CN108913684A - A kind of method that exogenous sequences efficiently pinpoint orientation insertion DNA virus genome - Google Patents
A kind of method that exogenous sequences efficiently pinpoint orientation insertion DNA virus genome Download PDFInfo
- Publication number
- CN108913684A CN108913684A CN201810841103.9A CN201810841103A CN108913684A CN 108913684 A CN108913684 A CN 108913684A CN 201810841103 A CN201810841103 A CN 201810841103A CN 108913684 A CN108913684 A CN 108913684A
- Authority
- CN
- China
- Prior art keywords
- virus
- dna
- gene
- crispr
- cas9
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/16011—Herpesviridae
- C12N2710/16041—Use of virus, viral particle or viral elements as a vector
- C12N2710/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Abstract
The invention belongs to viral gene recombinant technique fields, and in particular to utilize non-homogeneous recombination mechanism, by exogenous dna fragment fixed point, be directionally efficiently inserted into specific large-scale DNA virus genome.The present invention includes the following steps:1) it designs and constructs CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats and CRISPR-associated protein 9) system for the specific cleavage site of DNA virus genome;2) it designs and constructs the Alien gene donor for carrying one or more identical cleavage site;3) CRISPR-Cas9 system expression carrier and Alien gene donor according to a certain percentage and are sequentially introduced into specific cells;4) after a period of time, according to virus characteristic, suitable infection time point and infection multiplicity are selected, by virus infected cell;5) time point of selection optimization collects the filial generation recombinant virus generated after virus infection;6) separate, screen and identify target recombinant progeny DNA virus.The recombination efficiency of foreign gene fixed point orientation insertion DNA virus genome can be significantly improved using this method, and then shortens the construction and screening time of recombinant virus.
Description
Technical field
The invention belongs to viral genome recombinant technique fields, especially for double-stranded DNA virus, and in particular to utilize one
Exogenous genetic fragment is efficiently oriented the biggish DNA virus gene of insertion by high-fidelity method of the kind independent of homologous recombination
Group can be used for virus infection Mechanism Study, exogenous gene expression, viral vectors building, attenuated vaccine and oncolytic virus building etc.
Using.
Background technique
There are mainly two types of the methods of existing building recombinant DNA virus:First way is by by the full base of DNA virus
Pass through the form of bacterial artificial chromosome (Bacterial Artificial Chromosome, BAC) because organizing, stabilization is stored in
In Escherichia coli, endonuclease, the homologous recombination modification in Escherichia coli or gene integration can be then utilized in vitro
The modes such as system such as Cre-loxP carry out gene modification operation.The recombination method can be steady in the form of plasmid by viral genome
It is fixed to save and conveniently edited, but its also have it is certain restricted, as the process of vivo modification relies on suitable limit
Property restriction endonuclease processed, or need specific recombination site.In addition, being constructed using bacterial artificial chromosome, it is also desirable to certain
Screening step, and it also requires being saved to recombinant virus, it is therefore desirable to which more wheels of big workload operate ability for a long time
Obtain recombinant DNA virus.The second way then utilizes the homologous recombination machinery of endogenous cellular, and building is had viral gene
The Alien gene donor plasmid of group homologous sequence, imports recipient cell with DNA virus genome jointly, passes through intracellular spontaneous frequency
The extremely low homologous recombination machinery of rate, thus by the recombination of purpose foreign gene into viral genome.But due to homologous recombination compared with
Low occurrence frequency, the efficiency for carrying out foreign gene insertion using cellular endogenous homologous recombination is very low, and often below 0.1%, this
Sample will bring sizable workload and quite long pick cycle to the building of mutant or recombinant virus.
In the entitled " species specificity that application No. is CN201410041906.8, publication date is on 04 30th, 2014
DNA virus genome fixed point transformation and screening technique " application for a patent for invention in disclose one kind can be efficiently by external source
Gene is inserted into the fixed point remodeling method of DNA virus genome, and this method utilizes CRISPR-Cas9 system and homologous recombination machinery knot
It closes, has been obviously improved the efficiency (can reach 8%) of foreign gene insertion DNA virus genome, but the remodeling method is still
There is room for promotion, and for large fragment foreign gene, is inserted into efficiency and usually declines as fragment length increases, therefore can not
Meet efficiently insertion foreign gene, the especially needs of large fragment foreign gene.
Summary of the invention
The purpose of the present invention:A kind of exogenous sequences, which are provided, using the method for non-homogeneous recombination efficiently pinpoints orientation insertion DNA
Virus genomic method further improves the insertion efficiency of exogenous sequences relative to homologous recombination, while having significant decrease
Non-homogeneous recombinant technique insertion exogenous sequences easily lead to the tendency of joint mutation.
The adopted technical solution is that:
A kind of method that exogenous sequences efficiently pinpoint orientation insertion DNA virus genome, is characterized in that:Including under
Column step:
1, a kind of method that exogenous genetic fragment efficiently pinpoints orientation insertion DNA virus genome, it is characterised in that including
The following steps:
1) it designs and constructs the CRISPR-Cas9 (clustered for the specific cleavage site of DNA virus genome
regularly interspaced short palindromic repeats and CRISPR-associated protein
9) system;
2) design and construct carry 1 or more can be by the directional cutting position of identical CRISPR-Cas9 system identification
The donor systems of point and exogenous genetic fragment composition;
3) by CRISPR-Cas9 system expression carrier and Alien gene donor according to a certain percentage and sequence, selection be suitable for
Method imports specific cells;
4) according to DNA virus multiplication characteristic, infection time point, infection multiplicity and the infection cell of optimization are determined;
5) time point of selection optimization collects the filial generation recombinant virus generated after virus infection;
6) separate, screen and identify target recombinant progeny DNA virus.
In the present invention, specifically, mentioned virus includes all using DNA as the virus of inhereditary material, such as adenovirus, list
Pure herpesviral, varicella virus, cytomegalovirus, Epstein-Barr virus, Kaposi's sarcoma virus, poxvirus etc. virus with
And the embedded virus etc. Jing Guo artificial recombination.
Further, the step 1) is specially:Select specific insert region or site, structure on DNA virus genome
Build the CRISPR-Cas9 nucleic acid enzyme system that can pinpoint cutting viral genome specific site:The system includes guide function
Molecule and have fixed point the active protein nucleic acid enzyme of cutting double-stranded DNA;
When there are multiple sites can choose, Cas9 protease can be filtered out to the higher site of the cutting efficiency of DNA, screening
Mode cutting efficiency can be detected and be compared by systems such as Surveyor mispairing enzymes.
Further, the step 2) is specially:After insertion point has been determined in step 1), before and after foreign gene
The complete sequence with proteolytic cleavage site reverse complemental on genome is added in both ends or front and back any end;Foreign gene supplies
The carrier format of system system is the product of plasmid form or polymerase chain reaction or the form of minicircle dna;CRISPR-Cas9
The form of nucleic acid enzyme system can be the shape of plasmid form or rna form or albumen and RNA complex form or viral vectors
Formula.
Further, the step 3) is specially:Introduction method is that will transfect cell inoculation in cultivating on tissue culture plate
It adds the compound of DNA and transfection reagent afterwards to be transfected, or the compound of DNA and transfection reagent is pre-added to
Cell is inoculated after tissue culture plate to be transfected, or DNA is imported into cell using the method that conductance enters, furthermore CRISPR-
The ratio of Cas9 nuclease system expression plasmid and Alien gene donor plasmid is 4:1-1:Between 1.
Further, the step 4) is specially:After transfection can infectious viral particle infection cell time point be turn
4-24 hours after dye, infection multiplicity is between 0.01-10.
Further, the step 5) is specially:The time for collecting daughter DNA virus is 24-72 after virus infected cell
Hour.
Further, the step 6) is specially:Will be by above-mentioned steps 1)-step 6) optimization after filial generation obtained
Virus carries out isolating and purifying for progeny virus by picking plaque, limiting dilution assay or fluidic cell sorting technology, separation
The progeny virus of purifying can carry out nucleic acid sequencing identification, and amplification, which saves, recombinates correct progeny virus;Identification to recombinant virus
It can also be but be not limited to using reporter gene detection, in the way of resistant gene screening, detection of protein expression etc..
The beneficial effects of the invention are as follows:
1, it is carried out with HSV1 (herpes simplex virus type) genome in the way of homologous recombination in one of DNA virus
Directional integration is compared, and the efficiency that exogenous genetic fragment is integrated using non-homogeneous site-directed integration wants 3-10 times high, this will be dropped significantly
Low workload when being screened to recombinant virus.
2, using the method for non-homogeneous site-directed integration come when integrating exogenous genetic fragment, the nucleic acid sequence fidelity of recombinant virus
Degree is high.For example, nucleic acid sequencing is carried out to 15 recombinant virus monoclonals are obtained in experiment, wherein there is 14 plants of recombinant viral nucleic acid sequences
Column are not inserted into or deletion mutation, completely the same with expected sequence, and nucleic acid sequence accuracy is therefore 93.3%. can use this
Technology is carried out to integrating the higher operation of accuracy requirement, such as the amalgamation and expression of gene.
3, gene piece when integrating exogenous genetic fragment, being integrated into genome using the method for non-homogeneous site-directed integration
The direction of section can meet expection.For example, carrying out nucleic acid sequencing, 15 plant weight groups to 15 recombinant virus monoclonals are obtained in experiment
The direction of viral gene segment integration and expection are completely the same, and the accuracy that segment integrates direction is 100%.
Detailed description of the invention
Fig. 1 is operating process schematic diagram of the invention;
Fig. 2 is the CRISPR-Cas9 system expression plasmid and homologous recombination Alien gene donor matter that embodiment one provides
Grain and non-homologous end joining Alien gene donor plasmid schematic diagram;
Fig. 3 is the efficiency knocked in using homologous recombination and non-homologous end joining progress foreign gene that embodiment one provides
Comparison schematic diagram;
Fig. 4 be embodiment two provide firefly luciferase plain gene is integrated into HSV base using non-homogeneous site-directed integration
Because of a group schematic illustration;
Fig. 5 is the recombination reporter virus and wild-type virus PCR qualification figure that embodiment two provides;
Fig. 6 is the recombination reporter virus sequencing qualification figure that embodiment two provides;
Fig. 7 is the titre schematic diagram of the wild-type virus that embodiment two provides and recombination reporter virus;
Fig. 8 is the active schematic diagram of detection firefly luciferase element after the infection recombination reporter virus that embodiment two provides;
Fig. 9 is that expression thymidine kinase-green fluorescent protein fusion protein recombinant virus genomes that embodiment three provides are shown
It is intended to;
Figure 10 is the recombinant virus and wild-type virus PCR qualification figure that embodiment three provides;
Figure 11 is the recombinant virus sequencing qualification figure that embodiment three provides;
Figure 12 is the microscope photo for the pattern of fusion recombinant virus HSV1-ZW6A-TK-EGFP1c that embodiment three provides;
Figure 13 is TK the and EGFP amalgamation and expression for the immune-blotting method HSV1-ZW6A-TK-EGFP1c that embodiment three provides
Protein expression situation schematic diagram;
Figure 14 is thymidine kinase-green fluorescent protein fusion protein biological activity in the recombinant virus of the offer of embodiment three
Detection schematic diagram;
Specific embodiment
Below in conjunction with attached drawing of the invention, technical solution of the present invention is clearly and completely described.Based on this hair
Embodiment in bright, every other implementation obtained by those of ordinary skill in the art without making creative efforts
Example, shall fall within the protection scope of the present invention.
As shown in Figure 1:
The selection of Cas9 proteolytic cleavage site in step 1 genome
The basis of CRISPR/Cas9 system targeting cutting genome sequence is that containing NGG sequence, (N is any in genome
One nucleotide sequence, G represent guanine, the sequence of plum mark in specific i.e. example) gene loci, one is complete
Cas9 proteolytic cleavage site is the gene order that NGG sequence adds 20 bases of the front.Such as
CACGTTTGCCCGGGAGATGG.Since there are the effects of different DNA modifications in genome, Cas9 protease is resulted in base
Because the cutting efficiency in different genes site in group also has biggish difference, and Cas9 protease to the cutting efficiency of DNA one
Determine the integration efficiency for determining exogenous sequences in degree, therefore in the selection of Cas9 proteolytic cleavage site needs to carry out excellent
Change.The present invention compares the cutting efficiency of several Cas9 proteolytic cleavage sites.The result shows that other sites are compared, in Cas9
Protease cuts high-efficient site, and the efficiency of exogenous origin gene integrator also can relative efficiency.Therefore when constructing recombinant DNA virus
Cas9 protease should be filtered out to the higher site of the cutting efficiency of DNA, the mode of screening can pass through Surveyor mispairing
The systems such as enzyme are detected and are compared to cutting efficiency.
The design and CRISPR-Cas9 nuclease system expression carrier and external source base of step 2 Alien gene donor system
Because of the selection of donor vehicle
Alien gene donor system is designed as a bit the most key in the present invention, and cutting effect has been determined in step 1
Behind the higher site of rate, need to be added and proteolytic cleavage on genome in the rear and front end of foreign gene or front and back any end
The complete sequence of site reverse complemental is cut, this design can guarantee that foreign gene can be integrated with expected direction of integrating.
The sequence can be obtained by way of gene chemical synthesis, can also be introduced while expanding foreign gene by primer.External source
The form of genetic donor system can be plasmid form, is also possible to the product of polymerase chain reaction, is also possible to minicircle dna
Form.And CRISPR-Cas9 enzyme nucleic acid expression system then can be plasmid form, rna form, albumen and the compound bodily form of RNA
The form of formula either viral vectors.
The selection of step 3 transfection cell and transfection method
The cutting of genome is carried out using CRISPR/Cas9 system, more it is important that guaranteeing CRISPR-Cas9 core
The efficiency of sour enzyme system expression plasmid and Alien gene donor plasmid-transfected cells, therefore have chosen in the present invention a kind of instantaneous
The relatively high cell HEK-293T of transfection efficiency is operated, and also be can choose the higher cell of other transfection efficiencies and is carried out.
Usually in transfection, the ratio-dependent of control cell quantity and transfected plasmids is 3x105A cell uses 0.75-1.5ug plasmid,
And transfection reagent as used in the present invention be PolyPlus company JetPrime transfection reagent (DNA and
The ratio of JetPrimereagent is 1 μ g:2 μ L), transfection efficiency can achieve 90%, and transfection method is that will transfect cell to connect
Kind the compound of DNA and transfection reagent is added to be transfected after cultivating 20 hours on tissue culture plate, or can also be with
The compound of DNA and transfection reagent are pre-added to and inoculates cell after tissue culture plate and transfects, electricity also can be used
DNA is imported cell by the method for importing.
Step 4 determines the ratio of cotransfection CRISPR-Cas9 system expression plasmid and Alien gene donor plasmid
Because this method needs two kinds of plasmids of cotransfection, the ratio of two kinds of plasmid transfections is also required to optimize to arrive
Up to optimal recombination efficiency, the present invention has chosen Cas9 protease in DNA genome and cuts high-efficient site, compares several
Ratio (CRISPR-Cas9 system expression plasmid and Alien gene donor plasmid ratio=4 of plasmid co-transfection:1-1:4).As a result
Show that when the ratio of CRISPR-Cas9 system expression plasmid and Alien gene donor plasmid be 1:There is higher integration to imitate when 1
Rate.
Step 5 determine transfection after can infectious viral particle infection cell time point and infection multiplicity
This method needs virus infection after transfection, confirms to the time point infected after transfection, this hair
It was infected in bright using 4 hours after transfection, but is infected in 4 hours and 24 hours, to integration efficiency
It influences little.Furthermore the dosage of infecting virus particle is also required to be determined, the present invention has chosen Cas9 in viral genome
Protease cuts the best of high-efficient site and CRISPR-Cas9 nuclease system expression carrier and Alien gene donor plasmid
Ratio, comparing can the dosage of infectious viral particle and the ratio (specially MOI=0.01-10) of transfection cell.As a result table
It is bright, when can infectious viral particle dosage and transfection cell ratio be 1 when have higher integration efficiency.In addition, although originally
It uses in invention and is infected after transfection, but the mode infected before transfection can also be taken to be operated.
Step 6 determines the time for collecting infection DNA virus cell
This method needs virus infection, therefore the time of virus infection is also required to be determined, and the present invention has chosen DNA base
Because Cas9 protease cuts high-efficient site, CRISPR-Cas9 nuclease system expression carrier and Alien gene donor in group
The optimal proportion and virus liquid dosage of plasmid and the optimal proportion of transfection cell, after comparing the different time for infecting DNA virus
Integration efficiency (specially 12,24,36,48,60,72 hours).The result shows that having highest when infecting DNA virus 48 hours
Integration efficiency.
The screening and identification of step 7 recombinant DNA virus
By the progeny virus obtained after above step optimizes, can by picking plaque, limiting dilution assay or
Fluidic cell sorting technology carries out the picking of monoclonal progeny virus, and the monoclonal progeny virus after picking carried out genome
Nucleic acid sequencing identification is carried out after extraction, picking receives the recombinant virus being correctly transformed and finally carries out amplification preservation to it.In addition,
To the identification of recombinant virus also can use reporter gene detection, using resistant gene directed screening, express albumen inspection
Survey etc. meets the mode of transformation purpose to carry out.
Embodiment is just like shown in Fig. 2-Fig. 3:
Enhanced green fluorescence protein (EGFP) reporter gene of tape starting and transcription stop signals is inserted into I type list
CRISPR- is relatively based in pure hsv gene group UL23 gene (thymidine kinase, ThymidineKinease, TK) site
The difference of homologous recombination and non-homologous end joining in exogenous origin gene integrator efficiency under Cas9 system:
1, the selection of gene loci and the building of plasmid
(1) selection of .Cas9 proteolytic cleavage site:At HSV1-8F plants (using I herpes simplex virus type (HSVl)
Strain is operated, this strain is separated and saved using existing method, for example, the HSV1-8F disease saved using laboratory
Malicious pass on strain is infected, and 8F is the code name of Strain.) search out in UL23 gene order in whole genome sequence, have NGG
The gene loci of (N is any one nucleotide sequence, and G represents guanine), then finds gene loci five end 20 alkali
The sequence of base, this is gRNA sequence, and the sequence selected in this is specially GAGGGCGCAACGCCGTACGTCGG;
(2) constructs CRISPR-Cas9 system expression carrier (CRISPR-Cas9 expressionplasmid):According to upper
The cutting sequence of one selection designs gRNA sequence and synthesizes, the sequence anneals after synthesis connected, then by carrier PX330
It is returned with the segment glue after the agarose gel electrophoresis separation of 1% mass volume ratio of the segment after endonuclease BbsI digestion
It receives, the carrier of annealed product and recycling is ligated and transformed into Escherichia coli, identification is sequenced after extracting plasmid, constructs CRISPR-
Cas9 system expression plasmid pCW206;(PX330 carrier is purchased from U.S. Addgene company, number 42335)
Composition sequence particular sequence is:
Forward primer (P109):caccggagggcgcaacgccgtacgt
Reverse primer (P110):aaacacgtacggcgttgcgccctcc
(3) constructs homologous recombination Alien gene donor plasmid (homologous recombination donor respectively
Plasmid, HR donor) and non-homologous end joining Alien gene donor plasmid (homologous independent end
jointdonor plasmid,NHEJ donor plasmid):It is template use by the HSV1-8F viral genome of vitro extraction
Q5 high-fidelity DNA polymerase (NEB company of the U.S.) is expanded with left and right end homology arm amplimer, is obtained length and is respectively
The left and right end homology arm of the homologous recombination Alien gene donor plasmid of 1000kb, then with the enhanced green containing tape starting
The plasmid pEGFP-N2 (Dalian treasured biotech firm) of fluorescent protein report gene is outside template Q5 high-fidelity DNA polymerase expands
Source gene, using the homologous connection kit of multiple clips, (public affairs are only praised in Nanjing promise after the segment after amplification is recycled with QIAquick Gel Extraction Kit
Department) be attached after convert Escherichia coli, identification is sequenced after extracting plasmid, building obtains homologous recombination Alien gene donor plasmid
pCW932.Meanwhile on the basis of pMD19T carrier (Dalian treasured biotech firm) plasmid, according to the cleavage site of previous step selection
Primers carry out amplification with Q5 high-fidelity DNA polymerase as template using pEGFP-N2 and obtain exogenous genetic fragment, will expand
Segment after increasing is ligated and transformed into greatly after adding A kit to handle with fragment ends after being recycled with QIAquick Gel Extraction Kit with pMD19T carrier
Enterobacteria is sequenced identification after extracting plasmid, constructs non-homologous end joining Alien gene donor plasmid pCW768;
Non-homologous end joining Alien gene donor plasmid is constructed, the primer of design is specially:
Forward primer (N151):CCGACGTACGGCGTTGCGCCCTCcgttacataacttacggtaaatgg
(CCGACGTACGGCGTTGCGCCCTC is the reverse complementary sequence of cutting sequence in (1), this design guarantees insertion
Segment is that direction is certain)
Reverse primer (N155):taagatacattgatgagtttgga
Homologous recombination Alien gene donor plasmid is constructed, the primer of design is specially:
Left end homology arm amplimer:Forward primer (N396):
AaaacgacggccagtgaattcCCCTCTTGCACGAACGGGG reverse primer (N397):
ctccatatatggGGGATCGATAATTCGCCGC
Foreign gene amplimer:Forward primer (N398):TcgatcccCCATATATGGAGTTCCGCGTTAC reversely draws
Object (N399):gccgcggTAAGATACATTGATGAGTTTGGACAAAC
Right end homology arm amplimer:Forward primer (N400):TcaatgtatcttaCCGCGGCCCTCCAGGAACc is anti-
To primer (N401):caggtcgactctagaggatccCGCGTCCCGCGGTAGTTG
2, the infection of the cotransfection and wild-type virus of plasmid
The pCW206 of 0.5ug is taken, is mixed respectively with the pCW768 of 0.5ug or pCW932, with transfection reagent JetPrimeTM
(French polyplus company) transfects into the HEK293T cell for being seeded to 12 orifice plates, and the HSV1-8F of MOI=1 is taken after 4 hours
Virus is infected, and it is the DMEM culture medium containing 2% fetal calf serum that liquid is changed after 2 hours.48 hours collection virus liquids after infection, point
Dress freezes in -80 DEG C of refrigerators.
3, the statistics for knocking in efficiency calculates
By the virus of collection according to different dilutions, it is added in the Vero cell for being seeded to 6 orifice plates, 2 hours
The agarose of covering upper 1% afterwards.After occurring obvious plaque after 3 days, plaque number is selected to unite in 20 to 200 or so holes
Meter.Recombinant virus of the observation with green fluorescence and counting, then again count total plaque first under fluorescence microscope,
Utilize formula:Efficiency=(the Virus plaque number with green fluorescence/total Virus plaque number) x 100% is knocked in, benefit is calculated
Foreign gene knocks in efficiency when knocking in strategy with difference.The results show that being based on CRISPR-Cas9 system, pass through non-homogeneous end
End connection carries out the efficiency of exogenous origin gene integrator than by the 2.97 times high of homologous recombination.
Embodiment two is as shown in Fig. 4-Fig. 8:
The firefly luciferase element reporter gene of tape starting is inserted into I type herpe simplex with CRISPR/Cas9 technology
The site viral genome UL23 gene (thymidine kinase, ThymidineKinease, TK):
1, the selection of gene loci and the building of plasmid
(1) selection of .Cas9 proteolytic cleavage site:At HSV1-8F plants (using I herpes simplex virus type (HSVl)
Strain is operated, this strain is separated and saved using existing method, for example, the HSV1-8F disease saved using laboratory
Malicious pass on strain is infected, and 8F is the code name of Strain.) search out in UL23 gene order in whole genome sequence, have NGG
The gene loci of (N is any one nucleotide sequence, and G represents guanine), then finds the base of the gene loci end 20
Sequence, this is gRNA sequence, and the sequence selected in this is specially GAGGGCGCAACGCCGTACGTCGG;
(2) constructs CRISPR-Cas9 system expression carrier (CRISPR-Cas9expressionplasmid):According to upper
The cutting sequence of one selection designs gRNA sequence and synthesizes, the sequence anneals after synthesis connected, then by carrier PX330
It is returned with the segment glue after the agarose gel electrophoresis separation of 1% mass volume ratio of the segment after endonuclease BbsI digestion
It receives, the carrier of annealed product and recycling is ligated and transformed into Escherichia coli, identification is sequenced after extracting plasmid, constructs CRISPR-
Cas9 system expression plasmid pCW206;(PX330 carrier is purchased from U.S. Addgene company, number 42335)
Composition sequence particular sequence is:
Forward primer (P109):caccggagggcgcaacgccgtacgt
Reverse primer (P110):aaacacgtacggcgttgcgccctcc
(3) constructs Alien gene donor plasmid (donorplasmid):In pMD19T carrier (Dalian treasured biotech firm) matter
On the basis of grain, according to the cleavage sequences design primer of previous step selection with the firefly luciferase element containing tape starting
The plasmid pCW702 (pFluc-PSE332) of reporter gene is that template is expanded with Q5 high-fidelity DNA polymerase, after amplification
Segment with pMD19T carrier is ligated and transformed into large intestine bar after adding A kit to handle with fragment ends after being recycled with QIAquick Gel Extraction Kit
Bacterium is sequenced identification after extracting plasmid, constructs Alien gene donor plasmid pCW931;
Alien gene donor plasmid is constructed, the primer of design is specially:
Forward primer (N151):CCGACGTACGGCGTTGCGCCCTCcgttacataacttacggtaaatgg
(CCGACGTACGGCGTTGCGCCCTC is the reverse complementary sequence of cutting sequence in (1), this design guarantees insertion
Segment is that direction is certain)
Reverse primer (N155):taagatacattgatgagtttgga
2, the infection of the cotransfection and wild-type virus of plasmid
The pCW206 and pCW931 for respectively taking 0.5ug, with transfection reagent JetPrimeTM(French polyplus company) transfects extremely
It is seeded in the HEK293T cell of 12 orifice plates, takes the HSV1-8F virus of MOI=1 to be infected after 4 hours, change liquid after 2 hours
For the DMEM culture medium containing 2% fetal calf serum.48 hours collection virus liquids after infection, packing freeze in -80 DEG C of refrigerators.
3, the picking of recombinant virus and identification
By the virus of collection according to different dilutions, it is added in the Vero cell for being seeded to 6 orifice plates, 2 hours
The agarose of covering upper 1% afterwards.After occurring obvious plaque after 3 days, picking plaque is expanded to the Vero for being seeded to 96 orifice plates.
After 2 days, viral DNA is extracted with viral genome extracts kit, is expanded with Vazyme2xRapidpremix, is then surveyed
Sequence carries out genotype identification, and as a result picking to 1 correctly incorporates firefly luciferase element reporter gene in 16 plaques
Recombinant virus, and genotype with expection it is consistent, be named as HSV1-8F-Fluc1c;
PCR identifies amplimer sequence:
Forward primer 1 (N330):CCGCTCGAGATGgaagacgccaaaaacataaag
Reverse primer 1 (N331):ATAAGAATGCGGCCGCttaCAATTTGGACTTTCCGCCC
Sequencing identification and amplimer sequence:
Sequencing primer 2 (N332):ccatcccgtggggaccgtctatat
Sequencing primer 2 (N333):caacagcgtgccgcagatcttggt
4, the statistics of the amplification of recombinant virus and virus titer
By the correct virus of genotype with MOI=0.1 infection into the Vero cell for being seeded to T25 Tissue Culture Flask, to
Culture medium supernatant cell is collected after lesion, is centrifuged after five minutes in 4 DEG C with 3000g, Aspirate supernatant, cell precipitation is added few
Freeze thawing 3 times after amount culture medium, merges culture medium and supernatant after freeze thawing, frozen after packing in -80 DEG C of refrigerators.After expanding respectively
Wild-type virus and the 3rd generation recombinant virus are diluted with decimal dilution method and are seeded to 8x10e5 of 6 orifice plates on the day before infecting
Vero cell, there is the quantity of obvious plaque in statistics after 4 days, and the titre of generation virus is denoted as after calculating.
5, wild type and the detection of recombinant virus luciferase element reporter gene expression
The wild-type virus of step 4 acquisition and the 3rd generation recombinant virus are seeded to 12 orifice plates with MOI=3 infection the previous day
3x10e5 Vero cell in, for 24 hours when take cells following viral infection lysate sample and medium supernatant to detect respectively carefully
Firefly luciferase element activity in cellular lysate liquid sample and medium supernatant.The results show that wild-type virus does not detect
To firefly luciferase element activity, and the 3rd generation recombinant virus then detects firefly luciferase element activity.
Embodiment three, as shown in Fig. 9-Figure 14:
It is simple that the I type being clinically separated will be inserted into enhanced green fluorescence protein (EGFP) with CRISPR/Cas9 technology
The C-terminal in the site hsv gene group UL23 gene (thymidine kinase, Thymidine Kinease, TK) carries out protein fusion
Expression:
1, the selection of gene loci and the building of plasmid
(1) selection of .Cas9 proteolytic cleavage site:It (is used I herpes simplex virus type (HSVl) at HSV1-ZW6A plants
Strain infected, this strain using existing method separate and save, for example, the HSV1- saved after being clinically separated
ZW6A virus clinical separation strain is infected, and ZW6A is the code name of Strain.) UL23 gene sequence is searched out in whole genome sequence
In column, the gene loci with NGG (N is any one nucleotide sequence, and G represents guanine) then finds the gene loci
The sequence of five 20 bases in end, this is gRNA sequence, and the sequence selected in this is specially
CACGTTTGCCCGGGAGATGG;
(2) constructs CRISPR-Cas9 system expression carrier (CRISPR-Cas9expressionplasmid):According to upper
The cutting sequence of one step selection designs gRNA sequence and synthesizes, the sequence anneals after synthesis connected, then by carrier PX330
It is returned with the segment glue after the agarose gel electrophoresis separation of 1% mass volume ratio of the segment after endonuclease BbsI digestion
Receive, the carrier of annealed product and recycling be ligated and transformed into Escherichia coli, identification is sequenced after extracting plasmid, construct Cas9 and
The expression plasmid pCW206 of gRNA;(PX330 carrier is purchased from U.S. Addgene company, number 42335)
Composition sequence particular sequence is:
Forward primer (N485):caccgcacgtttgcccgggagatgg
Reverse primer (N486):aaacccatctcccgggcaaacgtgc
(3) constructs Alien gene donor plasmid (donorplasmid):In pMD19T carrier (Dalian treasured biotech firm) matter
On the basis of grain, the cleavage sequences design primer selected according to previous step is using plasmid pEGFPN2 as template Q5 high-fidelity
Archaeal dna polymerase is expanded, the segment after amplification recycled with QIAquick Gel Extraction Kit after with fragment ends add A kit handle after with
PMD19T carrier is ligated and transformed into Escherichia coli, and identification is sequenced after extracting plasmid, constructs Alien gene donor plasmid pCW932;
Alien gene donor plasmid is constructed, the primer of design is specially:
Forward primer (N489):CCCCCATCTCCCGGGCAAACGTGatggtgagcaagggcgagga
(CCCCCATCTCCCGGGCAAACGTG is the reverse complementary sequence of cutting sequence in (1), this design guarantees insertion
Segment is that direction is certain)
Reverse primer (N155):taagatacattgatgagtttgga
2, the infection of the cotransfection and wild-type virus of plasmid
The pCW206 and pCW932 for respectively taking 0.5ug, with transfection reagent JetPrimeTM(French polyplus company) transfects extremely
It is seeded in the HEK293T cell of 12 orifice plates, takes the ZW6A strain virus of MOI=1 to be infected after 4 hours, be changed to and contain after 2 hours
The MEM culture medium of 2% newborn bovine serum.48 hours collection virus liquids after infection, packing freeze in -80 DEG C of refrigerators.
3, the picking of recombinant virus and identification
By the virus of collection according to different dilutions, it is added in the Vero cell for being seeded to 6 orifice plates, 2 hours
The agarose of covering upper 1% afterwards.After occurring obvious plaque after 3 days, in fluorescence microscopy microscopic observation, as a result chosen in 6 plaques
1 virus for having green fluorescence is got, and the picking plaque is expanded to the Vero cell for being seeded to 96 orifice plates.2 days
Afterwards, with viral genome extracts kit extract viral DNA, expanded with Vazyme2xRapidpremix, be then sequenced into
Row genotype identification, as a result genotype is consistent with expection, is named as HSV1-ZW6A-TK-EGFP1c;
PCR identifies amplimer sequence:
Forward primer 1 (N333):caacagcgtgccgcagatcttggt
Reverse primer 1 (N502):tatgaacaaacgacccaacacccgtgc
Sequencing identification and amplimer sequence:
Sequencing primer 2 (N502):tatgaacaaacgacccaacacccgtgc
Sequencing primer 2 (P416):CACCgCATGTGATCGCGCTTCTCGT
4, the statistics of a wheel plaque purification of recombinant virus, amplification and virus titer
By the virus of previous step Collection and conservation by 1 wheel plaque purification, PCR is identified after purification, has chosen recombinant virus
Two monoclonals are denoted as #1 and #10, later by the virus after purification without wild-type virus pollution with MOI=0.1 infection to inoculation
Into the Vero cell of T25 Tissue Culture Flask, culture medium supernatant cell is collected after lesion, is centrifuged 5 points in 4 DEG C with 3000g
Zhong Hou, Aspirate supernatant, cell precipitation are added after a small amount of culture medium freeze thawing 3 times, merge culture medium and supernatant after freeze thawing, packing
After freeze in -80 DEG C of refrigerators, viral generation is denoted as P2 generation at this time.2nd generation recombinant virus after amplification is dilute with decimal dilution method
8x10e5 Vero cell of 6 orifice plates is seeded on the day before the virus infection of the area Shi Bing appropriate dilution, statistics occurs bright after 4 days
The quantity of aobvious plaque, is denoted as the titre of generation virus after calculating.
5, recombinant virus thymidine kinase-green fluorescent protein fusion protein (TK-EGFP) expression is identified
By two monoclonal #1 of the second generation virus HSV1-ZW6A-TK-EGFP1c (P2) after previous step purifying amplification
TK gene and the weight of single expression EGFP are destroyed with what #10 and wild-type virus HSV1-ZW6A and one plant of laboratory were saved
Group virus HSV1-ZW6A-EGFP1c-TK infects 3x10e5 Vero cell for the previous day being seeded to 12 orifice plates with MOI=3 respectively
In.It is inhaled when infecting for 24 hours and abandons medium supernatant, the cell sample of cell pyrolysis liquid RIPA lytic virus infection is added, uses egg
The expression of white immune-blotting method TK and EGFP fusion protein.The wild-type virus and recombination disease that different time points are collected later
Malicious sample, which infects in 3x10e5 Vero cell for being seeded to 12 orifice plates to the previous day, measures titre, identifies its growth characteristics.Knot
Fruit shows do not have the expression of EGFP albumen in wild-type virus;HSV1-ZW6A-EGFP1c-TK Identification of recombinant baculovirus has arrived EGFP
Single expression, size is about 27kd, and HSV1-ZW6A-TK-EGFP1c (P2) recombinant virus has then identified TK and EGFP
Amalgamation and expression, size is about 60KD, with expection be consistent.Demonstrate the expression of the fusion protein of TK and EGFP in recombinant virus.
6, thymidine kinase-green fluorescent protein fusion protein (TK-EGFP) biological activity identification in recombinant virus
In order to prove that the fusion protein of thymidine kinase and enhanced green fluorescence protein still remains chest in recombinant virus
The activity of glycosides kinases, by a monoclonal #1 and wild-type virus of second generation virus HSV1-ZW6A-TK-EGFP1c (P2)
HSV1-ZW6A is seeded in 3x10e5 Vero cell of 12 orifice plates on the day before being infected respectively with MOI=0.1, after infection 2 hours
Control group culture medium is changed to the MEM culture medium containing 2% newborn bovine serum, and it is 100ug/ml that another group, which is then changed to Determination of Acyclovir,
The MEM culture medium containing 2% newborn bovine serum, continue culture 24 hours after collect virus infection after cell and culture medium supernatant
Liquid is frozen after packing in -80 DEG C of refrigerators.
Second day viral sample by collection dilutes altogether 9 dilutions in such a way that 10 times diluted, then will be each dilute
100 microlitres of virus liquids of degree of releasing are added in the suspension Vero cell for being inoculated in 96 orifice plates, and culture counted cytopathy after 2-3 days
Situation and the result for comparing control group and experimental group.
The results show that the experimental group that joined acyclovir is generated without infectious viral particle, illustrate in recombinant virus
Thymidine kinase-green fluorescent protein fusion protein still remains biological activity.
One-embodiment of above-described embodiment can be seen that technical solution of the present invention:1. utilizing intracellular nonhomologous end
The DNA repair mechanism of connection carries out gene integration:
A. integration efficiency is improved:In cell, when double-strand break occurs for DNA, mainly can there are two types of DNA repair mechanism,
One kind be homologous recombination repair, another kind be non-homologous end joining reparation, and the former fidelity it is higher but there is no
In the case that DNA double chain is broken, occurrence frequency is very low, then and frequency that the latter occurs is very high, but fidelity is poor, usually
Insertion and deletion and the mutation of base can be introduced in the site of reparation.In the present invention, using CRISPR/Cas9 technology to viral base
Because group and Alien gene donor Plasmid DNA introduce double-strand break simultaneously, then using non-homologous end joining mechanism to fracture
Genome and the donor plasmid DNA of fracture are efficiently connected, thus integrator gene segment.Based on non-homologous end joining thing
The high-frequency that part occurs in cell, so it is more whole than being carried out before by homologous recombination machinery to carry out gene integration by this method
High-efficient 2.97 times of the mode of conjunction.
B. the efficiency of large fragment foreign gene insertion is improved:In (being greater than 5kb) larger for exogenous genetic fragment length
In the case where, the exogenous sequences insertion efficiency based on homologous recombination machinery can decline to a great extent.In the way of non-homologous end joining
The integration of progress, still can efficient being integrated into large fragment exogenous gene high-efficient in viral genome.
C. it can guarantee the hi-fi and directionality of Insert Fragment:In design when Alien gene donor system, the party
Method is added and proteolytic cleavage site reverse complemental on genome in the rear and front end of foreign gene or front and back any end
Complete sequence.This, which is designed, can guarantee in foreign gene after the integration of direction as expected, CRISPR-Cas9 system identification before
Directional cutting site is destroyed and can not again identify that, and as expected the foreign gene of direction integration then remain to it is identified and again
It is secondary to cut, therefore this method can ensure that the exogenous genetic fragment being inserted by correct direction being capable of stable integration.
2. being cut using the specificity that CRISPR/Cas9 technology carries out full-length genome:
A. editable site in genome has been expanded:Because of the basis of CRISPR/Cas9 system target gene group sequence
For the gene loci for containing NGG sequence (N is any one nucleotide sequence, and G represents guanine) in genome, and the type
Site is 1/16 in the probability that genome occurs, therefore can cover large range of genome sequence.So to a certain extent
It solves in the viral genome based on BAC system, the basis of transformation is to need to have specific nucleic acid inscribe at the site being transformed
The limitation of enzyme.
B. complicated experimental implementation before simplifying:Utilize CRISPR/Cas9 system, it is only necessary to construct CRISPR-Cas9
System expression carrier and Alien gene donor, and select proper method and imported into viral permissive cell, importing the time can be
Before or while virus infection virus permissive cell, gene integration process can be completed, pass through proper method separation screening later
Carrying out downstream identification afterwards can be obtained recombinant DNA virus, enormously simplify the process of transformation.
The above description is merely a specific embodiment, but scope of protection of the present invention is not limited thereto, any
Those familiar with the art in the technical scope disclosed by the present invention, can easily think of the change or the replacement, and should all contain
Lid is within protection scope of the present invention.Therefore, protection scope of the present invention should be based on the protection scope of the described claims.
Claims (7)
1. a kind of method that exogenous genetic fragment efficiently pinpoints orientation insertion DNA virus genome, it is characterised in that including following
Step:
1) it designs and constructs the CRISPR-Cas9 system for the specific cleavage site of DNA virus genome;
2) design and construct carry 1 or more can by the directional cutting site of identical CRISPR-Cas9 system identification and
The donor systems of exogenous genetic fragment composition;
3) by CRISPR-Cas9 system expression carrier and Alien gene donor according to a certain percentage and sequence, select proper method
Import specific cells;
4) according to DNA virus multiplication characteristic, infection time point, infection multiplicity and the infection cell of optimization are determined;
5) time point of selection optimization collects the filial generation recombinant virus generated after virus infection;
6) separate, screen and identify target recombinant progeny DNA virus.
2. the method that a kind of exogenous genetic fragment according to claim 1 efficiently pinpoints orientation insertion DNA virus genome,
It is characterized in that:The step 1) is specially:
Specific insert region or site on DNA virus genome are selected, building can pinpoint cutting viral genome certain bits
The CRISPR-Cas9 nucleic acid enzyme system of point:The system includes the molecule of guide function and has fixed point cutting double-stranded DNA active
Protein nucleic acid enzyme;
When there are multiple sites can choose, Cas9 protease can be filtered out to the higher site of the cutting efficiency of DNA, the side of screening
Formula can be detected and be compared to cutting efficiency by systems such as Surveyor mispairing enzymes.
3. the method that a kind of exogenous genetic fragment according to claim 1 efficiently pinpoints orientation insertion DNA virus genome,
It is characterized in that:The step 2) is specially:After insertion point has been determined in step 1), foreign gene rear and front end or
The complete sequence with proteolytic cleavage site reverse complemental on genome is added in any end before and after person;Alien gene donor system
Carrier format be the product of plasmid form or polymerase chain reaction or the form of minicircle dna;CRISPR-Cas9 nuclease
The form of system can be the form of plasmid form or rna form or albumen and RNA complex form or viral vectors.
4. a kind of non-homogeneous process for site-directed integration of foreign gene of DNA virus genome according to claim 1, feature
It is:The step 3) is specially:Transfection method be will transfect cell inoculation on tissue culture plate cultivate after add DNA with
The compound of transfection reagent is transfected, or after the compound of DNA and transfection reagent is pre-added to tissue culture plate
It inoculates cell to be transfected, or DNA is imported into cell using the method that conductance enters, furthermore CRISPR-Cas9 nucleic acid enzyme system
The ratio of system expression plasmid and Alien gene donor plasmid is 4:1-1:Between 1.
5. a kind of non-homogeneous process for site-directed integration of foreign gene of DNA virus genome according to claim 1, feature
It is:The step 4) is specially:After transfection can infectious viral particle infection cell time point be transfection after 4-24 hours,
Infection multiplicity is between 0.01-10.
6. a kind of non-homogeneous process for site-directed integration of foreign gene of DNA virus genome according to claim 1, feature
It is:The step 5) is specially:The time for collecting daughter DNA virus is 24-72 hours after virus infected cell.
7. a kind of non-homogeneous process for site-directed integration of foreign gene of DNA virus genome according to claim 1, feature
It is:The step 6) is specially:Will be by above-mentioned steps 1)-step 6) optimization after progeny virus obtained, by choosing
Plaque, limiting dilution assay or fluidic cell sorting technology is taken to carry out isolating and purifying for progeny virus, the filial generation isolated and purified
Virus can carry out nucleic acid sequencing identification, and amplification, which saves, recombinates correct progeny virus;Can also be but not to identifying for recombinant virus
It is defined in using reporter gene detection, in the way of resistant gene screening, detection of protein expression etc..
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810841103.9A CN108913684A (en) | 2018-07-27 | 2018-07-27 | A kind of method that exogenous sequences efficiently pinpoint orientation insertion DNA virus genome |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810841103.9A CN108913684A (en) | 2018-07-27 | 2018-07-27 | A kind of method that exogenous sequences efficiently pinpoint orientation insertion DNA virus genome |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108913684A true CN108913684A (en) | 2018-11-30 |
Family
ID=64417362
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810841103.9A Pending CN108913684A (en) | 2018-07-27 | 2018-07-27 | A kind of method that exogenous sequences efficiently pinpoint orientation insertion DNA virus genome |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108913684A (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110305908A (en) * | 2019-07-12 | 2019-10-08 | 南方医科大学 | A kind of gene integration system and its application efficiently precisely targeted |
CN111041003A (en) * | 2019-12-20 | 2020-04-21 | 畜科生物工程有限公司 | Recombinant duck plague virus and construction method and application thereof |
CN112481222A (en) * | 2020-11-30 | 2021-03-12 | 中国医学科学院医学生物学研究所 | Conditionally replicating recombinant herpes simplex virus, vaccine and application thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103397018A (en) * | 2013-08-20 | 2013-11-20 | 中国医学科学院医学生物学研究所 | Site-directed modification method for DNA viral genome |
CN103757053A (en) * | 2014-01-28 | 2014-04-30 | 中国医学科学院医学生物学研究所 | Site-specific modification and screening method for specific DNA (deoxyribonucleic acid) viral genome |
US20160022737A1 (en) * | 2014-07-25 | 2016-01-28 | Sangamo Biosciences, Inc. | Gene editing for hiv gene therapy |
-
2018
- 2018-07-27 CN CN201810841103.9A patent/CN108913684A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103397018A (en) * | 2013-08-20 | 2013-11-20 | 中国医学科学院医学生物学研究所 | Site-directed modification method for DNA viral genome |
CN103757053A (en) * | 2014-01-28 | 2014-04-30 | 中国医学科学院医学生物学研究所 | Site-specific modification and screening method for specific DNA (deoxyribonucleic acid) viral genome |
US20160022737A1 (en) * | 2014-07-25 | 2016-01-28 | Sangamo Biosciences, Inc. | Gene editing for hiv gene therapy |
Non-Patent Citations (5)
Title |
---|
KEIICHIRO SUZUKI ET AL.: "In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration", 《NATURE》 * |
PENGXIANG CHANG ET AL.: "The Application of NHEJ-CRISPR/Cas9 and Cre-Lox System in the Generation of Bivalent Duck Enteritis Virus Vaccine against Avian Influenza Virus", 《VIRUSES》 * |
XIANGJUN HE ET AL.: "Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair", 《NUCLEIC ACIDS RES》 * |
YUE GONG ET AL.: "High-efficiency nonhomologous insertion of a foreign gene into the herpes simplex virus genome", 《J GEN VIROL》 * |
ZHIHUA LI ET AL.: "CRISPR-Cas9 system-driven site-specific selection pressure on Herpes simplex virus genomes", 《VIRUS RES》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110305908A (en) * | 2019-07-12 | 2019-10-08 | 南方医科大学 | A kind of gene integration system and its application efficiently precisely targeted |
CN111041003A (en) * | 2019-12-20 | 2020-04-21 | 畜科生物工程有限公司 | Recombinant duck plague virus and construction method and application thereof |
CN112481222A (en) * | 2020-11-30 | 2021-03-12 | 中国医学科学院医学生物学研究所 | Conditionally replicating recombinant herpes simplex virus, vaccine and application thereof |
CN112481222B (en) * | 2020-11-30 | 2024-01-02 | 中国医学科学院医学生物学研究所 | Conditionally replicating recombinant herpes simplex virus, vaccine and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Andersson et al. | A defined subgenomic fragment of in vitro synthesized Moloney sarcoma virus DNA can induce cell transformation upon transfection | |
CN103397018B (en) | Site-directed modification method for DNA viral genome | |
CN107557390A (en) | A kind of method for screening the high expression sites of Chinese hamster ovary celI system | |
Britt | Human cytomegalovirus: propagation, quantification, and storage | |
CN108913684A (en) | A kind of method that exogenous sequences efficiently pinpoint orientation insertion DNA virus genome | |
CN106414740A (en) | Method for specific knockout of swine SLA-3 gene using CRISPR-Cas9 specificity, and sgRNA used for specifically targeting sla-3 gene | |
CN105518137A (en) | Method for specifically removing pig SALL1 gene by CRISPR-Cas9 and sgRNA used for specific targeting SALL1 gene | |
CN105518135A (en) | Method for pig CMAH gene specific knockout through CRISPR-Cas9 and sgRNA for specially targeting CMAH gene | |
CN105492608A (en) | Method using CRISPR-Cas9 to specifically knock off pig PDX1 gene and sgRNA of PDX1 gene for specific targeting | |
CN105950656A (en) | Method for rapidly obtaining gene knockout cell strains | |
CN101979598B (en) | Method for constructing HSV-1 BAC system carrying luciferase report genes | |
CN104928292B (en) | The design method of sgRNA a kind of and slow virus carrier, the plasmid of building | |
CN103757053A (en) | Site-specific modification and screening method for specific DNA (deoxyribonucleic acid) viral genome | |
CN106636154A (en) | Efficient sgRNA screening system and efficient sgRNA screening method | |
CN109182277B (en) | Monopterus albus rhabdovirus CrERV and RT-PCR detection primer and application | |
CN110468155A (en) | It is a kind of for saving the system, method and application of chitling road A type coronavirus | |
CN104745551B (en) | The method for knocking out human papillomavirus E 6/E 7 oncogene using TALEN | |
CN105713866A (en) | Human cytomegalovirus (HCMV) infectious clone as well as construction method and applications of HCMV infectious clone | |
CN113874495A (en) | Method for producing virus and harvesting solution composition | |
CN106566829A (en) | Nucleocapsid assembling necessary element and application thereof | |
CN114790463B (en) | Construction method and application of monoclonal cell strain for stably transfecting CRISPR/dCAS9 system | |
CN104975043A (en) | Shuttle vector for constructing recombinant MVA virus and having marker gene self-deleting system | |
Gowripalan et al. | Selection of vaccinia virus recombinants using CRISPR/Cas9 | |
CN107384961B (en) | TK gene deletion type goat pox virus and preparation method and application thereof | |
Rush et al. | Molecular recombination in a circular genome-ϕX174 and S13 |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181130 |
|
RJ01 | Rejection of invention patent application after publication |