CN108950030A - For detecting primer, detection method and the kit of Listeria Monocytogenes - Google Patents
For detecting primer, detection method and the kit of Listeria Monocytogenes Download PDFInfo
- Publication number
- CN108950030A CN108950030A CN201810668342.9A CN201810668342A CN108950030A CN 108950030 A CN108950030 A CN 108950030A CN 201810668342 A CN201810668342 A CN 201810668342A CN 108950030 A CN108950030 A CN 108950030A
- Authority
- CN
- China
- Prior art keywords
- listeria monocytogenes
- reaction
- kit
- primer sets
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of for detecting the primer sets, detection method and kit of Listeria Monocytogenes.Using reverse transcriptase by the mRNA reverse transcription of cls gene to be checked at CDNA, and 4 species specific primers are devised according to 6 regions to target gene, using Bst archaeal dna polymerase in 63-65 DEG C or so amplification 1h, completes nucleic acid amplification reaction.Not only specificity is high but also quick and precisely for this method, can accurately exclude the interference of dead bacterium in sample, avoid dead bacterium bring false positive.
Description
Technical field
The invention belongs to field of detection of food safety, and in particular to one kind is for detecting Listeria Monocytogenes
Primer sets, detection method and kit.
Background technique
Listeria monocytogenes (Listeria monocytogenes, LM) abbreviation Listeria monocytogenes.It is single
Numerous food product, including livestock meat, ferment sausage and marine product etc. can be infected by increasing Listeria.WHO is by itself and Escherichia coli
O157:H7, salmonella, staphylococcus aureus are listed as big food-borne pathogens the 1990s four.It is Liszt
The strongest bacterium of pathogenicity in Pseudomonas.Listeria monocytogenes are extensive in distributed in nature, such as in rotten plant, soil, animal
It is found in excrement, sewage；Also there is different degrees of pollution in newborn meat egg products, vegetables and aquatic products.It is cheese, cold and dressed with sauce
Cabbage, hot dog, poultry etc. are the conventional foods for causing listeriosis.Since Listeria monocytogenes are as zoonosis
Bacterium, it is widely distributed, it is normally bred at 4 DEG C, it is food-safe to constitute serious threat, therefore various countries are to singly increasing Li Si in food
Special bacterium makes the regulation U.S. one after another and requires to sell in food there is not allowed that Listeria monocytogenes.It is single in Canada's regulation ready-to-eat food
The quantity for increasing Listeria is no more than 100cfu/g.These prescribed requirements can accurately measure a small amount of single increasing Li Si in food
Special bacterium.
The identification of Listeria monocytogenes at present mostly uses National Standard Method, enzyme-linked immunization, PCR method, LAMP method.
1, Physiology and biochemistry detection method (National Standard Method)
EB enrichment and LB enrichment in national standard, by being separately cultured of microorganism, biochemical reaction, hemolytic test,
Collaboration hemolytic test, animal experiment etc. carry out separation identification.Experimental facilities is of less demanding, strong operability, but round of visits is long,
It needs 6-7 days.Before this traditional detection method has been unable to satisfy the on-line checking in food production, food listing and consumption
The requirement quickly detected.
2, enzyme-linked immunization
Immunoassays are a kind of detection techniques based on antibody to antigen affinity, and this method is not easily susceptible to other in sample
The interference of ingredient can accurately measure the antigen in a small amount of sample.Immunological detection is swift to operate, high specificity, sensitivity
Height, but prepare the higher cost of monoclonal antibody.And there are antigenic cross-reaction between the thallus and flagellum of Listeria,
Reduce the specificity of detection.
3, nucleic acid detection method
(1) polymerase chain reaction method (PCR method)
Round pcr has had been obtained and has been widely applied since 1980 by invention.Its method is with a pair of of oligo DNA
As primer, the DNA that will be expanded passes through high temperature unwinding, and annealing finally carries out duplication extension.So repeat 25~35 circulations
It can be obtained by a large amount of DNA.The detection of Listeria monocytogenes, one is the special virulence according to it for the design of specific primer
Gene order (common hlyA, iap, inl, Dth), one is distinguished sequence (16S or the 16S/ in the genome sequence according to it
Conservative region among 23S).Jiang Yong is equal using the hlyA virulence gene of Listeria monocytogenes as target sequence by force, can detect 4cfu/mL
Milk.Wang etc. can detect 1~2cfu/mL milk sample with the iap virulence gene segment of PCR amplification Listeria monocytogenes.
Conservative region carries out PCR amplification among the 16S/23S rRNA gene such as Graham, carries out to the specificity of Listeria monocytogenes
Research provides foundation for detection.However the transformation of multiple temperature involved in regular-PCR process, need to use expensive PCR
The equipment such as instrument and gel imager, the on-site test being not suitable under non-laboratory condition.And PCR detection cannot distinguish between in sample extremely
The Listeria monocytogenes died often result in the result that will cause false positive.
(2) LAMP method
Ring mediated isothermal amplification method (Loop-mediated isothermal amplification, LAMP) is by Japan
The novel nucleic acid detection method (14) of one kind that people Notomi is developed.LAMP analysis method have specific good, high sensitivity and
The advantages that at low cost (15).This method has become food industry and public health agencies (14) the case where not needing precision equipment
A valuable tool for lower quick diagnosis microorganism.However, since LAMP is also the DNA in test sample, so also holding
Easily because dead bacterium causes false positive.So if having a kind of detection method, it can be quick, sensitive, accurate, and do not need complicated examination
Equipment is tested, pathogen can be detected under the conditions of field, so that it may timely and effectively control the pollution in food chain.
(3) RT-LAMP method
RT-LAMP also be used to detect the genome of RNA virus at present, and multiple virus detection reagents have now been developed
Box (16,17).But there has been no the reports that RT-LAMP is used for detection bacterium at present.Detection bacterium is gone with RT-LAMP technology
RNA can accurately exclude the interference of dead bacterium in sample.After bacterial death, RNA can be decomposed rapidly, therefore RNA can make
DNA is replaced to be detected by a mark of living body.The detection segment that the present invention designs is RNA, more due to having in cell
Part RNA copy, therefore the high sensitivity detected is in the conventional LAMP technology of detection DNA.This patent describe it is a kind of it is quick, sensitive,
Accurately quickly detect the method for Listeria monocytogenes in food.
Summary of the invention
Detection method in order to solve existing Listeria monocytogenes is not easy, sensitivity is low, the time is long, poor specificity, vacation
Positive high technological deficiency, the present invention provides a kind of reverse transcription monotonic increasing Listeria hymenial veil mediated isothermality amplification techniques quickly to detect
With primer sets, can be used for detecting Listeria Monocytogenes In Food.
For detecting the primer sets of Listeria Monocytogenes, which is characterized in that the primer sets sequence are as follows:
F3:GCTGCTGAAAAAACAGAGAA；
B3:TGCTTACTGCTTTGTCAGT；
FIP:TTGTTCCACCTTTGATGGACGTAATAAGCGCAACTTGGTTAAACG；
BIP:GTAACTGTTGAAACAACCGAATCTAACAGTATTTACCGTTAACGAAACC.
A second object of the present invention is to provide a kind of kits for detecting Listeria monocytogenes.
For detecting the kit of Listeria Monocytogenes, which is characterized in that the kit includes sample
Pretreatment fluid, reaction solution, Bst archaeal dna polymerase, positive control solution and above-mentioned primer sets.
Further, volume ratio F3-F: B3-R: FIP: BIP 1: 1: 2.5: 2.5 of the primer sets.The reaction solution
It is the 10 × Thermopol reaction buffer for being 3: 3: 1: 2 by volume ratio, 1.2mMdNTPs, 2.0mM MgSO4With 1M glycine betaine
Composition.Preferably, 10 × Thermopol reaction buffer contains 200mM pH8.8 trishydroxymethylaminomethane hydrochloric acid
Salt, 1 00mM potassium chloride, 100mM ammonium sulfate, 2 0mM magnesium sulfate and concentration of volume percent are 1% triton x-100.
Further, contain 8~16 active units for described every microlitre of Bst archaeal dna polymerase.
The kit further includes color developing agent, and color developing agent is fluorescent dye, preferably SYBR Green I.
Third object of the present invention is to provide the methods of detection Listeria Monocytogenes, including following step
It is rapid:
1) extraction of Listeria Monocytogenes RNA；
2) reverse transcription is carried out with AMV reverse transcriptase；
3) ring mediated isothermal amplification of Listeria Monocytogenes: prepared PCR pipe is reacted in 60-65 DEG C
1-1.5 hours, 80 DEG C of termination reactions；Wherein reaction system total volume is 25 μ L, is reacted including 3 μ L10 × Thermopol
Buffer, 3 μ L dNTPs, 1 μ L MgSO4, 2.5 μ l FIP, 2.5 μ l BIP, 1 μ l F3,1 μ l B3,2 μ l glycine betaines, 1 μ l
Bst archaeal dna polymerase and 8 μ l reverse transcription CDNA to be checked；
Primer sets sequence are as follows:
F3:GCTGCTGAAAAAACAGAGAA；
B3:TGCTTACTGCTTTGTCAGT；
FIP:TTGTTCCACCTTTGATGGACGTAATAAGCGCAACTTGGTTAAACG；
BIP:GTAACTGTTGAAACAACCGAATCTAACAGTATTTACCGTTAACGAAACC.
5) it analyzes and determines reaction product result: 2.5 μ l fluorescent dyes being added in the reaction product, be sun if shows green
Property, orange is then feminine gender；Or after 10000g centrifugation, identification is observed by the naked eye, it is shown compared with negative control pipe, detection pipe
Obvious sediment occur is the positive, has no that precipitating is feminine gender.
Further, ring mediated isothermal amplification temperature is 63 DEG C, the reaction time 1 hour.
The present invention is a kind of utilization quick test sample Listeria monocytogenes viable bacteria of reverse transcription loop Jie isothermal amplification technique
Method, using reverse transcriptase by the mRNA reverse transcription of cls gene to be checked at CDNA, and according to target gene 6 regions design
4 species specific primers complete nucleic acid amplification reaction using Bst archaeal dna polymerase in 60-65 DEG C of amplification 1h.Expand anti-
Mg during answering, from the pyrophosphate ion and reaction solution that dNTP is precipitated2+In conjunction with generating by-product-pyrophosphoric acid is in cream
White precipitate can observe by the naked eye judgement result.Not only specificity is high but also quick and precisely for this method, can be by target piece
Section is expanded to 109-1010Times, it is omitted in PCR amplification and is denaturalized, anneals and extends these three steps, the time is greatly saved.
This comparatively gentle temperature condition and simplify required instrument without temperature cycles, overcomes normal PCR
Intrinsic detection time is long, is easy the disadvantages of pollution and testing cost are high.In addition, technology of this detection method to testing staff
Competency profiling is lower, and practical operation is extremely easy, does not need special reagent and instrument and equipment, is conducive to establish low-cost
Quickly screening system.
RT-LAMP method is a kind of easy, quick, high degree of specificity gene amplification method.By reverse transcription constant temperature gene amplification
Technology is compared with other nucleic acid detection techniques, it can be found that the technology is in the methods of sensitivity, specificity and false positive
Learn and be better than other nucleic acid detection techniques in index, and do not depend on, any special instrument and equipment can be realized it is live high-throughput fast
Speed detection.It is domestic that there has been no the sales of the kit of this respect at present.At present in national standard by microorganism be separately cultured and in the form of
The passing method identified based on identifying, in conjunction with biochemical analysis and serological typing is learned, Preliminary Identification needs 2-3 days, completes identification report
Accusing needs 10 to 15 days；It is only needed 3 hours using the gene diagnosis kit detection in the present invention.Also, reaction solution of the invention
In be added to fluorescent dye, qualification result is more visual and clear.
The present invention has following technical characterstic:
(1), instrument and equipment is simple, does not need expensive device.
(2), high specific: six regions pairs of four isothermal duplication primers and target gene reduce the probability of mispairing.
(3), quick, efficient amplification: detection time 3 hours or so.
(4), high sensitivity: the lowest detection limit reaches 10CFU/ml；The recall rate of sample reaches 99%.
(5), identification is easy: can be creamy white precipitating by directly observing pyrophosphoric acid, or by the way that fluorescent dye is added after, it is positive
Property result colour developing for green, negative findings be it is orange, visually just can determine that result.
(6), false positive is low: the common LAMP for being used to detect DNA cannot distinguish dead bacterium and viable bacteria, in actually detected
It is easy to cause false positive.And with the method for RT-LAMP, the interference of DNA is eliminated, has the characteristics that only to detect a viable bacteria.So false
The positive is well below common LAMP.
(7), purposes is wide: can be widely used for the fields such as food, aquatic products, cosmetics and health care safety rapid detection.
(8), because molecular amounts of the mRNA of reverse transcription LAMP detection in cell are much larger than the gene number contained in DNA
Amount, that is to say, that mRNA has higher abundance, it is easier to be detected.So detecting the sensitive of Listeria with RT-LAMP
Degree is higher than common LAMP.This is also that RT-LAMP is applied to detection Listeria for the first time.
Detailed description of the invention
Fig. 1 is RT-LAMP reaction result electrophoretogram.Wherein M-Mark 2000 ×；1- reaction product；2- negative control.
Fig. 2 is the specific test electrophoretogram of RT-LAMP reaction.Wherein M-2000bp Ladder Marker；1- monokaryon
Hyperplasia Listeria WS1；2- Listeria monocytogenes F2365；3- Listeria monocytogenes F8027；
4- Listeria monocytogenes J1723；5- Listeria monocytogenes HF550；6- monocyte hyperplasia Liszt
Bacterium J1045；7- Listeria monocytogenes clip11262；8- Listeria monocytogenes J0161；9- large intestine bar
Bacterium O104；10- salmonella；11- negative control.
Fig. 3 is the sensitivity test electrophoretogram of LAMP reaction.M-Mark 2000×；1- extension rate is 100；2- dilution
Multiple is 10-1；3- extension rate is 10-2；4- extension rate is 10-3；5- extension rate is 10-4；6- extension rate is 10-5；
7- extension rate is 10-6；8- extension rate is 10-7；9- negative reaction.
Specific embodiment
Following specific embodiments are the further explanations to method provided by the invention and technical solution, but are not construed as
Limitation of the present invention.
Embodiment 1: the screening of primer and reaction condition optimization
With reference to Listeria monocytogenes iap gene order, present inventor to the information such as sequence binding site carried out compared with
For in-depth study.Many experiments show that the effect of different primer pair constant-temperature amplifications and sensitivity have a very big impact.Cause
The primer quality and unstable come is predicted for LAMP primer design software PrimerExplorerV5.In actual use, it expands
Success rate it is very low.So needing to test a large amount of software prediction primer when studying LAMP amplification, therefrom select efficiently
Stable available primer.During actual experiment, it has been found that the primer stability of software prediction is not high, so we
2 complementary bases are supplemented at 5 ' ends of software prediction primer, increase the stability of primer.The more sets of this researching and designing draw
Object, by experiment, finishing screen selects a pair of of outer primer and a pair of of inner primer.
Table 1: Listeria Monocytogenes primer iap gene primer sequence
It is first CDNA by the Listeria monocytogenes mRNA reverse transcription of extraction, it is anti-into LAMP by template of CDNA
It answers, primer is 4 primers (BIP, FIP, F3, B3) of LAMP primer.LAMP reaction system (25 μ L): containing 10 ×
ThermoPoL Buffer 3μL(200mmol/L Tris-HC1、100mmol/L KC1、20mmol/L MgSO4、100mmol/
L(NH4)2SO4, 1.0%Triton x-100), 3 μ L of 2.5mmol/L dNTPs, 100mmol/L MgSO4 1μL、40mmol/L
2.5 μ L of FIP, 2.5 μ L of 40mmol/L BIP, 1 μ L of 10mmol/L F3,1 μ L of 10mmol/L B3,1mmol/L glycine betaine U/L
1 μ L of BstDNA Polymerase, 0.5 μ L deionized water of Listeria monocytogenes CDNA template complement to 25 μ L.Instead
Should pipe be placed in water-bath, 65 DEG C of reaction temperature, time 60min, after reaction, while utilize 2% agarose gel electrophoresis
It verifies whether that LAMP reaction occurs.The result is shown in Figure 1.It will be seen from figure 1 that there is gradient band, Successful amplification in reaction product
Out, reaction system is also tentatively established, and in order to ensure the stabilization of reaction system, is optimized to LAMP reaction system.Determine 25 μ
Mg in L LAMP reaction system2+Concentration be 2.0mmol/L, the concentration of dNTPs is 1.2mmol/L, and the concentration of Bst enzyme is
320U/mL selects 63.0 DEG C of annealing temperatures combined for most suitable primer.
Specific test is carried out to Listeria monocytogenes and other strains using LAMP.Figure it is seen that different lists
Increasing Listeria can amplify.And for other strains, LAMP amplification is generated without band.Illustrate LAMP reaction pair
Listeria monocytogenes have specificity.
DNA is diluted to various concentration gradient and carries out LAMP test, its sensitivity is observed, as a result sees Fig. 3.It can be with by Fig. 3
Find out, different concentration gradients has the appearance of amplified band, with the variation of concentration, until extension rate is 10-7Until by
Gradual change is light, therefore the sensitivity of its primer is 4.36 × 10-6ng/μL。
Embodiment 2: the preparation of kit
Diagnostic kit provided by the present invention is reversed by two pairs of isothermal amplimers (F3-F, B3-R, FIP, BIP)
Record enzyme, Bst archaeal dna polymerase, reaction solution, sample pretreatment liquid, the composition such as color developing agent.
(1) primer is drawn by 20 μM of outer primers 1 (F3) of 1:1:2.5:2.5, outer primer 2 (B3), inner primer l (FIP) with interior
Object 2 (BIP) composition.
(2) 10 × Thermopol reaction buffer that reaction solution is 3: 3: 1: 2 by volume ratio, 1.2mMdNTPs, 2.0mM
MgSO4With 1M betaine group at.10 × Thermopol reaction buffer contains 200mM pH8.8 trishydroxymethylaminomethane
Hydrochloride, 1 00mM potassium chloride, 100mM ammonium sulfate, 2 0mM magnesium sulfate and concentration of volume percent are 1% triton x-100.
(3) Bst archaeal dna polymerase is Bst DNA polymerase, and every microlitre contains 8 active units.
(4) sample pretreatment liquid is 20mM pH 8.0Tris-HCl, 2mM EDTA, and concentration of volume percent is 1.2% bent
Logical X-1 00 is drawn to form；
(5) color developing agent is fluorescent dye SYBRGreen I.
Embodiment 3: detection method
(1), it is detected the extraction of RNA in sample:
The extraction of Listeria monocytogenes RNA:
1. 8,000r/min, 4 DEG C, 5min collects 2~4mL of somatic cells.
2. 1mL TE (10mM Tris-HCL, 1mM EDTA, pH 7.5) buffer is washed once, 1mL TE (includes 0.2%
Triton X-100) it is resuspended.
3. 100 DEG C, 15~25min goes to rapidly ice bath.
4. plus chloroform in equal volume, turn upside down 10~15 times mixing, 12,000r/min, 4 DEG C, 10min centrifugation.
5. turning supernatant to new pipe.
6. plus dehydrated alcohol, -20 DEG C of placement 20min- are pre-chilled in 1/10 volume 3M sodium acetate (pH 5.2), 2~2.5 times of volumes
Overnight.
7. 12,000r/min, 4 DEG C, supernatant is abandoned in 10min centrifugation.
8. 1mL washes of absolute alcohol precipitates 2-3 times.
9. being placed at room temperature for 5min, precipitating is dissolved with 30~50 μ L RNase-free water.The RNase inhibitor of 1 μ L is added ,-
80 DEG C save backup.
(2) RT (20 μ l volume) is carried out with AMV reverse transcriptase:
1., be added 5 μ l DEPC water, 1 μ l (50p mol) random primer, 6 μ l template ribonucleic acids are into 0.2ml EP pipe；
2., be slightly centrifuged, 100 DEG C of abundant 1min of boiling water；
3., be added 2 μ l dNTP (10mM each), 4 μ 5 × RT of l Buffer, 1 μ l (10U) AMV reverse transcriptase, 1 μ l
(10U) RNase inhibitor；42 DEG C are made reverse transcription in water-bath 1 hour；
4., the abundant 3min of 100 DEG C of boiling water inactivate AMV；Isothermal duplication or -20 DEG C of preservations are done immediately.
(3), loop-mediated isothermal amplification technique reaction process:
A, reaction system: each 2.5 μ l of four kinds of primers, reaction buffer 2.5 μ l, Bst is prepared in 200 μ l PCR pipes
Polymerase Large Fragment 1ul (8U), 3 μ l of dNTPs, 1 μ l of MgSO4, 1 μ l of target
cDNA；, add 2.5 μ l water, 1 μ l of Bst DNA Polymerase.
B, by prepared PCR pipe in 63 DEG C of reaction 1-1.5h, 80 DEG C of termination reactions.
(4), it analyzes and determines reaction product result: 2.5 μ l fluorescent dyes being added in the reaction product.
(SYBRGREN), it mixes, stands 5min, be the positive if shows green, it is orange for feminine gender.
Sequence table
<110>Zhejiang Prov Industrial And Commercial University
<120>for detecting primer, detection method and the kit of Listeria Monocytogenes
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
gctgctgaaa aaacagagaa 20
<210> 2
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
tgcttactgc tttgtcagt 19
<210> 3
<211> 45
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
ttgttccacc tttgatggac gtaataagcg caacttggtt aaacg 45
<210> 4
<211> 49
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
gtaactgttg aaacaaccga atctaacagt atttaccgtt aacgaaacc 49
Claims (10)
1. the primer sets for detecting Listeria Monocytogenes, which is characterized in that the primer sets sequence are as follows:
F3:GCTGCTGAAAAAACAGAGAA；
B3:TGCTTACTGCTTTGTCAGT；
FIP:TTGTTCCACCTTTGATGGACGTAATAAGCGCAACTTGGTTAAACG；
BIP:GTAACTGTTGAAACAACCGAATCTAACAGTATTTACCGTTAACGAAACC.
2. the kit for detecting Listeria Monocytogenes, which is characterized in that the kit includes that sample is pre-
Treatment fluid, reaction solution, Bst archaeal dna polymerase, positive control solution and primer sets described in claim 1.
3. kit according to claim 2, which is characterized in that volume ratio F3: B3: FIP: BIP 1 of the primer sets
∶1∶2.5∶2.5。
4. kit according to claim 2, which is characterized in that the reaction solution be by volume ratio be 3: 3: 1: 2 10
× Thermopol reaction buffer, 1.2mM dNTPs, 2.0mM MgSO4 and 1M betaine group at.
5. kit according to claim 4, which is characterized in that 10 × Thermopol reaction buffer contains
200mM pH8.8 trishydroxymethylaminomethane hydrochloride, 100mM potassium chloride, 100mM ammonium sulfate, 2 0mM magnesium sulfate and volume
Percent concentration is 1% triton x-100.
6. kit according to claim 2, which is characterized in that described every microlitre of Bst archaeal dna polymerase contains 8~16 work
Property unit.
7. kit according to claim 2, which is characterized in that the kit further includes color developing agent, and color developing agent is glimmering
Photoinitiator dye.
8. kit according to claim 7, which is characterized in that the fluorescent dye is SYBR Green I.
9. the method for detecting Listeria Monocytogenes, which is characterized in that the described method comprises the following steps:
1) extraction of Listeria Monocytogenes RNA；
2) reverse transcription is carried out with AMV reverse transcriptase；
3) ring mediated isothermal amplification of Listeria Monocytogenes: by prepared PCR pipe in 60-65 DEG C of reaction 1-
1.5 hours, 80 DEG C of termination reactions；Wherein reaction system total volume is 25 μ L, reacts slow including 3 μ L10 × Thermopol
Fliud flushing, 3 μ L dNTPs, 1 μ L MgSO4, 2.5 μ l FIP, 2.5 μ l BIP, 1 μ l F3,1 μ l B3,2 μ l glycine betaines, 1 μ l Bst
Archaeal dna polymerase and 8 μ l reverse transcription CDNA to be checked
Primer sets sequence are as follows:
F3:GCTGCTGAAAAAACAGAGAA；
B3:TGCTTACTGCTTTGTCAGT；
FIP:TTGTTCCACCTTTGATGGACGTAATAAGCGCAACTTGGTTAAACG；
BIP:GTAACTGTTGAAACAACCGAATCTAACAGTATTTACCGTTAACGAAACC.
5) it analyzes and determines reaction product result: 2.5 μ l fluorescent dyes being added in the reaction product, be the positive if shows green,
Orange is then feminine gender；Or after 10000g centrifugation, identification is observed by the naked eye, it is shown compared with negative control pipe, detection pipe goes out
Existing obvious sediment is the positive, has no that precipitating is feminine gender.
10. according to the method described in claim 9, it is characterized in that, ring mediated isothermal amplification temperature be 63.0 DEG C, the reaction time
1 hour.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810668342.9A CN108950030A (en) | 2018-06-26 | 2018-06-26 | For detecting primer, detection method and the kit of Listeria Monocytogenes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810668342.9A CN108950030A (en) | 2018-06-26 | 2018-06-26 | For detecting primer, detection method and the kit of Listeria Monocytogenes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108950030A true CN108950030A (en) | 2018-12-07 |
Family
ID=64486686
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810668342.9A Pending CN108950030A (en) | 2018-06-26 | 2018-06-26 | For detecting primer, detection method and the kit of Listeria Monocytogenes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108950030A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101368203A (en) * | 2008-09-16 | 2009-02-18 | 中国计量学院 | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection |
| CN104263838A (en) * | 2014-10-13 | 2015-01-07 | 天津市动物疫病预防控制中心 | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes |
| CN104328113A (en) * | 2014-10-12 | 2015-02-04 | 中国疾病预防控制中心传染病预防控制所 | Nucleotide sequence composition and application thereof in Listeria monocytogenes identification |
-
2018
- 2018-06-26 CN CN201810668342.9A patent/CN108950030A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101368203A (en) * | 2008-09-16 | 2009-02-18 | 中国计量学院 | Primer, reagent kit and detection method for monotonic increasing Listeria hymenial veil mediated isothermality amplification technique fast detection |
| CN104328113A (en) * | 2014-10-12 | 2015-02-04 | 中国疾病预防控制中心传染病预防控制所 | Nucleotide sequence composition and application thereof in Listeria monocytogenes identification |
| CN104263838A (en) * | 2014-10-13 | 2015-01-07 | 天津市动物疫病预防控制中心 | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes |
Non-Patent Citations (4)
| Title |
|---|
| CHENGHUA LI等: "Development and Application of Reverse Transcription Loop-Mediated Isothermal Amplification for Detecting Live Shewanella putrefaciens in Preserved Fish Sample", 《JOURNAL OF FOOD SCIENCE》 * |
| DEGUO WANG等: "DEVELOPMENT AND EVALUATION OF A LOOP‐MEDIATED ISOTHERMAL AMPLIFICATION (LAMP) METHOD FOR DETECTING LISTERIA MONOCYTOGENES IN RAW MILK", 《JOURNAL OF FOOD SAFETY》 * |
| 刘宁伟等: "多重环介导等温扩增快速检测沙门菌、副溶血弧菌和单核细胞增生性李斯特菌方法的建立", 《军事医学》 * |
| 谭贵良等: "《现代分子生物学及组学技术在食品安全检测中的应用》", 30 June 2014, 中山大学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106367500B (en) | Method for rapidly detecting vibrio vulnificus at constant temperature, primer and application | |
| CN110195121B (en) | CPA primer, kit and detection method for detecting methicillin-resistant staphylococcus aureus | |
| Li et al. | A novel visual loop-mediated isothermal amplification assay targeting gene62181533 for the detection of Salmonella spp. in foods | |
| Yuan et al. | Development of the saltatory rolling circle amplification assay for rapid and visual detection of Alicyclobacillus acidoterrestris in apple juice | |
| CN102154497B (en) | M-PCR (Multiplex Polymerase Chain Reaction) primers, probes and detection methods for vibrio cholerae, vibrio parahaemolyticus and salmonella | |
| CN102367475A (en) | M-PCR (multiplex-polymerase chain reaction) detection kit for different serotype vibrio cholerae and detection method thereof | |
| CN105039541A (en) | Primer and probe sequence used for LAMP-LFD detection of vibrio fluvialis and application of primer and probe sequence | |
| CN107022638A (en) | The LAMP primer group of quick detection salmonella and its application | |
| US20220098645A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN112725480B (en) | Primer group, detection method and kit for rapidly detecting salmonella typhi by LAMP (loop-mediated isothermal amplification) technology | |
| US6268143B1 (en) | Automated high throughput E. coli o157:H7 PCR detection system and uses thereof | |
| Du et al. | Probe-based loop-mediated isothermal amplification assay for multi-target quantitative detection of three foodborne pathogens in seafood | |
| AU2006215415B2 (en) | Method for detecting viable cells in a sample by using a virus | |
| Zhou et al. | Rapid visual detection of Aeromonas salmonicida by loop‐mediated isothermal amplification with hydroxynaphthol blue dye | |
| Liu et al. | Development of a Loop‐Mediated Isothermal Amplification Assay Based on lmo0460 Sequence for Detection of L isteria monocytogenes | |
| Mozola | Genetics-based methods for detection of Salmonella spp. in foods | |
| CN102827928B (en) | Rapid diagnosis method for plesimonas shigelloides | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| CN110938704A (en) | LAMP (loop-mediated isothermal amplification) synchronous detection method and kit for staphylococcus aureus and salmonella in liquid milk | |
| CN109735636A (en) | A kind of primer, kit and the method for PSR detection staphylococcus aureus leucocytic toxin | |
| CN108950030A (en) | For detecting primer, detection method and the kit of Listeria Monocytogenes | |
| CN111004854B (en) | Rapid constant temperature detection method, primer set and kit for vibrio vulnificus and vibrio cholerae simultaneously | |
| Charoenpanich et al. | A pH sensitive, loop-mediated isothermal amplification assay for detection of Salmonella in food | |
| Fratamico et al. | Applications of the polymerase chain reaction for detection, identification, and typing of food-borne microorganisms | |
| CN116064877A (en) | Kit and method for rapidly detecting enterobacter cloacae by utilizing LAMP technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181207 |