEG C of annealing 30s,
72 DEG C of extension 30s, 32 circulations；72 DEG C of extension 10min；12℃30min.
Amplified production is subjected to agarose gel electrophoresis detection, is detected in each citrus germplasm with the presence or absence of molecular labeling.
2.4 result
As shown in Figure 1, HPLC and LC-MS testing result is shown, in 24 kinds of shaddock classes (the 17 kinds of shaddocks, 5 kinds of grape fruits of selection
And 2 kinds of shaddock hybrids) in cultivar fruit, accumulate the neohesperidoside class of bitter taste.And in selected shaddock class fruit
In, aurantiin is the neohesperidoside class that its content has comparative advantage；And chicken tail grape fruit (JW) and shaddock in grape fruit
In cloth orchid family (OBL) fruit difficult to understand in hybrid, other than aurantiin, the neohesperidin of also a large amount of accumulation bitter tastes.Utilize molecule mark
Note specific primer carries out PCR testing result and shows, in selected 24 kinds of shaddock classes DNA, detects in embodiment 1 and divides
The presence of son label；
The orange class cultivar of selected 24 kinds includes 18 kinds of sweet oranges and 6 kinds of bitter oranges, and sweet orange is by 6 kinds of common sweet oranges, 9 hilums
Orange and 3 kinds of blood orange compositions.HPLC and LC-MS testing result shows that 18 kinds of all sweet orange fruits can not accumulate bitter taste
Neohesperidoside class, and in 6 kinds of bitter oranges then largely accumulation bitter tastes neohesperidoside classes.Wherein, aurantiin and neohesperidin
It is content neohesperidoside class the most abundant in bitter orange fruit.PCR testing result is carried out using molecular labeling specific primer
The presence of molecular labeling in embodiment 1 is not detected in display, 18 kinds of selected sweet oranges.And in 6 kinds of bitter orange genomic DNAs,
Then detect the presence of molecular labeling noted earlier.
The wide skin citrus of selected 24 kinds includes tangerine, mandarin orange and mixed citrus.HPLC and LC-MS testing result shows, only portion
Divide the neohesperidoside class that bitter taste can be accumulated in miscellaneous mandarin orange or big hill mandarin orange (Special germplasm) fruit.Different from other germplasm,
It is neohesperidin that content is the most abundant in bowl mandarin orange (OG), rather than aurantiin, and cultivates seed pod in selected tangerine class and mandarin orange class
In reality, then the presence of neohesperidoside can not be detected.It is aobvious that PCR testing result is carried out using molecular labeling specific primer
Show, in selected 20 kinds of tangerine classes and mandarin orange class DNA, the presence of molecular labeling in embodiment 1 is not detected, and in bowl mandarin orange
(OG), in ugly mandarin orange (CG), medicine bergmot (YXG) and big hill mandarin orange (MSYG) genomic DNA, then depositing for molecular labeling is detected
?.
HPLC and LC-MS testing result is shown, in 9 kinds of selected citron class fruits, does not accumulate the new orange peel of bitter taste
Glycoside；And in 2 kinds big wing orange and 5 kinds of Ichang papeda fruits, detect the presence of the neohesperidoside class of bitter taste.Using point
Son label specific primer carries out PCR testing result and shows, in 9 kinds of selected citron class DNA, embodiment 1 is not detected
The presence of middle molecular labeling；And in big wing orange and Ichang papeda genomic DNA, then detect the presence of previous molecular label.
The result shows that the molecular labeling of embodiment 1 can accurately be used for Citrus fruit in 88 kinds of selected citrus germplasm
The identification for the preceding bitter taste phenotype that real neohesperidoside class is induced.
The foregoing is merely presently preferred embodiments of the present invention, is not intended to limit the invention, it is all in spirit of the invention and
Within principle, any modification, equivalent replacement, improvement and so on be should all be included in the protection scope of the present invention.
Sequence table
<110>Hua Zhong Agriculture University
<120>the relevant molecular labeling of bitter taste phenotype and its application before a kind of citrus fruits
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 461
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
atccaagaac ctaccttcaa ggaagatgat acaaagatca tggactggct gagccaaaag 60
gagcctcgtt cagtcgtgta tgcatccttt ggcagtgagt actttccttc caaggatgaa 120
atacatgaga tagctagtgg gttattgctc agcgaggtta attttatatg ggctttcaga 180
ttacatcctg atgaaaaaat gactatcgag gaggcactgc ctcagggctt tgctgaggag 240
attgaaagga ataataaggg aatgatagta caaggttggg ttccgcaggc taaaatttta 300
aggcatggaa gcatcggcgg atttttgagt cattgtggtt ggggctcggt ggttgagggg 360
atggttttcg gggtaccaat cataggtgtg ccaatggcat atgagcagcc aagcaatgcc 420
aaggtggtgg ttgacaatgg tatgggcatg gtcgttccaa g 461
<210> 2
<211> 21
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
atccaagaac ctaccttcaa g 21
<210> 3
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
cttggaacga ccatgcccat accat 25
<210> 4
<211> 1359
<212> DNA
<213>shaddock (Citrus maxima)
<400> 4
atggatacca agcatcaaga taagccaagc attctcatgt taccatggct agctcatggg 60
cacatagctc cacaccttga acttgccaag aagctttcac agaaaaactt ccacatatat 120
ttctgctcta ctcccaacaa tctacaatcc ttcggcagaa atgttgaaaa aaacttctca 180
tcttcaatac aactcataga actgcaactt cccaatacat tccctgaact tccttcacaa 240
aatcagacca caaaaaacct tcctccccat cttatttata ctctcgtggg agcatttgaa 300
gatgcaaaac ctgctttttg caacatcttg gagacgctta aaccaaccct tgttatgtat 360
gatttgttcc aaccatgggc agcagaggca gcttaccagt atgacatagc tgctattttg 420
ttcttaccct tatctgcagt agcctgctct ttcttgctgc acaatatcgt aaatcccagc 480
ctgaaatacc ctttctttga atctgattac caagatagag aaagcaagaa catcaattac 540
ttcctgcatc ttactgccaa tggcacctta aacaaagaca ggttcttaaa agctttcgaa 600
ctatcttgca aatttgtgtt catcaaaaca tcaagagaga ttgaatccaa gtacttggat 660
tattttcctt ctttaatggg aaatgaaata attccagtag ggcctctaat ccaagaacct 720
accttcaagg aagatgatac aaagatcatg gactggctga gccaaaagga gcctcgttca 780
gtcgtgtatg catcctttgg cagtgagtac tttccttcca aggatgaaat acatgagata 840
gctagtgggt tattgctcag cgaggttaat tttatatggg ctttcagatt acatcctgat 900
gaaaaaatga ctatcgagga ggcactgcct cagggctttg ctgaggagat tgaaaggaat 960
aataagggaa tgatagtaca aggttgggtt ccgcaggcta aaattttaag gcatggaagc 1020
atcggcggat ttttgagtca ttgtggttgg ggctcggtgg ttgaggggat ggttttcggg 1080
gtaccaatca taggtgtgcc aatggcatat gagcagccaa gcaatgccaa ggtggtggtt 1140
gacaatggta tgggcatggt cgttccaaga gataagatca atcaaagact tggaggagag 1200
gaggtggcga gggtcattaa acatgttgtg ctgcaagaag aagcgaagca aataagaaga 1260
aaagctaatg aaattagtga gagtatgaag aagatagggg acgcagagat gagtgtggtg 1320
gtggagaagc tgctgcagct tgtcaagaaa tctgaataa 1359
<210> 5
<211> 1357
<212> DNA
<213>sweet orange (Citrus sinensis)
<400> 5
atggatacca agcatcaaga taagccaagc attctcatgt taccatggct agctcatggg 60
cacatatcta cataccttga acttaccaag aagctttcac agaaaaactt tcacatatat 120
ttctgctcta ctcccatcaa tctacaatcc atcagcaaaa atgatgaaga aaacttctta 180
tcttcaatac aactcataga actgcaactt cccaatacat tccctgaact tcctccacaa 240
aatcacacca caaaaaacct tcctccccat cttattttac tctcgtggca gcatttgaag 300
atgcaaaacc agcattttgc aacatcctgg agacgcttaa accaaccctt gttatgtatg 360
atttattcca accatgggca gcagaggcag cttaccagta tcacatagct gctgttttgt 420
tcttaaccat atctgcagta gccggttctt acttgctgca caatatcata aatcccagcc 480
tgaagtaccc tttctttgaa tctgacttcc tcgatagaga aaacaagaaa atcaaccgct 540
tcatgcatcc tactgccaat ggcaccttaa acaaagacag gaacttaaaa gcttttgaac 600
tatcttgcaa atttgtgttc atcaaaacat caagagagat cgaatccaag tacttggatt 660
attttccttc tttgatggaa aatgaaatag ttccagttgg gcctctagtt caagaatcta 720
tattcaaaga agatgatacg aagattatgg actggctgag ccaaaaggag ccttggtcag 780
tagtgtttgt atcatttggc agtgagtact ttctttccaa ggatgaaatg catgagatag 840
ccagtgggtt attgctcagc gaggttagtt ttatacgggt tttgagatta catcctgatg 900
aaaaaattac tatcgaggag gcactgcctc aaggctttgc tgaggagatt gaaaggaata 960
ataagggaat gttagtacaa ggttgggttc cgcaggctaa aattttaagg catggaagga 1020
tcggcggttt tttgagtcat tgtggttggg gttcggcagt tgaagggatg gtgttcgggg 1080
taccaatcat agctatgcca atggtatatg agcagtcaag gaatgccaaa gtggtggttg 1140
atatcggtat gggcatggac gtgccgagag ataagatcaa tcaaagactt agaagagagg 1200
aggtggcaag ggtcattaaa catgttttgc tgcaagaaga agggaagcaa ataagaagaa 1260
aagctaaaga aatgagtgag aggatgagaa gataggagac tcagagatga atgtggtagt 1320
ggagaagctg ctgctgcttg ttaagaaatc tgaataa 1357
<210> 6
<211> 1359
<212> DNA
<213>shaddock (Citrus maxima)
<400> 6
atggatacca agcatcaaga taagccaagt attctcatgt taccatggct agctcatggg 60
cacatatcta cataccttga acttaccaag aagctttcac agaaaaactt tcacatatat 120
ttctgctcta ctcccatcaa tctacaatcc atcagcaaaa atgatgaaga aaacttctca 180
tcttcaatac aactcataga actgcaactt cccaatacat tccctgaact tcctccacaa 240
aatcacacca caaaaaacct tcctccccat cttattttta ctctcatggc agcatttgaa 300
gatgcaaaac cagcattttg caacatcctg gagacgctta aaccaaccct tgttatgtat 360
ggtttattcc aaccatgggc agcagaggcg gcttaccagt atcacatagc tgctgttttg 420
ttcttaacca tatctgcagt agccggttct tacttgctgc acaatatcat aaatcccagc 480
ctgaagtacc ctttctttga atctgacttc ctcgatagag aaaacaagaa aatcaaccgc 540
ttcatgcatc gtactgccaa tggcacctta aacaaagaca ggaacttaaa agcttttgaa 600
ctatcttgca aatttgtgtt catcaaaaca tcaagagaga tcgaatccaa gtacttggat 660
tattttcctt ctttgatgga aaatgaaata gttccagttg ggcctctagt tcaagaatct 720
atattcaaag aagatgatac gaagattatg gactggctga gtcaaaagga gccttggtca 780
gtagtgtttg tatcatttgg cagcgagtac tttctttcca aggatgaaat gcatgagata 840
gccagtgggt tattgctcag cgaggttagt tttatatggg ttttgagatt acatcctgat 900
gaaaaaatta ctatcgagga ggcactgcct caaggctttg ctgaggagat tgaaaggaat 960
aataagggaa tgttagtaca aggttgggtt ccgcaggcta aaattttaag gcatggaagg 1020
atcggcggat ttttgagtca ttgtggttgg ggttcggcag ttgaagggat ggtgttcggg 1080
gtaccaatca tagctatgcc aatggtatat gagcagtcag ggaatgccaa agtggtggtt 1140
gatatcggta tgggcatgga cgtgccgaca gataagatca atcaaagact tagaagagag 1200
gaggtggcaa gggtcattaa acatgttgtg ctgcaagaag aagggaagca aataagaaga 1260
aaagctaaag aaatgagtga gaggatgaag aagataggag actcagagat gaatgtggta 1320
gtggagaagc tgctgcagct tgttaagaaa tctgaataa 1359
Claims (8)
1. the relevant molecular labeling of bitter taste phenotype before a kind of citrus fruits, which is characterized in that the nucleotide of the molecular labeling
Sequence is as shown in SEQ ID NO:1.
2. molecular labeling according to claim 1, which is characterized in that with nucleotide sequence shown in SEQ ID NO:1
Citrus plant individual, fruit display are with preceding bitter taste feature；Lack the citrus of nucleotide sequence shown in SEQ ID NO:1
Platymiscium individual, fruit display are unmatched bitter taste feature.
3. a kind of primer pair for molecular labeling described in detecting as claimed in claim 1 or 22, which is characterized in that the primer pair point
It Ju You not nucleotide sequence shown in SEQ ID NO:2 and SEQ ID NO:3.
4. primer pair according to claim 3, which is characterized in that using the primer pair to citrus plant gene to be measured
Group DNA carries out PCR amplification and detects the length of amplified fragments, when the amplified fragments of 461bp can be amplified, the citrus to be measured
Platymiscium has nucleotide sequence shown in SEQ ID NO:1, and fruit display is with preceding bitter taste feature；When core cannot be amplified
When acid fragment, nucleotide sequence shown in the citrus plant missing SEQ ID NO:1 to be measured, fruit display is unmatched bitter taste
Feature.
5. a kind of kit for molecular labeling described in detecting as claimed in claim 1 or 22, which is characterized in that include claim 3
Or primer pair described in 4.
6. a kind of application of molecular labeling as claimed in claim 1 or 2, which is characterized in that be used for each germplasm fruit of Citrus
The identification of preceding bitter taste phenotype or the screening of the weak bitter taste elite germplasm of Citrus.
7. a kind of application of primer pair as described in claim 3 or 4, which is characterized in that for before each germplasm fruit of Citrus
The identification of bitter taste phenotype or the screening of the weak bitter taste elite germplasm of Citrus.
8. a kind of application of kit as claimed in claim 5, which is characterized in that for bitter taste before each germplasm fruit of Citrus
The identification of phenotype or the screening of the weak bitter taste elite germplasm of Citrus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810811804.8A CN108950045B (en) | 2018-07-23 | 2018-07-23 | Citrus fruit pre-bitter phenotype related molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810811804.8A CN108950045B (en) | 2018-07-23 | 2018-07-23 | Citrus fruit pre-bitter phenotype related molecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108950045A true CN108950045A (en) | 2018-12-07 |
| CN108950045B CN108950045B (en) | 2021-03-30 |
Family
ID=64463336
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810811804.8A Active CN108950045B (en) | 2018-07-23 | 2018-07-23 | Citrus fruit pre-bitter phenotype related molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108950045B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110305856A (en) * | 2019-06-27 | 2019-10-08 | 华中农业大学 | A kind of application of cytochrome P 450 enzymes |
| CN114058728A (en) * | 2021-11-22 | 2022-02-18 | 华南农业大学 | Set of molecular markers for identifying phyllanthus emblica strain and application thereof |
| CN116286712A (en) * | 2023-05-11 | 2023-06-23 | 中国中医科学院中药研究所 | Rhamnosyl transferase mutant, coding gene, preparation method and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000043490A2 (en) * | 1999-01-22 | 2000-07-27 | Yeda Research And Development Co. Ltd. | Rhamnosyl-transferase gene and uses thereof |
| CN107267461A (en) * | 2017-06-08 | 2017-10-20 | 华中农业大学 | It is a kind of largely to produce the tobacco cell, its preparation method and application of aurantiin |
-
2018
- 2018-07-23 CN CN201810811804.8A patent/CN108950045B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000043490A2 (en) * | 1999-01-22 | 2000-07-27 | Yeda Research And Development Co. Ltd. | Rhamnosyl-transferase gene and uses thereof |
| CN107267461A (en) * | 2017-06-08 | 2017-10-20 | 华中农业大学 | It is a kind of largely to produce the tobacco cell, its preparation method and application of aurantiin |
Non-Patent Citations (5)
| Title |
|---|
| AHUVA FRYDMAN等: "Citrus fruit bitter flavors: isolation and functional characterization of the gene Cm1,2RhaT encoding a 1,2 rhamnosyltransferase, a key enzyme in the biosynthesis of the bitter flavonoids of citrus", 《PLANT J》 * |
| AHUVA FRYDMAN等: "The molecular and enzymatic basis of bitter/non-bitter flavor of citrus fruit: evolution of branch-forming rhamnosyltransferases under domestication", 《PLANT J》 * |
| EIKI KOJA等: "Identification and characterization of a rhamnosyltransferase involved in rutin biosynthesis in Fagopyrum esculentum (common buckwheat)", 《BIOSCI BIOTECHNOL BIOCHEM》 * |
| 李绍杰: "柑橘果实主要苦味物质含量变化及相关基因表达分析", 《中国优秀硕士学位论文全文数据库农业科技辑》 * |
| 陈嘉景: "柑橘中类黄酮新橘皮糖苷代谢关键基因分离和功能分析", 《中国博士学位论文全文数据库农业科技辑》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110305856A (en) * | 2019-06-27 | 2019-10-08 | 华中农业大学 | A kind of application of cytochrome P 450 enzymes |
| CN114058728A (en) * | 2021-11-22 | 2022-02-18 | 华南农业大学 | Set of molecular markers for identifying phyllanthus emblica strain and application thereof |
| CN114058728B (en) * | 2021-11-22 | 2023-08-08 | 华南农业大学 | Molecular marker set for tea branch citrus strain identification and application thereof |
| CN116286712A (en) * | 2023-05-11 | 2023-06-23 | 中国中医科学院中药研究所 | Rhamnosyl transferase mutant, coding gene, preparation method and application |
| CN116286712B (en) * | 2023-05-11 | 2023-08-25 | 中国中医科学院中药研究所 | Rhamnosyl transferase mutant, coding gene, preparation method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108950045B (en) | 2021-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Frydman et al. | Citrus fruit bitter flavors: isolation and functional characterization of the gene Cm1, 2RhaT encoding a 1, 2 rhamnosyltransferase, a key enzyme in the biosynthesis of the bitter flavonoids of citrus | |
| Vrhovsek et al. | Identification and quantification of flavonol glycosides in cultivated blueberry cultivars | |
| Chen et al. | Cit1, 2RhaT and two novel CitdGlcT s participate in flavor-related flavonoid metabolism during citrus fruit development | |
| CN108950045A (en) | The relevant molecular labeling of bitter taste phenotype and its application before a kind of citrus fruits | |
| De Beer et al. | Development of HPLC method for Cyclopia subternata phenolic compound analysis and application to other Cyclopia spp. | |
| CN106755308A (en) | Screen the '-hydroxylase gene functional label of flavonoids 3 ', 5 ' and its application, application process of dihydroxy catechin tea tree high | |
| CN102676578B (en) | Method for increasing artemisinin content in sweet wormwood by DBR2 (double bond reductase 2) gene transfer | |
| Chester et al. | Genetic and metabolic diversity in Stevia rebaudiana using RAPD and HPTLC analysis | |
| CN107164459B (en) | Functional marker for identifying and screening tea trees with high catechin indexes and application of functional marker | |
| Bi et al. | Greenhouse performance, genetic stability and biochemical compounds in Chrysanthemum morifolium ‘Hangju’plants regenerated from cryopreserved shoot tips | |
| Guo et al. | Temporospatial flavonoids metabolism variation in Ginkgo biloba leaves | |
| Perlatti et al. | Application of a quantitative HPLC-ESI-MS/MS method for flavonoids in different vegetables matrices | |
| Veremeichik et al. | Isoflavonoid biosynthesis in cultivated and wild soybeans grown in the field under adverse climate conditions | |
| Bai et al. | Transcriptomic analysis and dynamic expression of genes reveal flavonoid synthesis in Scutellaria viscidula | |
| Bombo et al. | Capitate glandular trichomes in Aldama discolor (Heliantheae–Asteraceae): morphology, metabolite profile and sesquiterpene biosynthesis | |
| CN105646686A (en) | Gene for regulating and controlling synthesis of plant flavonol and application | |
| Łuczkiewicz et al. | LC-DAD UV and LC-MS for the analysis of isoflavones and flavones from in vitro and in vivo biomass of Genista tinctoria L. | |
| CN105925709A (en) | PCR (Polymerase Chain Reaction) system of SCoT (Start Codon Targeted Polymorphism) molecular marker for rubus biflorus buch | |
| Jiang et al. | Glucosinolate content of camelina genotypes as affected by applied nitrogen and sulphur | |
| CN103772460A (en) | Extraction process of cordycepin (active substance) from silkworm pupa cordyceps militaris | |
| Vasilev et al. | Metabolic profiling of lignan variability in Linum species of section Syllinum native to Bulgaria | |
| Gerhardt et al. | Occurrence of RNA in glyoxysomes from castor bean endosperm | |
| Scordino et al. | Characterization of polyphenolic profile of citrus fruit by HPLC/PDA/ESI/MS-MS | |
| Subramaniam et al. | Comparative analysis of lycorine in wild plant and callus culture samples of Hymenocallis littoralis by HPLC-UV method | |
| Cascini | Investigations into the hypothesis of transgenic cannabis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |