CN108904806B

CN108904806B - Inhibitor of miR-497-5p and application thereof in preparation of medicine for treating hepatic fibrosis

Info

Publication number: CN108904806B
Application number: CN201810934325.5A
Authority: CN
Inventors: 郑葵阳; 颜超; 汤仁仙; 沈莉萍; 于倩; 李向阳; 华慧; 张波
Original assignee: Xuzhou Medical University
Current assignee: Xuzhou Medical University
Priority date: 2018-08-16
Filing date: 2018-08-16
Publication date: 2021-04-06
Anticipated expiration: 2038-08-16
Also published as: CN108904806A

Abstract

The invention belongs to the technical field of biology, and particularly relates to an inhibitor of miR-497-5p and application thereof in preparation of a medicine for treating hepatic fibrosis. According to the invention, through extensive and intensive research, the inhibitor is found to be capable of being complementarily combined with a miR-497-5p sequence for the first time, inhibiting the function of miR-497-5p to further promote the expression of Smad7, and the inhibitor can obviously inhibit the activation of hepatic stellate cells (main cells generating extracellular matrixes such as type I collagen and type III collagen fibrin) and the secretion of type I collagen fibers, so that the hepatic fibrosis is improved. Namely, the invention discovers the new application of the miR-497-5p inhibitor in the preparation of the medicine for treating hepatic fibrosis for the first time.

Description

Inhibitor of miR-497-5p and application thereof in preparation of medicine for treating hepatic fibrosis

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of an inhibitor of miR-497-5p in preparation of a hepatic fibrosis drug.

Background

microRNA (microRNA, miRNA) is a non-coding small RNA with the length of about 22 nt, exists in most eukaryotic cells, and can regulate the expression of genes at the post-transcriptional level. In a cell nucleus, firstly, RNA polymerase II transcribes an initial transcription product pri-miRNA with the length of about 300-1000 bp of a DNA fragment for coding miRNA, the pri-miRNA is processed by nuclease Drosha to form an miRNA precursor (pre-miRNA) with the length of about 70-90 bp, the pre-miRNA is transported out of the cell nucleus by a nuclear transport protein export 5 and then processed by nuclease Dicer to form a double-stranded miRNA with the length of 20-25 bp, and one of the double strands and an RNA silencing complex (RNA-induced silencing complex, RISC) form a RISC-miRNA complex and then are combined to a 3 'non-coding region (3' UTR) of target gene mRNA, so that the RISC is guided to degrade the mRNA or the target gene translated by repressing the target gene. It is characterized in that: (1) located in a non-coding region of the genome; (2) highly conserved evolutionarily; (3) gene expression can be regulated at the post-transcriptional level; (4) participate in various life processes and regulate the expression of up to 30 percent of protein. Mature miRNA is specifically combined with target messenger ribonucleic acid (mRNA) through RNA-induced silencing complex (RISC), thereby inhibiting the gene expression after transcription, and playing an important role in the aspects of regulating gene expression, cell cycle, organism development time sequence and the like. In particular, the nucleotides 2-8 from the 5' end of microRNAs are highly conserved in the same family of microRNAs, known as seed sequences, which play a critical role in post-transcriptional inhibition of translation of messenger ribonucleic acids (mRNAs).

Hepatic fibrosis is a compensatory response of the body to chronic liver injury, and is characterized in that extracellular matrix (ECM) is excessively deposited in the liver, and activation of Hepatic Stellate Cells (HSCs) is a main source of ECM and is a central link of Hepatic fibrosis. And factors causing liver fibrosis include chronic hepatitis B virus infection, alcohol abuse, non-alcoholic fatty liver disease and parasitic infection. Clonorchis sinensis (Clonorchis sinensis)Clonorchis sinensis) The fluke is commonly known as the liver fluke, mammals such as people, dogs and cats are infected by eating fish and shrimps containing clonorchis sinensis cysticercus, adults of the fluke are mainly parasitic in liver and gall ducts of the people and the mammals, the clonorchis sinensis caused by the fluke is a serious parasitic disease of zoonosis, China is a high-incidence area and a main epidemic area of the clonorchis sinensis, the fluke is widely popular in 26 provinces, cities and autonomous areas of China, and people are generally susceptible and are one of the key food-borne parasitic diseases for prevention and treatment in China. The excretion/secretion products (ESPs) of clonorchis sinensis can cause tissue damage and function change of liver and gall bladder of human and animal, cholangitis, gallstone, hepatic fibrosis, liver cirrhosis and the like, even induce bile duct cancer, wherein the most common pathological change is liver cancerAnd (4) fibrosis is carried out.

TGF-beta 1 can promote HSCs activation, increase ECM synthesis and reduce degradation, has important function in the occurrence and development of hepatic fibrosis, and mainly plays a role through TGF-beta/Smads signal transduction pathways. Smad7 is an important negative regulator in this pathway, and competes with Smad2 for binding to the activated TGF- β type i receptor (T β R-i) via its site in MH2, thereby inhibiting phosphorylation of Smad2, and preventing binding of Smad2 to Smad4 and nuclear transfer of the Smads complex. Smad7 also recruits smurf2 to activated TGF- β ri, ubiquitinates and degrades it, thereby inhibiting Smad2 phosphorylation, and thereby inhibiting TGF- β/Smad signaling pathways in activated HSCs cells, thereby reducing collagen deposition and α -SMA production.

At present, more and more researches show that miRNA can regulate the occurrence and development of hepatic fibrosis, for example, miR-29 plays an important role in regulating HSCs cell activation, and is miRNAs for inhibiting fibrosis. Upon transformation of HSCs cell activation into MFB, miR-29 decreases, while profibrotic genes such as platelet-derived growth factor (PDGF) -B and insulin-like growth factor (IGF) -I increase. TGF- β can down-regulate miR-29, aggravate the degree of fibrosis by activating HSCs and increasing ECM deposition. Conversely, Hepatocyte Growth Factor (HGF) may up-regulate miR-29 by decreasing TGF- β levels, thereby inhibiting fibrosis. In addition, miR-29 reduces HSCs activation by inhibiting PI3K/AKT signaling pathway to induce apoptosis. In liver fibrosis, major miR-21 expression is up-regulated; PDGF-BB is used for stimulating human hepatic stellate cells (LX-2), COL I and alpha-SMA are remarkably increased, and miR-21 is also remarkably up-regulated. By transfecting the miR-21 inhibitor, miR-21 expression in the LX-2 cell is reduced, and PDGF-BB induced LX-2 cell activation can be blocked, so that miR-21 plays an important role in regulating and controlling liver fibrosis. These studies indicate that miRNA has potential therapeutic effect and practical application value as an extremely important gene expression regulatory factor and action target.

Although some micro-RNAs are known in the art to have a certain correlation with hepatic fibrosis, miRNAs known in the art are various in types and functions, and the screening of miRNAs which are related to fibrosis and can be used as the selection and prognosis of pathogenesis and treatment schemes is difficult. At present, no report on treatment and prognosis of hepatic fibrosis based on miR-497 function inhibition exists in the field.

Disclosure of Invention

The technical problem to be solved by the invention is to provide an inhibitor of miR-497-5p, which can promote the expression of Smad7 so as to inhibit the activation of HSCs and is used for treating hepatic fibrosis.

The purpose of the invention is realized by the following modes: an inhibitor of miR-407-5p is used for regulating Smad7 protein expression, so that HSCs activation is regulated, and occurrence and development of hepatic fibrosis are regulated.

The inhibitor is combined with miR-497-5p, expression and functions of miR-497-5p are inhibited, and combination of miR-497-5p and Smad 73-UTR region is inhibited, so that transcription and expression of Smad7 are promoted, and HSCs activation is regulated;

the inhibitor is a nucleic acid comprising the following sequence:

the specific sequence is as follows: 5 '-ACAAACCACAGUGUGCUGCUG-' 3.

As an optimization scheme of the inhibitor of miR-497-5p, the inhibitor is a complementary sequence of miR-497-5 p.

As an optimized scheme of the inhibitor of miR-497-5p, the inhibitor is prepared by 2 omes, namely: 2-methoxy group, which is chemically modified, can maintain its stability.

An application of the miR-497-5p inhibitor in the preparation of hepatic fibrosis drugs.

Preferably, the present invention provides a pharmaceutical preparation for treating hepatic fibrosis, comprising the sequence: 5 '-ACAAACCACAGUGUGCUGCUG-' 3.

The inhibitor can be obtained by chemical synthesis.

The inhibitor may also be derived from a sample of an organism, including tissues, cells, and peripheral blood.

The inhibitor of the invention can be obtained from cells and tissues which are chemically synthesized and have the gene sequence, and the tissues can be selected from peripheral blood, body fluid, abscesses of cavities and ducts, pathological tissues, paraffin blocks and paraffin sections which are made of the tissues.

In the present specification, the term "sample" refers to an ex vivo circulating blood sample potentially containing micro miR-497-5p and its complementary sequence, preferably a human and mouse derived sample, preferably an unpurified lysate sample containing total blood RNA, although purified samples from which total blood RNA is extracted can also be used in the present invention. Those skilled in the art are aware of cellular molecular biology techniques for lysing or extracting, purifying and maintaining solid nucleated cells in which the miRNA components are not degraded. The sample of the present invention may be a processed sample such as dilution, blood cell lysis, PCR amplification, etc., or may be an unprocessed sample. The treated sample may be further purified to enrich for miRNA.

Herein, the term "miR-497-5 p" refers to a microRNA comprising the sequence "5 '-CAGCAGCACACUGUGGUUUGU-' 3" or a sequence homologous thereto. Various sources of miR-497-5p are known in the art, such as human, chimpanzee, horse, chicken, etc., and these homologous sequences are encompassed by the term miR-497-5p of the present invention. The term of the invention also encompasses RNAs with one or more nucleotides substituted, deleted or added to the naturally occurring miR-497-5p sequence, or with biochemical modification, and still having biological activity.

The inventor jointly predicts and discovers the binding site of miR-497-5p and smad 73' UTR region by using four databases of bioinformatics software MiRanda, MiRDB, MiRWalk and Targetscan. The dual-luciferase reporter gene detection shows that miR-497-5p can reduce the fluorescence activity of the wild type reporter gene, and the fluorescence activity of the mutant reporter gene has no significant difference compared with that of a control group. After miR-497-5p transfects LX-2 cells, Smad7 protein expression is reduced, miR-497-5p expression can be inhibited by using the inhibitor, Smad7 protein expression is increased, correspondingly, TGF-beta 1 or clonorchis sinensis excretion/secretion product induced hepatic stellate cell p-Smad2/3 protein expression level is reduced, hepatic stellate cell activation degree is reduced, and the expression amount of type I collagen and alpha-Smooth muscle actin (alpha-SMA) protein produced by the hepatic stellate cell is reduced. The data indicate that the inhibitor of miR-497-5p can promote the expression of Smad7 to be increased, and inhibit the activation of hepatic stellate cells, thereby inhibiting hepatic fibrosis.

The inhibitor can remarkably inhibit activation of hepatic stellate cells (main cells producing extracellular matrixes such as type I and type III collagen fibrin) and secretion of type I collagen fibers, thereby improving hepatic fibrosis.

Description of the drawings:

FIG. 1 is a Western blot for detecting the relative expression quantity of alpha-SMA and COL I proteins in LX-2 cells;

FIG. 2 is qRT-PCR detection of relative expression of alpha-sma, COL I mRNA in LX-2 cells;

FIG. 3 is a Western blot for detecting the relative expression quantity of alpha-SMA and COL I proteins in LX-2 cells;

FIG. 4 is a Western blot for detecting the relative expression quantity of Smad protein in LX-2 cells;

FIG. 5 shows that relative expression of miR-497-5p in LX-2 cells is detected by qRT-PCR;

FIG. 6 is a binding site of a plurality of different species Smad 73' UTR regions to miR-497-5 p;

FIG. 7 is a sequencing alignment of Smad 73' UTR wild type and mutant plasmids;

FIG. 8 is a schematic diagram of the binding sites of miR-497-5p and Smad 73' UTR wild type and mutant;

FIG. 9 is a dual luciferase reporter assay for fluorescence activity;

FIG. 10 shows that relative expression of miR-497-5p in LX-2 cells is detected by qRT-PCR;

FIG. 11 shows that relative expression of miR-497-5p in LX-2 cells is detected by qRT-PCR;

FIG. 12 shows that relative expression of miR-497-5p in LX-2 cells is detected by qRT-PCR;

FIG. 13 shows that Western blot is used for detecting the relative expression amount of Smad7 protein in LX-2 cells.

The Inhibitor used in the above figure represents a miR-497-5p Inhibitor; mimic represents a mimic of miR-497-5 p.

Detailed Description

The above-described scheme is further illustrated below with reference to specific examples; it is to be understood that these examples are intended to illustrate the invention and are not intended to limit the scope of the invention; the conditions used in the examples may be further adjusted according to the conditions of the particular manufacturer, and the conditions not specified are generally the conditions in routine experiments.

Example 1

Reagent and material

Reagent

Fetal bovine serum (Hyclone, usa); complete medium: each liter of RPMI1640 (Hyclone, USA) was added with 100ml of fetal bovine serum, 0.15g of L-glutamine, and 10.0 ml (5X 10) of 2-mercaptoethanol^-3mol/L); liposome 2000 (Invitrogen, usa); penicillin, streptomycin (Shanghai Biotechnology Co., Ltd.); TRIzol (Invitrogen, usa); agarose (spain); the reagents used in experiments such as sucrose, Triton-100, Tris (hydroxymethyl) aminomethane (Tris), hydrochloric acid, EDTA, NaCl, phenol, chloroform, isoamylol, Sodium Dodecyl Sulfate (SDS), absolute ethyl alcohol and the like are all analytically pure or superior pure; SYBR Green I fluorescent quantitation kit (Roche, USA), miRNA reverse transcription kit (Beijing Tiangen Biochemical technology Co.); dual-luciferase reporter assay kit (Promega, usa); pmirgo Smad7wt, mut plasmid (shanghai jiri bioengineering, ltd); miRNA-497 mim and miRNA-497 inhibitor (miRNA-497 inhibitor) are synthesized by Gima Gene Inc. PCR primers were synthesized from Shanghai.

Cell line

A human immortalized Hepatic Stellate Cell (HSC) cell line LX-2 was purchased from Xiangya medical college.

Instrument for measuring the position of a moving object

CO₂Cell culture chambers, low-temperature high-speed centrifuges (Eppendorf, Germany), conventional centrifuges, Biophotometer biophotometers (Eppendorf, Germany), real-time fluorescence quantitative PCR instruments (Roche, USA), protein electrophoresis instruments (BIO-RAD, USA), single-tube chemiluminescence detectors (Berthold, Germany).

Experimental methods

1. Real-time fluorescent quantitative detection of miR-497-5p expression level in HSCs (LX-2)

ESPs (60 mu g/ml) and TGF-beta 1 (15 ng/ml) are used for stimulating LX-2 cells respectively, and the relative expression quantity of miR-497-5p of the cells is detected by real-time quantitative PCR in cell samples of 6h, 12h, 24 h and 48h after stimulation.

The specific operation is as follows: the cell sample obtained above was used for extracting total RNA using Trizol reagent according to the instructions. The miRNA is inverted into cDNA by applying a tailing miRNA reverse transcription kit: 2 μ g of total RNA, 2 × miRNA RT Solution mix10 μ L, miRNA RT Enzyme mix 2 μ L, RNAase-free ddH₂O make up the volume to 20 μ L; and (3) gently mixing, centrifuging for 3-5 s, incubating the reaction mixture at 37 ℃ for 60 min, heating at 85 ℃ for 5min to inactivate the enzyme, and storing at 4 ℃. Detecting by using a real-time quantitative PCR kit, and detecting the relative expression quantity of miR-497-5p in the sample; u6RNA is used as an inner control; pre-denaturation: 5min at 95 ℃, amplification: 30 s at 95 ℃, 30 s at 60 ℃ and 30 s at 72 ℃ for 40 cycles; dissolution curve: 5 s at 95 ℃ and 1 min at 65 ℃ for 1 cycle. The upstream primer CAGCAGCACACTGTGGTTTGTA and the downstream universal primer are provided by Shanghai Bioengineering Co., Ltd.

2. Prediction of miRNA target sites of action

By miRWalk 1.0 (http:// zmf. umm. uni-heidelberg. de/apps/zmf/miRWalk @

Html), all target genes differentially expressing mirnas were predicted simultaneously using RNA22, miRWalk, TargetScan, miRDB and miRanda. We selected three or more simultaneously displayed target genes from the database. GO analysis and KEGG analysis were performed on these target genes by DAVID 6.7 (https:// DAVID. ncifcrf. gov). The miRNA related to the TGF-beta/Smad signaling pathway is predicted through DIANA-miRPath v3.0 http:// diana.iminis. athera-innovation. gr/DianaTools /), and the miRNA differentially expressed in the miRNA is found out. miR-497-5p can bind to the Smad 73' UTR region in four databases of miRanda, mirDB, mirWalK, RNA22 and Targetscan.

3 Dual luciferase reporter gene assay

3.1 Liposomal transfection

Add 500. mu.l of antibiotic-free medium to 24-well cell culture plates and inoculate each well1×10⁵293T cells, put into a cell culture box and 5% CO₂And culturing at 37 ℃ for 24 h to ensure that the cell fusion rate reaches about 90 percent. 0.8 mu g of each of the unloaded plasmid, Smad7 wild type plasmid, Smad7 mutant plasmid and miR-497-5p 40 pmol were dissolved in 50 mu L of serum-free antibiotic-free DMEM medium. Dissolving 1.6 μ L liposome in 50 μ L serum-free and antibiotic-free DMEM medium, mixing the two solutions after 5min, and standing at room temperature for 20 min. Removing culture medium from 24-well culture plate, washing cells with 1 ml serum-free and antibiotic-free culture medium for 3 times, adding 400 μ l serum-free and antibiotic-free culture medium, adding 100 μ l liposome plasmid mixed solution, mixing, placing in cell culture box with 5% CO₂Incubation is carried out at 37 ℃, and after 5 h, the medium is replaced by 500 mu l of DMEM medium containing 10% fetal bovine serum, so that the transfection is completed. 48h after transfection of the plasmid into the cells, luciferase activity was determined according to the instructions of the Dual-luciferase Reporter Assay kit.

3.2 Dual luciferase reporter Gene detection

Media was discarded from each well and cells were rinsed 3 times with PBS. Add 100. mu.L of Passive Lysis Buffer (PLB) to each well, gently shake the 24-well plate at room temperature, and after 15 min, transfer the cell lysate from each well to a 1.5 ml EP tube. After adding 100. mu.L of luciferase assay II (luciferase assay II, LARII) to a new 1.5 ml EP tube to be tested, 20. mu.L of cell lysate was added, vortexed and mixed to detect the firefly luciferase activity. Add 100. mu.L of stop & GLo Reagent, mix gently and detect Renilla luciferase activity. The ratio of the two is the relative luciferase activity intensity value.

4. Cell culture and processing

And after 24 hours of LX-2 adherence, adding a DMEM medium for starvation culture for 12 hours, respectively adding 120 pmol of miR-497-5p mice and inhibitors of NC and miR-497-5p (provided by synthesis of Shanghai Jima pharmaceutical technology Co., Ltd.), dissolving in 50 μ l of DMEM and 6 μ l of lip2000 in 50 μ l of DMEM, uniformly mixing, standing at room temperature for 20 min, adding into a culture dish, and adding the volume of DMEM to make up for 2 ml. After 6h, the medium was replaced with 10% FBS serum, and TGF-. beta.1 (15 ng/ml) and clonorchis sinensis excretion and secretion antigens (ESPs) (60. mu.g/ml) were added to stimulate LX-2 cells for further 48h, respectively.

Collecting the cells, and performing: adding 1 mL of Trizol, uniformly mixing, and storing at-80 ℃ for RNA extraction; ② adding pancreatin for digestion, centrifuging, adding PBS for washing, storing at-80 ℃ for protein extraction.

4.1 qRT-PCR detection in LX-2 cellsα-SMA、col1a、Smad7Relative expression amount of mRNA

4.1.1 Synthesis of cDNA

Taking the cell RNA, carrying out reverse transcription to synthesize single-stranded cDNA, wherein a reverse transcription reaction system (20 mu L) comprises:

reagent	Volume of
		RNA	3 μg
Oligo(dT)	2 μL
		dNTP
	2 μL

RNAase-free ddH2O, adding into water bath at 70 deg.C for 5min, cooling on ice for 2 min, centrifuging for a short time, and adding the following components:

reagent	Volume of
		5×First-strand	4 μL
RNasin	0.5 μL
		TIANScript M-MLV	1 μL

4.1.2 real-time quantitative PCR pairsα-SMA、col1a、Smad7Relative expression of mRNA

The following primers were used to perform real-time quantitative PCR detection on the target gene, and the real-time quantitative PCR reaction program was set as follows:

pre-denaturation 95 ℃ for 5min, amplification procedure: 30 s at 95 ℃, 30 s at 60 ℃ and 30 s at 72 ℃ for 40 cycles; dissolution curve program: 5 s at 95 ℃ and 1 min at 65 ℃ for 1 cycle.

TABLE 1 real-time quantitative PCR primer sequences

Correcting the Ct value of the target gene of each sample by taking the beta-actin gene as an internal reference, calculating the delta Ct value by taking 2^-△△CtValues were calculated for relative gene expression levels.

5. Detection of expression level of alpha-SMA, ColI and smad7 proteins

The expression of the alpha-SMA, ColI and smad7 proteins is detected by a conventional western-blot technology. The specific operation steps are as follows:

5.1 mixing the lysate containing protein with 5 xSDS loading buffer solution, balancing the lysate containing protein in each volume according to the measured protein concentration, boiling for 5min and preparing protein loading solution; 5.2 assembling the gel plate: aligning and fixing two rubber plates in a clamping plate on a horizontal experiment table to clamp (make the bottom surfaces parallel and level to prevent glue leakage), and vertically fixing the clamping plate on a rubber frame on which a rubber pad is arranged to prepare for glue pouring; 5.3, glue preparation: preparing 10% of separation glue, fully and uniformly mixing, slowly adding the separation glue along the wall of the glass plate, pouring until the position is about 2/3, stopping, then adding double distilled water to cover the glue surface, pouring the upper layer of double distilled water when an obvious boundary line appears between water and the separation glue, sucking the double distilled water by using filter paper, adding the prepared concentrated glue to the position 1-2 mm away from the top end of the rubber plate, quickly vertically inserting a comb to prevent bubbles from generating, and taking down a splint after the concentrated glue is solidified;

5.4, slightly pulling out the comb, pouring the electrophoresis liquid into the electrophoresis tank (the inner tank is full, the outer tank exceeds the electrode wire), and removing air bubbles in the inner tank and the sample adding hole;

5.5 sample loading and electrophoresis: injecting equal volume of Marker and protein sample solution into the sample hole by a microsyringe (to avoid sample overflow), covering the cover of the electrophoresis tank, inserting electrodes, starting the electrophoresis apparatus to run for 30 min at constant voltage of 60V, and when the bromophenol blue electrophoresis reaches the boundary of the concentrated gel and the separation gel, converting to constant voltage of 120V to bromophenol blue electrophoresis to the bottom of the gel plate; 5.6 film transfer: after electrophoresis is finished, cutting the gel into 8 cm multiplied by 4 cm according to a Marker, soaking the gel strip, the PVDF membrane and the filter membrane in 1 multiplied by wet conversion solution for 30 min, then sequentially placing the filter membrane, the PVDF membrane, the gel strip and another filter membrane on a positive plate of a wet conversion instrument, expelling bubbles by using a glass rod, fixing, starting to convert the membrane into 100V, and 1.5 h;

5.7 after the membrane is turned, washing the PVDF membrane for 5min by TBST, then putting the PVDF membrane into a sealing solution, and sealing the PVDF membrane on a horizontal shaking table at room temperature for 4 h;

5.8 fully contacting the sealed PVDF membrane with the diluted primary antibody, and incubating overnight at 4 ℃; 5.9 taking out the PVDF membrane from a refrigerator at 4 ℃, rewarming for 30 min at 37 ℃, then adding TBST to wash for 5min multiplied by 6 times, then adding diluted secondary antibody, and incubating for 2h at room temperature; 5.10 washing with TBST for 5min × 6 times, then washing with TBST to remove the residual Tween-20 on the membrane, and taking a picture of the PVDF membrane in a BIO-RAD gel imager. 5.11 calculating the band gray value by using beta-actin as an internal reference and using Image-J analysis software, and calculating the absorbance (A) value.

[ results ] A method for producing a compound

1. Expression of miR-497-5p inhibitor can relieve LX-2 cell activation induced by TGF-beta 1

After the miR-497-5p inhibitor is transfected, the TGF-beta 1 is used for stimulating LX-2 to activate the inhibitor, and Western blot results show that compared with a control group, after the miR-497-5p inhibitor is transfected, the expression quantity of alpha-SMA and COLI in LX-2 cells is reduced, and the difference has statistical significance (1)P<0.05). The miR-497-5p inhibitor is shown to reduce the LX-2 cell activation induced by TGF-beta 1. FIG. 1 shows that Western blot is used for detecting the relative expression amounts of alpha-SMA and COL I proteins in LX-2 cells (note: vs control:^# P<0.05；^## P<0.01；vs inhibitor NC： *P<0.05；** P<0.01); FIG. 2 shows the relative expression amounts of α -sma and COL I mRNAs in LX-2 cells measured by qRT-PCR (note: vs control:^# P<0.05；vs inhibitor NC： *P<0.05）。

2. miR-497-5p inhibitor can relieve ESPs-induced LX-2 cell activation

Early studies show that clonorchis sinensis excretes secretory antigens (ESPs) which can induce LX-2 cell activation, causing alpha-SMA, COLI expression increase. In order to further study the influence of the miR-497-5P inhibitor on hepatic fibrosis caused by clonorchis sinensis infection, after the miR-497-5P inhibitor is added, the LX-2 cells are stimulated by the ESPs, and Western blot results show that compared with a control group, after the miR-497-5P inhibitor is transfected, the expression quantity of alpha-SMA and COLI in the LX-2 cells is reduced, and the difference has statistical significance (P < 0.05). The fact that the miR-497-5p inhibitor can relieve the LX-2 cell activation induced by the ESPs is shown. FIG. 3 shows that Western blot detects the relative expression of alpha-SMA and COLI proteins in LX-2 cells (note: vs inhibitor NC: P < 0.05; note: vs NC: P < 0.01).

3. miR-497-5p inhibitor can inhibit activation of TGF-beta/Smad signaling pathway in XL-2 cell

Research results show that TGF-beta 1 can promote the activation of hepatic stellate cells and has important function in the occurrence and development of hepatic fibrosis. To further validate whether the miR-497-5p inhibitor can regulate the expression of Smad7, it is involved in TGF-beta 1-induced LX-2 cell activation. After the miR-497-5P inhibitor is transfected, the TGF-beta 1 is adopted to stimulate LX-2 cells, and Western blot results show that compared with an inhibitor control group, after the miR-497-5P inhibitor is transfected, the expression level of Smad7 protein is increased, the difference is statistically significant (P <0.05), the content of P-Smad2/3 protein is reduced, and the difference is statistically significant (P <0.05), so that the miR-497-5P inhibitor can increase the expression of the inhibitory protein Smad7 and reduce the expression of the downstream P-Smad 2/3. FIG. 4 shows that relative expression amounts of Smad protein in LX-2 cells were measured by Western blot (note: vs control: # P <0.05, # P < 0.001; vs inhibitor NC: # P < 0.05).

4. miR-497-5p inhibitor can inhibit expression of miR-497-5p

The miR-497-5p inhibitor is transfected to LX-2 cells, and qRT-PCR results show that compared with a control group, after the miR-497-5p inhibitor is transfected, the relative expression amount of miR-497-5p is reduced, and the difference is statisticallyMeans (P<0.01), the miR-497-5p inhibitor can reduce the expression level of miR-497-5p in LX-2 cells after transfection. FIG. 5 shows that relative expression of miR-497-5p in LX-2 cells is detected by qRT-PCR.

5. miR-497-5p has potential targeting effect on Smad 73' UTR region of multiple different species

Bioinformatics analysis suggests that the Smad 73' UTR region contains a miR-497-5p binding site, and the site exists in different species, and the sequence is highly conserved. FIG. 6 is a depiction of the binding site of multiple different species of Smad 73' UTR region to miR-497-5 p.

6. Smad7 is a direct target gene of miR-497-5p

6.1 successful construction of the pmiRGLO-Smad 73' UTR region Bifluorescein reporter Gene

6.1.1 construction of the pmiRGLO-Smad 73 'UTR region wild-type dual-fluorescein reporter by Shanghai Jie, Inc., Triplex sequencing showed that the plasmid matched 100% to the sequence of Smad 73' UTR. FIG. 7 shows the sequence alignment of wild type and mutant plasmids for Smad 73' UTR (note: black bold regions are mutant regions).

6.2 construction of the pmiRGLO-Smad 73' UTR region mutant Bifluorescein reporter Gene

FIG. 8 is a schematic diagram of the binding sites of miR-497-5p and Smad 73' UTR wild type and mutant.

6.3, the dual-luciferase experiment proves that smad7 is the target gene of miR-497-5p

To further clarify whether miR-497-5p can inhibit Smad7 expression by binding to the Smad 73 ' UTR region, we constructed a luciferase reporter plasmid pmiRGLO Smad 73 ' UTR (WT) reporter plasmid containing a miR-497-5p binding site on the Smad 73 ' UTR. Wild-type reporter plasmid (WT) was co-transfected with miR-497-5p into 293T cells. The activity of the reporter gene plasmid is detected by adopting a dual-luciferase reporter gene kit after 48 hours of transfection, and the result shows that the luciferase activity of the miR-497-5P group is reduced compared with that of an unloaded plasmid control group, and the difference has statistical significance (P < 0.05). We further constructed a luciferase reporter plasmid pmiRGLO Smad 73 'UTR Mutant (MUT) reporter plasmid containing a mutation in the miR-497-5p binding site on the Smad 73' UTR. After the mutant and miR-497-5P are co-transferred into 293T cells, the activity of the mutant reporter gene is not different compared with that of a control plasmid group, but is increased compared with that of a wild type plasmid group, and the difference has statistical significance (P is less than 0.05). The results prove that miR-497-5p can be bound to the Smad 73 ' UTR, so that protein expression of the Smad 73 ' UTR can be inhibited by promoting mRNA degradation or inhibiting translation of the Smad 73 ' UTR. FIG. 9 is a dual luciferase reporter fluorescence activity assay (note: vs NC: # P < 0.01; vs WT:xP < 0.001).

7. miR-497-5p up-regulated after LX-2 cell activation stimulated by TGF-beta 1

We use TGF-beta 1 to stimulate LX-2 cells, and the results show that miR-497-5p is obviously up-regulated at 48h compared with normal control cells, and the difference has statistical significance (P<0.05), suggesting that TGF-beta 1 can induce miR-497-5p up-regulation in LX-2 cells, thereby reducing the expression of inhibitory protein Sma7, promoting TGF-beta/Smad signaling pathway, and promoting TGF-beta 1 induced LX-2 cell activation. FIG. 10 shows that the relative expression quantity of miR-497-5p in LX-2 cells is detected by qRT-PCR (note: vs NC:. sup.: S. sup.: R)P<0.05；）。

8. miR-497-5p up-regulated after clonorchis sinensis ESPs stimulate LX-2 cell activation

In order to further research the effect of miR-497-5p on the hepatic fibrosis process caused by clonorchis sinensis. Human hepatic stellate cell LX-2 cells are stimulated by clonorchis sinensis excreted and secreted antigens (ESPs), 6h, 12h, 24 h and 48h cells are respectively collected, expression change of miR-497-5P in the LX-2 cells is detected by qRT-PCR, and results show that compared with cells of a normal control group, miR-497-5P is increased for 12h after the ESPs stimulate the LX-2 cells, and the difference has statistical significance (P <0.05), and the results show that the ESPs can induce expression of miR-497-5P in the LX-2 cells, so that the activation of the LX-2 cells induced by the ESPs can be promoted by reducing expression of inhibitory protein Sma7 and promoting TGF-beta/Smad signal pathways. FIG. 11 shows that relative expression of miR-497-5P in LX-2 cells is detected by qRT-PCR (note: vs NC:. about. P < 0.05).

9. Overexpression of miR-497-5p can reduce Smad7 protein level

9.1, to determine whether miR-497-5p has a regulation effect on Smad7 protein expressionWe transfect miR-497-5p to LX-2 cells, and after 48h, the relative expression quantity of miR-497-5p is increased compared with that of a control group, and the difference has statistical significance (P<0.05), which shows that miR-497-5p can up-regulate the expression level of miR-497-5p in LX-2 cells. FIG. 12 shows the relative expression of miR-497-5p in LX-2 cells detected by qRT-PCR (note: vs NC:. times. delta. C)P<0.01）。

9.2, compared with the control group, the expression amount of Smad7 protein in LX-2 cells is reduced after miR-497-5p transfection, and the difference is statistically significant (P<0.05). The miR-497-5p is suggested to inhibit the expression of Smad7 protein in LX-2 cells. FIG. 13 shows Western blot for detecting relative expression of Smad7 protein in LX-2 cells (Note: vs NCP<0.05）。

Claims

1. The application of the miR-497-5p inhibitor in the preparation of the medicine for treating hepatic fibrosis is characterized in that: the inhibitor of miR-497-5p inhibits the expression and function of miR-497 by combining with miR-497, inhibits the combination of miR-497 and Smad 73-UTR region, further promotes the transcription and expression of Smad7, and regulates the activation of HSCs;

the inhibitor is a nucleic acid comprising the following sequence:

the specific sequence is as follows: 5 '-ACAAACCACAGUGUGCUGCUG-' 3.

2. The application of the inhibitor of miR-497-5p in the preparation of drugs for treating hepatic fibrosis according to claim 1, wherein: the inhibitor is a complementary sequence of miR-497-5 p.

3. The application of the inhibitor of miR-497-5p in the preparation of drugs for treating hepatic fibrosis according to claim 1, wherein: the inhibitor is passed through 2 omes, i.e.: 2-methoxy group, which is chemically modified, can maintain its stability.