CN108893452A - Baeyer-Villiger monooxygenase, mutant and its application in preparation in long-chain binary hydroxy acid - Google Patents

Abstract

The invention discloses a kind of Baeyer-Villiger monooxygenase PaBVMO and its mutant from pseudomonas aeruginosa Pseudomonas aeruginosa, its encoding gene and amino acid sequence, recombinant vector and recombinant expression transformants containing the gene order, and ester acid or diester are generated using recombination Baeyer-Villiger monooxygenase catalysis long-chain ketone acid or the oxidation of long-chain ketone ester, using long-chain alpha in the hydrolysis generation of simple chemical method, the method for ω-dicarboxylic acids and medium-chain fatty alcohol.Compared with prior art, Baeyer-Villiger monooxygenase of the present invention has high regioselectivity, it is catalyzed long-chain ketone acid or the oxidation of long-chain ketone ester, it is preferentially produced unconventional ester acid or diester, middle long-chain alpha is directly obtained after chemical method hydrolysis, ω-dicarboxylic acids, efficiency of pcr product is high, has good potential prospects for commercial application.

Description

Baeyer-Villiger monooxygenase, mutant and its long-chain binary carboxylic in preparation Application in acid

Technical field

The invention belongs to technical field of bioengineering, and in particular to one kind derives from pseudomonas aeruginosa (Pseudomonas Aeruginosa Baeyer-Villiger monooxygenase and its mutant), the recombinant expression containing the monooxygenase gene carry Body and recombinant expression transformants, and utilize recombination Baeyer-Villiger monooxygenase catalysis long-chain ketone acid or long chain ketone The Baeyer-Villiger oxidation reaction of ester generates long-chain ester acid or diester, and then prepares α, ω-dicarboxylic acids method.

Background technique

α, ω-dicarboxylic acids can be used as monomer synthetic high polymer because of the particularity of its functional group, such as polyesters, polyamides The various functional plasticses such as amine, it is also possible to carry out all kinds of finings such as syntholube, plasticizer, coating, fine perfumery, corrosion inhibiter Product.Long-chain binary hydroxy acid is needed using short-chain dicarboxylates as substrate in chemical method synthesis, extends carbochain system by multistep reaction , there is the problems such as cumbersome, yield is low, and chemical method synthesis is all saturated dicarboxylic acid, and chain length is limited, and carbon is former Subnumber is usually no more than 13, and the chemical method synthesis of unsaturated long-chain binary hydroxy acid does not make a breakthrough also.It is raw compared to chemical method Object enzymatic conversion method synthesizes α, ω-dicarboxylic acids is good with specificity, selectivity is high, catalytic reaction condition (temperature, pH etc.) is mild, The features such as low energy consumption, pollution is small, has been favored by people.Especially passed through by substrate of many kinds of, abundance vegetable oil Bioconversion generates α, and ω-dicarboxylic acids meets sustainable development idea, has vast potential for future development.

In current research, α is prepared by bioanalysis, ω-dicarboxylic acids mainly includes two paths：One approach be by Fatty acid beta oxidation approach cutting in candida tropicalis, using the omega oxidation of P450 enzyme system catalysis fatty acid to synthesize Dicarboxylic acids；Another approach needs the cascade catalysis of the multienzyme such as hydrase, alcohol dehydrogenase, Baeyer-Villiger monooxygenase, Unsaturated fatty acid is converted into ester acid, further hydrolysis generates dicarboxylic acids.In latter paths, Baeyer- The asymmetric Baeyer-Villiger oxidation that Villiger monooxygenase (being abbreviated as BVMO) is catalyzed ketone acid compound generates corresponding Ester acid, be the key enzyme in the approach.

According to the specificity of catalysis substrate, BVMO can be divided for cyclohexanone monooxygenase (CHMO), cyclopentanone list oxygenation Enzyme (CPMO), 4-hydroxyacetophenone monooxygenase (HAPMO) and straight chain fatty ketone monooxygenase (AKMO) etc. are different classes of.Its In, straight chain fatty ketone monooxygenase can also be catalyzed the oxidation of ketone acid compound, but less for the report of this fermentoid at present. Kirschner etc. has carried out clonal expression to the PfBVMO from Pseudomonas fluorescens, the rouge which is 8-12 to carbon atom number Fat ketone activity it is higher (Appl.Microbiol.Biotechnol., 2007,73:1065-1072).The clones such as Rehdorf obtain PpBVMO from pseudomonas putida, the enzyme is to aromatic ketone, cyclic ketones, aliphatic ketone (3- decanone, 2- undecyl ketone, ten diketone of 2- etc.) Have it is higher activity (Biotechnol.Lett., 2007,29:1393-1398).Altenbuchner etc. has been cloned from copper The substrate spectrum of the monooxygenase MEK700 of green pseudomonad, the enzyme are wider, have to straight chain ketone, aromatic ketone and ring ketone compounds Activity (Appl.Microbiol.Biotechnol., 2008,77:1251-1260).The clones such as Bisagni obtain enlightening thatch Salmonella BVMO in category, the catalysis substrate of the enzyme preference are straight chain fatty ketone, including methyl n-heptyl ketone, 2-HEPTANONE, 3- decanone etc. (J.Mol.Catal.B:Enzym.,2014,109:161-169)。

Song etc. constructed the bioconversion that plant origin fatty acid is participated in using AKMO, chain binary in generation in 2013 Carboxylic acid Technology Ways (Angew.Chem.Int.Ed., 2013,52:2534-2537).Using 10- carbonyl stearic acid as substrate When carrying out catalysis reaction, because the two kinds of BVMO used are (in the PpBVMO and Pseudomonas fluorescens in pseudomonas putida PfBVMO) different to the Preference of oxygen insertion position, therefore it is converted into two kinds of esters respectively.Wherein, PpBVMO preference is leaned in carbonyl Oxygen is inserted into the side of nearly carboxyl, and the ester of generation is known as " conventional ester ", and PfBVMO preference is inserted into oxygen in the side far from carboxyl, raw At ester be known as " unconventional ester ".When carrying capacity on substrate is 1mM, the main hydrolysate for the response path that PpBVMO is participated in is 9 hydroxynonanoic acid and n-nonanoic acid, analysis yield are higher than 60%；And the main hydrolysate for the response path that PfBVMO is participated in is octanol And decanedioic acid, yield is analyzed also above 60%.

Although PfBVMO can be catalyzed long chain ketone acid oxidase and generate unconventional ester, and then hydrolyzes and obtain target product α, ω- Dicarboxylic acids (decanedioic acid), but the enzyme regioselectivity is not high, and the ratio of unconventional ester and conventional ester is only 71：29, therefore bottom Object utilization rate is lower, and is difficult to obtain the single α of structure, ω-dicarboxylic acids, separation and purification of products it is at high cost.And conventional ester Hydrolysate α, ω-carboxylic acid need that α, ω-dicarboxylic acids could be generated using chemical method or the enzyme process oxidation of multistep, react Step is more, and substrate utilization ratio is low, and there are problem of environmental pollution (Adv.Synth.Catal., 2014,356:1782–1788； Adv.Synth.Catal.,2016,358:3084-3092)。

Summary of the invention

Region of the present invention for the Baeyer-Villiger oxidation reaction of BVMO reported at present catalysis long-chain ketone acid The problem of ratio of poor selectivity, the unconventional ester of acquisition is low, synthesis α, ω-dicarboxylic acids complex steps, provides one kind " very Rule " the high Baeyer-Villiger monooxygenase PaBVMO of regioselectivity distinguishes catalysis oxidation 10- carbonyl ten using the enzyme Eight alkanoic acids and 9- carbonyl octadecanoid acid obtain one nonyl ester of one monooctyl ester of decanedioic acid and azelaic acid, by chemical hydrolysis obtain decanedioic acid and Azelaic acid can significantly shorten its synthesis path.

The purpose of the present invention can be achieved through the following technical solutions：

First aspect present invention：A kind of Baeyer-Villiger monooxygenase that " unconventional " regioselectivity is high is provided.

A kind of Baeyer-Villiger monooxygenase that " unconventional " regioselectivity is high is following (a) or (b) Protein：

Protein (a)：The protein that the amino acid sequence shown in SEQ ID No.2 forms；

Protein (b)：In amino acid sequence shown in SEQ ID No.2 through replacing, missing or adding several amino acid and The protein as derived from (a) with Baeyer-Villiger monooxygenase activity.

The protein (a) is obtained by the method that genome excavates, and designed method for digging is specifically, with from glimmering The amino acid sequence of the Baeyer-Villiger monooxygenase PfBVMO of light pseudomonad Pseudomonas fluorescens As reference sequences, pBLAST search is carried out in ncbi database, selects a collection of function prediction mono- for Baeyer-Villiger The amino acid sequence of oxygenase, the Amino acid sequence identity with PfBVMO is 30-70%, is cloned to these albumen, Recombinant Bacillus coli cells are constructed, the mono- oxygenation of the stearic Baeyer-Villiger of 10- carbonyl of the recombinant protein of expression is measured The parameters such as reactivity and regioselectivity are comprehensively compared and are screened to the enzyme cloned, finally obtain regional choice Property highest, derive from pseudomonas aeruginosa (Pseudomonas aeruginosa) Baeyer-Villiger monooxygenase PaBVMO.It is WP_003087250.1 that the enzyme, which is according to accession number, is predicted as the protein of Baeyer-Villiger monooxygenase Nucleic acid sequence design primer, clone and obtain from the pseudomonas aeruginosa that deposit number is CGMCC 1.9047.Wherein deposit number China General Microbiological culture presevation administrative center is come from for the pseudomonas aeruginosa of CGMCC 1.9047.

The protein (b) is the replacement for passing through one or more amino acid on the basis of protein (a), lacks or add The derived protein with Baeyer-Villiger monooxygenase activity added.High regional choice is being obtained by screening Property enzyme PaBVMO on the basis of, to wild type PaBVMO carry out protein engineering transformation, to further increase the activity of the enzyme. Half design and rational is carried out by fallibility round pcr and to the amino acid residue near the active pocket and substrate channels of PaBVMO, It was found that on the basis of the amino acid sequence shown in SEQ ID No.2, to the 56th asparagine residue, the 141st serine Residue, the 257th phenylalanine residue, the 310th alanine residue, the 313rd threonine residues individually or collectively carry out Amino acid residue replacement, still has Baeyer-Villiger monooxygenase activity.On this basis, pass through well-designed, screening Obtain the mutant that enzymatic activity significantly improves.

Preferably, the Baeyer-Villiger monooxygenase mutant is the mono- oxygenation of wild Baeyer-Villiger The mutant that the mutation of any one following situation obtains occurs for the amino acid residue of enzyme PaBVMO：

(1) the 56th asparagine in the amino acid sequence of wild type Baeyer-Villiger monooxygenase PaBVMO Leucine is replaced with, PaBVMO is named as_N56L；

(2) the 141st serine in the amino acid sequence of wild type Baeyer-Villiger monooxygenase PaBVMO replaces It is changed to leucine, is named as PaBVMO_S141L；

(3) the 257th phenylalanine in the amino acid sequence of wild type Baeyer-Villiger monooxygenase PaBVMO Glutamine is replaced with, PaBVMO is named as_F257Q；

(4) the 310th alanine in the amino acid sequence of wild type Baeyer-Villiger monooxygenase PaBVMO replaces It is changed to cysteine, is named as PaBVMO_A310C；

(5) the 313rd threonine in the amino acid sequence of wild type Baeyer-Villiger monooxygenase PaBVMO replaces It is changed to valine, is named as PaBVMO_T313V；

(6) the 141st serine replacement in the amino acid sequence of wild type Baeyer-Villiger monooxygenase PaBVMO For leucine, and the 257th phenylalanine replaces with glutamine, and the 310th alanine replaces with cysteine, is named as PaBVMO_{S141L/F257Q/A310C}；

(7) the 56th asparagine replaces in the amino acid sequence of wild type Baeyer-Villiger monooxygenase PaBVMO It is changed to leucine, and the 141st serine replaces with leucine, and the 257th phenylalanine replaces with glutamine, and 310 alanine replace with cysteine, and the 313rd threonine replaces with valine, is named as PaBVMO_{N56L/S141L/F257Q/A310C/T313V}。

The preparation method of the mutant is specially：To derive from pseudomonas aeruginosa (Pseudomonas Aeruginosa the wild enzyme PaBVMO gene of Baeyer-Villiger monooxygenase in) is drawn as template using random mutation Object carries out fallibility PCR and constructs random mutation library, carries out high flux screening to obtained mutation library, obtains the mutation of vigor raising Body PaBVMO_N56L、PaBVMO_S141L、PaBVMO_F257Q、PaBVMO_A310CAnd PaBVMO_T313V；Then with mutant PaBVMO_S141L's Gene is template, (chooses each 15- of amino acid sites upstream and downstream being mutated using the mutant primer containing catastrophe point The base in mutational site is replaced with the codon of amino acid after mutation, drawn as PCR forward direction by one section of base sequence of 20bp Object, reverse complementary sequence are PCR reverse primer), it is expanded by PCR method, obtains mutant gene, expression obtains activity Higher PaBVMO_{S141L/F257Q/A310C}And PaBVMO_{N56L/S141L/F257Q/A310C/T313V}。

Wherein the fallibility PCR amplification is this field routine techniques, and the system (50 μ L) of optional PCR reaction is：Template 0.5-20ng, 10 × rTag buffer 5 μ L, dNTP (each 2.0mM) 5 μ L, MgSO₄(25mM) 2 μ L, MnCl₂(100 μM) 5 μ L, A pair of of each 1 μ L of mutant primer (20 μM), the rTaq enzyme of 1 unit add ultrapure water to 50 μ L.

Optionally the program of the fallibility PCR amplification is：(1) 94 DEG C of denaturation 3min；(2) 94 DEG C of denaturation 10s, (3) 60 DEG C Anneal 30s, (4) 68 DEG C of extension 90s, and step (2)-(4) carry out 30 circulations, last 72 DEG C of extensions 10min altogether, and 4 DEG C of preservations produce Object.

Wherein the rite-directed mutagenesis PCR amplification is this field routine techniques, and the system (50 μ L) of optional PCR reaction is： Template 5-20ng, 10 × KOD plus buffer 5 μ L, dNTP (each 2.0mM) 5 μ L, MgSO₄(25mM) 2 μ L, a pair of mutation are drawn Each 1 μ L of object (20 μM), the KOD enzyme of 1 unit add ultrapure water to 50 μ L.

Optionally the program of the rite-directed mutagenesis PCR amplification is：(1) 94 DEG C of denaturation 5min；(2) 94 DEG C of denaturation 30s, (3) 60 DEG C of annealing 1min, (4) 68 DEG C of extension 90s, step (2)-(4) carry out 30 circulations, last 68 DEG C of extensions 10min, 4 DEG C of guarantors altogether Hide product.

The regioselectivity referred in the present invention refers to that Baeyer-Villiger monooxygenase catalysis long chain ketone acid oxidase is raw At unconventional ester and conventional ester molar ratio.Wherein, what the side that the non-carboxyl that oxygen is inserted in ketone group in ketone acid replaces generated Ester is known as unconventional ester；Conversely, the ester that the side that the carboxyl of ketone group replaces in oxygen insertion ketone acid generates is conventional ester.

The pseudomonas aeruginosa that the encoding gene of PaBVMO of the present invention is CGMCC 1.9047 from deposit number Pseudomonas aeruginosa.The specific preparation method of its coding DNA includes：With the genomic DNA of pseudomonas aeruginosa It obtains using this field convenient technical process (such as polymerase chain reaction, PCR) for template and encodes the monooxygenase The global DNA sequence of PaBVMO.The synthetic primer wherein designed, such as SEQ ID No.3 (upstream primer) and SEQ ID No.4 Shown in (downstream primer)：Upstream primer：5'-CCGGAATTCATGAGTACCCAACCCACC-3 ', wherein sequence shown in underscore For the restriction enzyme site of restriction enzyme EcoR I；Downstream primer：5'-CCCAAGCTTTCATGCGGGTACCCCTTC-3 ', Sequence shown in middle underscore is the restriction enzyme site of restriction enzyme Hind III.

The nucleotide sequence of heretofore described monooxygenase PaBVMO full-length gene is as shown in SEQ ID No.1, overall length For 1545 nucleotide bases.Its coded sequence (CDS) stops from the 1st base to the 1542nd base, and initiation codon is ATG, terminator codon TGA, intronless, the gene coding protein amino acid sequence such as sequence table in SEQ ID Shown in No.2.

Due to the degeneracy of codon, the base sequence for encoding the amino acid sequence of SEQ ID No.2 is not limited solely to SEQ ID No.1.Furthermore it is also possible to provide a poly core by being suitably introduced into replacement, missing, change, insertion or increase The homologue of thuja acid.In the present invention homologue of polynucleotide can by one to base sequence SEQ ID No.1 or Multiple bases are replaced, lack or increase in holding enzyme activity range to be made.

The homologue of SEQ ID No.1 also refers to promoter variants.Promoter or signal before the base sequence Sequence can be changed by the replacement, insertion or missing of one or more nucleotide, but these changes there are not the function of promoter There is negative effect.And by change promoter sequence or even with the more effective promoter from different kinds of organisms into Row replacement, can be improved the expression of target protein.

The present invention also provides the recombinant expression carriers for containing above-mentioned monooxygenase gene nucleic acid sequence.The recombinant expression Above-mentioned monooxygenase gene sequence DNA segment can be connected to structure on various expression vectors by conventional method in that art by carrier It builds.The expression vector preferably includes each plasmid vector of this field routine, preferably pET28a plasmid.Compared with Good, as an example, recombinant expression carrier of the present invention can be made by following methods：It will be resulting by PCR amplification The gene order DNA fragmentation of monooxygenase PaBVMO restriction enzyme EcoR I and Hind III double digestion, while will be empty Charge material grain pET28a restriction enzyme EcoR I and Hind III double digestion, the monooxygenase after recycling above-mentioned digestion The gene DNA fragment and pET28a plasmid of PaBVMO is connected using T4DNA ligase, and building is obtained comprising single oxygenation The recombinant expression carrier pET28a-PaBVMO of enzyme PaBVMO gene.

The present invention also provides the recombinant expression transformants comprising above-mentioned monooxygenase recombinant expression carrier.The recombination table It can be made up to transformant by converting above-mentioned recombinant expression carrier into host cell.The host cell is that this field is conventional Host cell, as long as being able to satisfy recombinant expression carrier steadily can voluntarily replicate, and the monooxygenase gene entrained by it It can be by effective expression.The host cell is preferably Escherichia coli, more preferably：E. coli BL21 (DE3).The recombinant expression carrier is converted into E. coli BL21 (DE3), can be obtained currently preferred Engineering strain.For example, converting recombinant expression carrier pET28a-PaBVMO to E. coli BL21 (DE3) In, obtain recombination bacillus coli E.coli BL21 (DE3)/pET28a-PaBVMO.

The present invention also provides the preparation methods of above-mentioned recombination monooxygenase.It is described recombination monooxygenase preparation method compared with It is goodly：Recombinant expression transformants as described above are cultivated, separation obtains the monooxygenase of recombinant expression.The wherein recombination table It is that this field is any up to culture medium used in transformant culture to make transformants grew and generate recombination monooxygenase of the invention Culture medium.The preferred LB culture medium of culture medium, formula are：Peptone 10g/L, yeast extract 5g/L, NaCl 10g/L, pH 7.0.Cultural method and condition of culture do not have special limitation, can be according to factors such as host cell species and cultural methods not Together, it is made appropriate choice by this field Conventional wisdom, as long as enabling transformant to grow and producing the monooxygenase. The concrete operations of recombinant expression transformants culture can be carried out by this field routine operation.Preferably, by recombination of the present invention Escherichia coli, such as E.coli BL21 (DE3)/pET28a-PaBVMO, are seeded in the LB culture medium containing kanamycins, 37 DEG C Culture, as the optical density OD of culture solution₆₀₀When reaching (preferably 0.6) 0.5-1.0, it is (excellent that final concentration of 0.1-1.0mmol/L is added Select 0.5mmol/L) isopropyl-β-D-thiogalactoside (IPTG) carry out producing enzyme induction, continue at 16 DEG C culture for 24 hours, i.e., It can high efficient expression monooxygenase PaBVMO of the present invention.After culture, the somatic cells of precipitating are collected by centrifugation, that is, attach most importance to The resting cell of group expression transformant；The cell of harvest is suspended in glycine-NaOH buffer (100mM, pH 9.0), is surpassed Sound is broken, is crushed liquid centrifugation, collects supernatant, can be obtained the crude enzyme liquid of the recombination monooxygenase PaBVMO；Centrifugation is received The cell precipitation freeze-drying obtained, can obtain lyophilized cells, be conducive to store for a long time, use after convenient.

The determination of activity of monooxygenase PaBVMO：0.2mmol/L 10- carbonyl octadecanoid acid and 0.1mmol/L will be contained The 1mL reaction system (100mmol/L kaliumphosphate buffer, pH 9.0) of NADPH is preheated to 25 DEG C, and suitable list is then added and adds Oxygenase PaBVMO is uniformly mixed, 25 DEG C of insulation reactions, and the absorbance change of NADPH at 340nm is detected on spectrophotometer, Record the changing value of certain time internal absorbance.

Enzyme activity is calculated according to the following formula：

Enzyme activity (U)=EW × V × 10³/(6220×l)

In formula, EW is the variation of absorbance at 340nm in 1 minute；V is the volume of reaction solution, unit mL；6220 are The molar extinction coefficient of NADPH, unit are L/ (molcm)；L is optical path length, unit cm.1 enzyme activity unit (U) is right Enzyme amount needed for 1 μm of ol NADPH should be aoxidized per minute under above-mentioned condition.

The present invention also provides the Baeyer-Villiger monooxygenases in catalysis long-chain ketone acid or long chain ketone esters Object conversion is closed, α, the application in ω-dicarboxylic acids are prepared.The wherein chemistry knot of the long chain ketone acid or long chain ketone ester type compound For structure as shown in following formula 1 or 2, formula 1 is long-chain ketone acid, and formula 2 is long-chain ketone ester.

Wherein, in formula 1, m=5-9, n=7-8；

In formula 2, m=5-9, n=7-8, R are-CH₃Or-C₂H₅。

The mono- Oxygenation of Baeyer-Villiger of the long-chain ketone acid or long-chain ketone ester, can be by following illustrative methods It carries out：In the Glycine-NaOH buffer of pH 7.5-9.5, in glucose dehydrogenase, glucose and NADP⁺Presence Under, under the action of the monooxygenase PaBVMO, the Baeyer-Villiger for being catalyzed the long-chain ketone acid or long-chain ketone ester is mono- Oxygenation.After reaction, it is hydrolyzed using aliphatic ester of the chemical method to generation, obtains corresponding alpha, omega-dibasic acid. In the application, concentration of the substrate in reaction solution can be 0.1-100mmol/L.It is described according to used reaction system The dosage of monooxygenase can be 1-500U/L.The mono- oxygenation of the Baeyer-Villiger of enzymatic long-chain ketone acid or long-chain ketone ester is anti- At once, coenzyme NADP 11 oxidation generates NADP⁺, in order to carry out the circular regeneration of coenzyme NADP 11, additionally added into reaction system Glucose and from bacillus megaterium glucose dehydrogenase (contemporary Chinese medical journal, 2007,17:172-174).Depend on In different reaction systems, the unit of activity of glucose dehydrogenase is uploaded can be with the Baeyer-Villiger monooxygenase It is equal.The molar ratio of glucose and substrate can be 1.0-1.5, the NADP additionally added⁺Dosage can be 0-1.0mmol/ L.The buffer can be any buffer of this field routine, such as sodium citrate, sodium phosphate, potassium phosphate, Tris-HCl Or Glycine-NaOH buffer, as long as its pH range is in 5.0-10.0, preferably pH range is 7.5-9.5, more excellent Select pH 9.0.The concentration of the buffer can be 0.05-0.2mol/L.The temperature of the enzymatic asymmetric reduction reaction can To be 15-35 DEG C, preferably 25 DEG C.In reaction process, intermittent sampling measures reaction conversion ratio, and the reaction time is converted completely with substrate Or subject to the time of reaction conversion ratio stopping growth, generally 1-24 hours.Gas can be used in reaction conversion ratio and regioselectivity Phase chromatography is analyzed.Pass through analytic routines ester and unconventional ester hydrolysis product ω-carboxylic acid and α in the present invention respectively, The concentration of omega-dibasic acid carries out quantitative and regioselectivity and calculates.Preferably, using HP-5MS capillary chromatographic column (30m Length, 0.25 μm of film thickness, Agilent Technologies) it is analyzed, carrier gas is nitrogen, detector For flame ionization ditector (FID).Injector temperature is 280 DEG C, and detector temperature is 280 DEG C.

After enzymatic regioselectivity list Oxygenation, target product dicarboxylic acids is prepared using conventional method. Preferably, reaction product is extracted with organic solvent, volatilization removes solvent, and aqueous slkali (NaOH or KOH) then is added, adds The fatty acid ester product that heat generates reaction to 60-80 DEG C is hydrolyzed, and generates dicarboxylate.Then it is added in hydrolyzate Strong acid obtains the precipitating of dicarboxylic acids, and target product dicarboxylic acids is obtained by filtration.

On the basis of common knowledge of the art, above-mentioned each optimum condition, can any combination to get preferably real to the present invention Apply example.

Raw material used in the present invention or reagent are commercially available in addition to special instruction.

Detailed description of the invention

Fig. 1 is the building schematic diagram of recombinant expression plasmid pET-PaBVMO.

Specific embodiment

The present invention is further illustrated below by embodiment, but does not therefore limit the present invention to the embodiment described model Among enclosing.In the following examples, the experimental methods for specific conditions are not specified, according to conventional methods and conditions, or according to description of commodity Book selection.

Material source in the following example is：

Expression plasmid pET28a is purchased from Shanghai Novagen company.

E. coli DH5 α and E.coli BL21 (DE3) competent cell, 2 × Taq PCR MasterMix, Ago-Gel DNA QIAquick Gel Extraction Kit is purchased from Beijing Tiangeng biochemical technology Co., Ltd.

The screening of embodiment 1 " unconventional " regioselectivity Baeyer-Villiger monooxygenase

Using the Baeyer-Villiger monooxygenase PfBVMO with higher " unconventional " regioselectivity as probe (sequence Column accession number AAC36351.2), it is compared in NCBI by protein sequence, chooses a batch with probe sequence similarity in 20%- 70% sequence, design primer carry out gene cloning.The target fragment that PCR amplification is obtained through digestion, be connected to plasmid It on pET28a, converts into E.coli DH5 α, through bacterium colony PCR verifying, Hou Song Jin Sirui Biotechnology Co., Ltd carries out sequence Measurement.Recombinant plasmid is extracted to sequencing result and the consistent bacterium of aim sequence, plasmid is transformed into E.coli BL21 again (DE3) in, overexpression and the regioselectivity screening of purpose enzyme are carried out.

Using 1mM 10- carbonyl octadecanoid acid as substrate, 1mL reaction is carried out with whole cell is recombinantly expressed.Reaction system is as follows： 1mL Tris-HCl buffer (100mM, pH 7.5), 1mM 10- carbonyl octadecanoid acid, 1g/L Tween-80,5mM glucose, 0.2mM NADP⁺, 50g/L recombination bacillus coli wet cell, enzyme powder is lyophilized in 1g/L BmGDH, in 30 DEG C of concussion reaction 8h.Reaction Terminate, 20%H is added₂SO₄PH to 2 is adjusted hereinafter, terminating reaction.Isometric ethyl acetate and NaCl is added to vibrate to after being saturated Extraction is centrifuged 3min.Upper layer ethyl acetate phase is drawn, volatilization removes solvent, and the KOH solution (1M) that 40 μ L are added dissolves, and 60 DEG C Hydrolyze 2h.Reaction terminates, and NaCl is added to being saturated, 160 μ L 20%H are added₂SO₄, 400 μ L ethyl acetate (contain 0.5mM positive 12 Alkane and 0.5mM palmitic acid are internal standard) concussion extraction.Upper layer ethyl acetate phase is drawn, a certain amount of anhydrous sodium sulfate is added and is done It is dry.Nitrogen buffer gas carries out gas chromatographic analysis hydrolysate with HP-5MS gas chromatographic column, (non-by detection n-octyl alcohol Conventional ester hydrolysis product) and 9 hydroxynonanoic acid (conventional ester hydrolysis product) ratio, characterize the monooxygenase of clone region choosing Selecting property.Wherein, the Baeyer-Villiger monooxygenase of pseudomonas aeruginosa (Pseudomonas aeruginosa) is derived from PaBVMO has highest regioselectivity, is 89:11.

The clone of 2 monooxygenase PaBVMO gene of embodiment and recombinant expression transformants building

Baeyer- is predicted as according to what Genebank in pseudomonas aeruginosa (Pseudomonas aeruginosa) was included Gene order (the Genebank accession number of Villiger monooxygenase：It WP_003087250.1) is foundation, design PCR primer is such as Under：

Upstream primer：CCGGAATTCATGAGTACCCAACCCACC；

Downstream primer：CCCAAGCTTTCATGCGGGTACCCCTTC。

Wherein, the underscore part of upstream primer is the restriction enzyme site of EcoR I, and the underscore part of downstream primer is The restriction enzyme site of Hind III.

It is the genome of the pseudomonas aeruginosa (Pseudomonas aeruginosa) of CGMCC1.9047 with deposit number DNA is template, carries out PCR amplification.The total volume of PCR amplification system is 50 μ L, specially：2x Taq PCR MasterMix 25 μ L, upstream primer and each 1.5 μ L of downstream primer (0.4 μm of ol/L), 2 μ L of DNA profiling (1 μ g) and ddH₂O 20μL.PCR amplification Program is：(1) 95 DEG C, initial denaturation 3min；(2) 94 DEG C, initial denaturation 30s；(3) 55 DEG C, anneal 30s；(4) 72 DEG C, extend 90s； Step (2)-(4) repeat 30 times；(5) 72 DEG C, extends 10min, be cooled to 4 DEG C.PCR product is purified through agarose gel electrophoresis, Using Ago-Gel DNA QIAquick Gel Extraction Kit recycling 1500bp or so purpose band, 30 DEG C, with restriction enzyme EcoR I and Hind III double digestion, with simultaneously use restriction enzyme EcoR I and Hind III double digestion empty plasmid pET28a, It is connected using T4DNA ligase, building obtains the recombinant expression carrier pET28a- comprising the monooxygenase PaBVMO gene PaBVMO (see Fig. 1) is transformed into E. coli DH5 α competent cell, in resistant panel containing kanamycin On positive recombinants are screened, picked clones body, bacterium colony PCR verify positive colony.Recombinant bacterium is cultivated, after plasmid amplification Extract plasmid, converted again into E. coli BL21 (DE3) competent cell, conversion fluid be applied to containing card that On the LB plate of mycin, 37 DEG C of inversion overnight incubations obtain Positive E. coli recombinant expression transformants E.coli/pET28a- PaBVMO, bacterium colony PCR verify positive colony.Plasmid is extracted, Jin Sirui Biotechnology Co., Ltd is sent to carry out sequencing, base Because coded sequence is as shown in sequence table SEQ ID No.1.

The random mutation of 3 monooxygenase PaBVMO of embodiment

It introduces random nucleotide to PaBVMO gene using fallibility round pcr to be mutated, wherein the primer is as follows：

Upstream primer：CCGGAATTCATGAGTACCCAACCCACC；

Downstream primer：CCCAAGCTTTCATGCGGGTACCCCTTC.

Wherein, template is the PaBVMO gene recombination plasmid obtained such as embodiment 2.

PCR reaction system (50 μ L) be：5 μ L, dNTP (each 2.0mM) 5 of template 0.5-20ng, 10 × rTag buffer μ L, MgSO₄(25mM) 2 μ L, MnCl₂(100 μM) 5 μ L, a pair of of each 1 μ L of mutant primer (20 μM), the rTaq enzyme of 1 unit add super Pure water is to 50 μ L.

The program of PCR amplification is：(1) 94 DEG C of denaturation 3min；(2) 94 DEG C of denaturation 10s, (3) 60 DEG C of annealing 30s, (4) 68 DEG C Extend 90s, step (2)-(4) carry out 30 circulations, last 72 DEG C of extensions 10min, 4 DEG C of preservation products altogether.

After pcr amplification product purifying, with EcoR I and Hind III respectively to fallibility pcr amplification product and carrier PET28a carries out double digestion, and the recovery product of the two, with 5h is connected at 16 DEG C of T4 ligase, Transformed E .coli BL21 (DE3) feels By state cell, and it is spread evenly across the LB agar plate containing 50 μ g/mL kanamycins, 37 DEG C are incubated overnight, and construct random prominent Mutant libraries, and screened.Screening obtains activity as the mutant of maternal 2.1-3.5 times of activity, finds that it is prominent through DNA sequencing Displacement point is respectively the 56th, the 141st, the 257th, the 310th, the 313rd in amino acid sequence shown in SEQ ID No.2 Position, catastrophe is that the 56th asparagine residue replaces with leucine residue, and the 141st serine residue replaces with leucine Residue, the 257th phenylalanine residue replace with glutamine residue, and it is residual that the 310th alanine residue replaces with cysteine Base, the 313rd threonine residues replace with valine residue, and gained mutant is expressed as PaBVMO_N56L、PaBVMO_S141L、 PaBVMO_F257Q、PaBVMO_A310C、PaBVMO_T313V, write a Chinese character in simplified form and be expressed as：N56L, S141L, F257Q, A310C and T313V.

The combinatorial mutagenesis of 4 monooxygenase PaBVMO of embodiment

Rite-directed mutagenesis uses QuikII Site-Directed Mutagenesis Kit(Stratagene, Catalog#200522) scheme is operated.Mutant primer of the design containing catastrophe point first is as follows：

It is mutated F257Q:

Upstream primer:GGCTTCACCCAAGCCCCGCAGGTGATGAAGCTG is shown in SEQ ID No.5.

Downstream primer:CTGCGGGGCTTGGGTGAAGCCCAGCACCCGCCC is shown in SEQ ID No.6.

It is mutated A310C:

Upstream primer:CTGGCTGCCTGCAATTCCACGGTGATCACCGAA is shown in SEQ ID No.7.

Downstream primer:CGTGGAATTGCAGGCAGCCAGGGCCGGATAGTA is shown in SEQ ID No.8.

It is mutated N56L:

Upstream primer:AGAGTCAACCTTTACCCTGGCTGCGCCTGCGAC is shown in SEQ ID No.9.

Downstream primer:GCCAGGGTAAAGGTTGACTCTCCAGGTGCCGCC is shown in SEQ ID No.10.

Mutation T 313V:

Upstream primer:GCCAATTCCGTTGTGATCACCGAAGGCATCCGC is shown in SEQ ID No.11.

Downstream primer:GGTGATCACAACGGAATTGGCGGCAGCCAGGGC is shown in SEQ ID No.12.

The mutant PaBVMO obtained with embodiment 3_S141LPlasmid is template, and the system (50 μ L) of PCR reaction is：Template 5- 20ng, 10 × KOD plus buffer 5 μ L, dNTP (each 2.0mM) 5 μ L, MgSO₄(25mM) 2 μ L, a pair of of mutant primer (20 μ M) each 1 μ L, the KOD enzyme of 1 unit add ultrapure water to 50 μ L.

The program of PCR amplification is：(1) 94 DEG C of denaturation 5min；(2) 94 DEG C of denaturation 30s, (3) 60 DEG C of annealing 1min, (4) 68 DEG C extend 90s, step (2)-(4) carries out altogether 30 recycle, last 68 DEG C of extensions 10min, 4 DEG C of preservation products.

Pcr amplification product 37 DEG C through restriction endonuclease DpnI digest 2h after, Transformed E .coli BL21 (DE3) competent cell, And it is spread evenly across the LB agar plate containing 50 μ g/mL kanamycins, 37 DEG C are incubated overnight, and select monoclonal and send sequencing.It will Sequencing result is compared, the difference of confirmation mutation front and back gene order and corresponding amino acid sequence.

Wherein, S141L/F257Q/A310C mutation building process is：First it is with the full-length gene order of mutant S141L Template constructs mutant S141L/F257Q with the PCR primer of mutant F257Q, then using this mutant as template, uses mutant The PCR primer of A310C constructs mutant S141L/F257Q/A310C.

Wherein, N56L/S141L/F257Q/A310C/T313V mutation building process is：First with mutant S141L/ The full-length gene order of F257Q/A310C is template, constructs N56L/S141L/F257Q/ with the PCR primer of mutant N56L A310C, then using this mutant as template, mutant N56L/S141L/F257Q/ is constructed with the PCR primer of mutant T313V A310C/T313V。

The building of 5 recombinant expression plasmid of embodiment and the preparation of recombinant expression transformants

The Baeyer-Villiger monooxygenase gene DNA fragmentation that embodiment 2-4 building, PCR amplification, recycling are obtained Double digestion 12h is carried out with restriction enzyme EcoR I and Hind III at 37 DEG C, is purified through agarose gel electrophoresis, utilizes fine jade Sepharose DNA QIAquick Gel Extraction Kit recycles target fragment.By target fragment under the action of T4DNA ligase, and also pass through The plasmid pET28a of EcoR I and Hind III double digestion, connects at 16 DEG C and obtains recombinant plasmid overnight.

Above-mentioned recombinant expression plasmid is transformed into E. coli DH5 α competent cell, mould containing that is blocked Positive recombinants are screened in the resistant panel of element, picked clones body, bacterium colony PCR verifies positive colony.Recombinant bacterium is cultivated, Plasmid is extracted after plasmid amplification, is converted again into E. coli BL21 (DE3) competent cell, and conversion fluid applies On cloth to LB plate containing kanamycin, 37 DEG C of inversion overnight incubations obtain Positive E. coli recombinant expression transformants, bacterium Fall PCR verifying positive colony.

The expression of the recombination monooxygenase of embodiment 6

In gnotobasis, the resulting recombination bacillus coli of embodiment 5 is seeded to containing kanamycins (50 μ g/ of final concentration ML in LB culture medium (10g/L peptone, 5g/L yeast extract, 10g/L NaCl, pH 7.0)), 37 DEG C of shaken cultivations are stayed overnight, and are pressed The inoculum concentration access of 1% (v/v) sets 37 DEG C of shaking table shaken cultivations, works as culture equipped in the 500mL shaking flask of 100mL LB culture medium The OD of liquid₆₀₀When reaching 0.6, the IPTG of final concentration of 0.2mmol/L is added as inducer, destination protein expression is induced, in 16 DEG C Fiber differentiation for 24 hours after, by medium centrifugal, collect cell, and twice with brine, obtain resting cell.It will obtain The sodium phosphate buffer (20mM, pH 7.0) of the 10 times of volumes of resting cell obtained suspends again, and 4 DEG C are pre-chilled to after sieving, uses High pressure homogenizer is crushed, pressure 800bar.Broken liquid is centrifuged at 4 DEG C, 12000 × g, 20min, collects supernatant Liquid, the as described recombination monooxygenase crude enzyme liquid.

The vigor of monooxygenase is measured by way of light absorption value variation at detection 340nm using spectrophotometer.It surveys It is as follows to determine method：In 1mL reaction system (100mmo1/L Glycine-NaOH buffer, pH 9.0), it is added 0.2mmol/L 10- carbonyl octadecanoid acid, 0.1mmol/L NADPH, 25 DEG C are added appropriate crude enzyme liquid after heat preservation 2 minutes, rapidly It mixes, detects the variation of light absorption value at 340nm, the ratio work of enzyme is shown in Table 1 in crude enzyme liquid.Crude enzyme liquid is through polyacrylamide gel electrophoresis Map analysis, recombinant protein exist in the form of partly soluble.

Using 10- carbonyl octadecanoid acid as substrate, 1mL reaction is carried out using whole cell is recombinantly expressed.Pass through gas-chromatography point Analysis hydrolysate characterizes the regioselectivity of monooxygenase, and operating method is the same as embodiment 1.Monooxygenase is to 10- carbonyl The regioselectivity measurement result of octadecanoid acid is shown in Table 1

Table 1PaBVMO and its mutant compare the activity and regioselectivity of 10- carbonyl octadecanoid acid

The calculation formula of enzyme activity is：Enzyme activity (U)=EW × V × 10³/(6220×l).In formula, EW is in 1min The variation of absorbance at 340nm；V is the volume of reaction solution, Unit/mL；6220 be the molar extinction coefficient of NADPH, unit L/ (mol·cm)；L is optical path length, unit cm.The unit of activity of Baeyer-Villiger monooxygenase is defined as, in above-mentioned item Under part, enzyme amount needed for 1 μm of ol NADPH oxidation of catalysis per minute is defined as a unit of activity.

Crude enzyme liquid is poured into flat chassis, -80 DEG C of refrigerator freezings is placed in and is put into freeze dryer after overnight and is freeze-dried, obtain Enzyme powder must be lyophilized, the enzyme powder prepared is placed in 4 DEG C and is in store for.

Embodiment 7-12 recombinates monooxygenase PaBVMO_{N56L/S141L/F257Q/A310C/T313V}It is catalyzed the Baeyer- of long-chain ketone acid Villiger oxidation

It is added prepared by 5U such as embodiment 6 in 0.4mL Glycine-NaOH buffer (100mmol/L, pH 9.0) PaBVMO_{N56L/S141L/F257Q/A310C/T313V}Enzyme powder is lyophilized and enzyme powder is lyophilized in 5U glucose dehydrogenase, final concentration of 1mmol/L is added Serial long-chain ketone acid, add the NADP of final concentration of 0.1mmol/L⁺With the glucose of 5mmol/L.At 20 DEG C, 1000rpm Oscillating reactions certain time.20%H is used after reaction₂SO₄PH to 2 is adjusted hereinafter, terminating reaction.Isometric acetic acid second is added Ester oscillation extraction, 12000 × g are centrifuged 3min, draw upper organic phase, and volatilization removes solvent, and 40 μ L concentration, which are then added, is The KOH solution of 1mol/L makes single Oxygenation product hydrolysis generate corresponding alcohol, carboxylic acid or diacid in 60 DEG C of reaction 2h, into And it is detected.Reaction terminates, and 160 μ L 20%H are added₂SO₄With 400 μ L ethyl acetate (n-dodecane containing 0.5mM and 0.5mM Palmitic acid is as internal standard) oscillation extraction.It draws upper organic phase and a certain amount of anhydrous sodium sulfate is added and be dried overnight, hydrolysate 9 hydroxynonanoic acid and capric acid need to first pass through silane derivatization and carry out gas chromatographic analysis again.Derivatising condition is：40 μ L hydrolysis is anti- Extract liquor is answered, (BSTFA contains 1% tetramethylsilane for 40 μ L pyridines and bis- (trimethylsilyl) trifluoroacetamides of 20 μ L N, O- Alkane), in 75 DEG C of heat preservation 25min.With gas chromatographic analysis measurement hydrolysate concentration and PaBVMO_{N56L/S141L/F257Q/A310C/T313V}To the regioselectivity of long-chain ketone acid, the chromatographic column used is HP-5MS.

Hydrolysate and corresponding specific analytical conditions for gas chromatography are as follows：

In the gas chromatographic analysis of embodiment 7-12, carrier gas is nitrogen, and injector temperature is 280 DEG C, and detector temperature is 280 DEG C, other conditions are as follows：

Embodiment 7：Substrate is 10- carbonyl hexadecanoic acid, and the hydrolysate of analysis is respectively n-hexyl alcohol and 9 hydroxynonanoic acid, Wherein, the analysis condition of n-hexyl alcohol is 80 DEG C of heat preservation 2.5min, is warming up to 110 DEG C with 10 DEG C/min rate；9 hydroxynonanoic acid Analysis condition is 150 DEG C of initial temperature, is raised to 215 DEG C with the heating rate of 5 DEG C/min.

Embodiment 8：Substrate is 10- carbonyl Heptadecanoic acide, and the hydrolysate of analysis is respectively n-heptanol and 9 hydroxynonanoic acid, Wherein, the analysis condition of n-heptanol is 90 DEG C of heat preservation 8min；The analysis condition of 9 hydroxynonanoic acid is referring to embodiment 8.

Embodiment 9：Substrate is 10- carbonyl octadecanoid acid, and the hydrolysate of analysis is respectively n-octyl alcohol and 9 hydroxynonanoic acid, Wherein, the analysis condition of n-octyl alcohol is 90 DEG C of heat preservation 8min；The analysis condition of 9 hydroxynonanoic acid is referring to embodiment 8.

Embodiment 10：Substrate is 9- carbonyl octadecanoid acid, and the hydrolysate of analysis is respectively n-nonyl alcohol and capric acid, wherein The analysis condition of n-nonyl alcohol is 80 DEG C of initial temperature, is raised to 90 DEG C with the heating rate of 2 DEG C/min, keeps the temperature 4min；Point of capric acid Analysis condition is 120 DEG C of initial temperature, is raised to 260 DEG C with the heating rate of 20 DEG C/min, keeps the temperature 1min.

Embodiment 11：Substrate is 10- carbonyl nonadecylic acid, and the hydrolysate of analysis is respectively n-nonyl alcohol and 9- hydroxyl nonyl Acid, wherein the analysis condition of n-nonyl alcohol is 80 DEG C of initial temperature, is raised to 90 DEG C with the heating rate of 2 DEG C/min, keeps the temperature 4min； The analysis condition of 9 hydroxynonanoic acid is referring to embodiment 8.

Embodiment 12：Substrate is 10- carbonyl arachic acid, and the hydrolysate of analysis is respectively Decanol and 9- hydroxyl nonyl Acid, wherein the analysis condition of Decanol is 100 DEG C of heat preservation 10min；The analysis condition of 9 hydroxynonanoic acid is referring to embodiment 8.

Gas chromatographic analysis the results are shown in Table 2.

Table 2 recombinates monooxygenase PaBVMO_{N56L/S141L/F257Q/A310C/T313V}Catalytic long-chain fatty Baeyer-Villiger Single Oxygenation result

Embodiment 13 recombinates monooxygenase PaBVMO_{N56L/S141L/F257Q/A310C/T313V}Catalysis prepares decanedioic acid

Reaction carries out in 1L three-necked flask, in 500mL Glycine-NaOH buffer (100mmol/L, pH 9.0) The middle PaBVMO that 6250U such as embodiment 6 is added and prepares_{N56L/S141L/F257Q/A310C/T313V}Enzyme powder and 6250U glucose dehydrogenation is lyophilized Enzyme powder is lyophilized in enzyme, and the 10- carbonyl octadecanoid acid of 150mg is added, adds the glucose and final concentration of 0.1mmol/L of 0.45g NADP⁺.20 DEG C, 200rpm mechanic whirl-nett reaction is for 24 hours.Reaction terminates, and uses 20%H₂SO₄PH is transferred to 2, with isometric acetic acid Ethyl ester extracts 3 times, and combining extraction liquid, rotary evaporation is concentrated into 500ml, is added isometric twice of saturated common salt water washing, removes Part aqueous impurity.Organic phase decompression rotary evaporation after washing removes solvent, and the KOH solution that 25mL concentration is 1M is added, It is stirred in 60 DEG C, hydrolysis 2h, reaction terminates for temperature to be increased to 90 DEG C, uses 20%H₂SO₄It is adjusted to pH7 or so, is restored extremely Room temperature, the impurity in precipitating being precipitated in solution at this time is based on fatty acid salt etc..Suspension filtering, is warming up to 90 for filtrate DEG C, use 20%H₂SO₄It is adjusted to pH 2 or so, is restored to room temperature, the precipitating being precipitated in solution at this time is decanedioic acid crude product.Filtering, 4mL boiling water is added into filter cake to be made to be completely dissolved, and is placed on 4 DEG C overnight after naturally cool to room temperature, high-purity is obtained by filtration Decanedioic acid is placed in 105 DEG C of oven dryings, and weigh 57.8mg, yield 56.9%, and nuclear magnetic resonance spectroscopy structure is correct.

Embodiment 14 recombinates monooxygenase PaBVMO_{N56L/S141L/F257Q/A310C/T313V}It is preparing nonane diacid catalyzed

Reaction carries out in 1L three-necked flask, in 500mL Glycine-NaOH buffer (100mmol/L, pH 9.0) The middle PaBVMO that 6250U such as embodiment 6 is added and prepares_{N56L/S141L/F257Q/A310C/T313V}Enzyme powder and 6250U glucose dehydrogenation is lyophilized Enzyme powder is lyophilized in enzyme, is added the 9- carbonyl octadecanoid acid of 150mg, adds the glucose and final concentration of 0.1mmol/L of 0.45g NADP⁺.20 DEG C, 200rpm mechanic whirl-nett reaction is for 24 hours.Reaction terminates, and uses 20%H₂SO₄PH is transferred to 2, with isometric acetic acid second Ester extracts 3 times, and combining extraction liquid, rotary evaporation is concentrated into 500ml, is added isometric twice of saturated common salt water washing, removing unit Divide water-solubility impurity.Organic phase decompression rotary evaporation after washing removes solvent, and the KOH solution that 25mL concentration is 1M is added, in 60 DEG C of stirrings, hydrolysis 2h, reaction terminate for temperature to be increased to 90 DEG C, use 20%H₂SO₄It is adjusted to pH7 or so, is restored to room Temperature, the impurity in precipitating being precipitated in solution at this time is based on fatty acid salt etc..Suspension filtering, is warming up to 90 DEG C for filtrate, Use 20%H₂SO₄It is adjusted to pH 2 or so, is restored to room temperature, the precipitating being precipitated in solution at this time is azelaic acid crude product.Filtering, to 4mL boiling water is added in filter cake to be made to be completely dissolved, and is placed on 4 DEG C overnight after naturally cool to room temperature, the nonyl of high-purity is obtained by filtration Diacid is placed in 105 DEG C of oven dryings, and weigh 67.8mg, yield 71.8%, and nuclear magnetic resonance spectroscopy structure is correct.

The expression activitiy of the recombination of comparative example 1 monooxygenase PaBVMO and monooxygenase WP_003087250.1

The protein of monooxygenase will be predicted as disclosed in monooxygenase PaBVMO of the present invention and ncbi database (accession number：WP_003087250.1 sequence alignment, Amino acid sequence identity 99.0%) are carried out.Wherein, institute of the present invention The 45th amino acids residue for stating monooxygenase PaBVMO is glutamic acid, and the corresponding site of protein WP_003087250.1 is Aspartic acid；The 106th amino acids residue of PaBVMO is serine, and the corresponding site of protein WP_003087250.1 is Threonine；The 226th amino acids residue of PaBVMO is aspartic acid, and the corresponding site of protein WP_003087250.1 is Glutamic acid；The 285th amino acids residue of PaBVMO is arginine, and the corresponding site of protein WP_003087250.1 is bad Propylhomoserin；The 362nd amino acids residue of PaBVMO is cysteine, and the corresponding site of protein WP_003087250.1 is sweet Propylhomoserin.

Recombinating monooxygenase PaBVMO is 34.6U/g, regioselectivity 89 to the activity of 10- carbonyl octadecanoid acid:11. Mutant PaBVMO is obtained by fallibility PCR random mutation_S141L, which is improved to 121.4U/g, regioselectivity It improves to 90:10, pass through Fixedpoint mutation modified acquisition mutant PaBVMO_{S141L/F257Q/A310C}With PaBVMO_{N56L/S141L/F257Q/A310C/T313V}, which is respectively increased to 247.9 and 366.8U/g, regioselectivity point Indescribably up to 90:10 and 94:6.And activity of the protein WP_003087250.1 to 10- carbonyl octadecanoid acid of sequence is disclosed It is respectively 25.7U/g and 78 with regioselectivity:22, the results showed that disclose the work of the protein WP_003087250.1 of sequence Property measurement and regioselectivity be below monooxygenase PaBVMO of the present invention, monooxygenase more below of the present invention The mutant of PaBVMO.

The above description of the embodiments is intended to facilitate ordinary skill in the art to understand and use the invention. Person skilled in the art obviously easily can make various modifications to these embodiments, and described herein general Principle is applied in other embodiments without having to go through creative labor.Therefore, the present invention is not limited to the above embodiments, ability Field technique personnel announcement according to the present invention, improvement and modification made without departing from the scope of the present invention all should be of the invention Within protection scope.

Sequence table

<110>East China University of Science；Hundred Fuan zymotechnic Co., Ltd of Suzhou

<120>Baeyer-Villiger monooxygenase, mutant and its application in preparation in long-chain binary hydroxy acid

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1545

<212> DNA

<213>Pseudomonas aeruginosa (Pseudomonas aeruginosa)

<400> 1

atgagtaccc aacccacccc tgccgccgcc cggcactgca aggtcgccat catcggcacc 60

ggtttctccg ggctggggat ggcgatccgt ctccgccagg aaggcgagga cgacttcctg 120

attttcgaaa aggaagccgg cgtcggcggc acctggagag tcaacaacta ccctggctgc 180

gcctgcgacg tgcaatccca cgtctattcc ttctccttcg aagcgaaccc ggagtggacg 240

cggatgttcg cccgccagcc ggaaatccgc gcctatctgg agaagtgctg ggaaaaatat 300

cgcttgcagg aaaagtccct gctgaacacc gagatcggca aactggcctg ggacgagcgg 360

caaagcctct ggcacctgca tgatgcccag ggcaaccatt acaccgcgaa cgccgtggtt 420

tccggtatgg gcggcctgtc caccccggcc tatccgcgcc tcgatggcct ggagaacttc 480

cagggcaagg tcttccattc ccagcagtgg gaccatgact atgacctcaa gggcaagcgc 540

gtggcggtga tcggcaccgg cgcctcggcg atccagttcg tcccggagat ccagccgctg 600

gtggccgcgc tcgatctcta ccagcgcact ccgccatgga tcctgcccaa acccgaccgg 660

gcgattagcg aaaccgaccg ccggcgcttc cggcgcttcc cgctggtgca aaagctctgg 720

cgcggcggcc tctacagcct gctggaaggg cgggtgctgg gcttcacctt cgccccgcag 780

gtgatgaagc tggtgcagcg cctggcgatc cgccacatcc acaagcagat caaggatccg 840

gaactgcgcc gccgcgtcac gccggactac accatcggct gcaagcgcat cctcatgtcg 900

cacaactact atccggccct ggctgccgcc aattccacgg tgatcaccga aggcatccgc 960

gccgtcaccg ccaacggaat cgtcgacggc aacggccggg aacgcgaggt cgacgcgatt 1020

attttcggta ccggcttcac cgccaacgac cctatccccc gcggagtggt attcggtcgc 1080

gactgtcgcg acctgctgga cagctggacc aagggcccgg aagcctacaa gggcactacc 1140

accgccggct tccccaacct gttcttcctg atgggaccga ataccggcct cggccacaac 1200

tccatggtct acatgatcga gtcgcagatc gcctacgtcc tcgatgcgct gaagctgatg 1260

aagcgccgcg aactgctcag tctcgaggtc aaagccccgg tgcaggaacg ctacaacgaa 1320

tacctccagc gcaagctgga ccgcagcgtc tggagcgtgg gcggttgcaa gagctggtat 1380

ctgcatccgg tcagcggccg caactgcacc ctgtggccgg gattcacctg gcgcttccgc 1440

gctctgaccc ggcagttcga cgcctccgcc taccacctca ccacgacacc gctcgccgct 1500

ctaagcaacg aagcccgcca acaggccgaa ggggtacccg catga 1545

<210> 2

<211> 514

<212> PRT

<213>Pseudomonas aeruginosa (Pseudomonas aeruginosa)

<400> 2

Met Ser Thr Gln Pro Thr Pro Ala Ala Ala Arg His Cys Lys Val Ala

1 5 10 15

Ile Ile Gly Thr Gly Phe Ser Gly Leu Gly Met Ala Ile Arg Leu Arg

20 25 30

Gln Glu Gly Glu Asp Asp Phe Leu Ile Phe Glu Lys Glu Ala Gly Val

35 40 45

Gly Gly Thr Trp Arg Val Asn Asn Tyr Pro Gly Cys Ala Cys Asp Val

50 55 60

Gln Ser His Val Tyr Ser Phe Ser Phe Glu Ala Asn Pro Glu Trp Thr

65 70 75 80

Arg Met Phe Ala Arg Gln Pro Glu Ile Arg Ala Tyr Leu Glu Lys Cys

85 90 95

Trp Glu Lys Tyr Arg Leu Gln Glu Lys Ser Leu Leu Asn Thr Glu Ile

100 105 110

Gly Lys Leu Ala Trp Asp Glu Arg Gln Ser Leu Trp His Leu His Asp

115 120 125

Ala Gln Gly Asn His Tyr Thr Ala Asn Ala Val Val Ser Gly Met Gly

130 135 140

Gly Leu Ser Thr Pro Ala Tyr Pro Arg Leu Asp Gly Leu Glu Asn Phe

145 150 155 160

Gln Gly Lys Val Phe His Ser Gln Gln Trp Asp His Asp Tyr Asp Leu

165 170 175

Lys Gly Lys Arg Val Ala Val Ile Gly Thr Gly Ala Ser Ala Ile Gln

180 185 190

Phe Val Pro Glu Ile Gln Pro Leu Val Ala Ala Leu Asp Leu Tyr Gln

195 200 205

Arg Thr Pro Pro Trp Ile Leu Pro Lys Pro Asp Arg Ala Ile Ser Glu

210 215 220

Thr Asp Arg Arg Arg Phe Arg Arg Phe Pro Leu Val Gln Lys Leu Trp

225 230 235 240

Arg Gly Gly Leu Tyr Ser Leu Leu Glu Gly Arg Val Leu Gly Phe Thr

245 250 255

Phe Ala Pro Gln Val Met Lys Leu Val Gln Arg Leu Ala Ile Arg His

260 265 270

Ile His Lys Gln Ile Lys Asp Pro Glu Leu Arg Arg Arg Val Thr Pro

275 280 285

Asp Tyr Thr Ile Gly Cys Lys Arg Ile Leu Met Ser His Asn Tyr Tyr

290 295 300

Pro Ala Leu Ala Ala Ala Asn Ser Thr Val Ile Thr Glu Gly Ile Arg

305 310 315 320

Ala Val Thr Ala Asn Gly Ile Val Asp Gly Asn Gly Arg Glu Arg Glu

325 330 335

Val Asp Ala Ile Ile Phe Gly Thr Gly Phe Thr Ala Asn Asp Pro Ile

340 345 350

Pro Arg Gly Val Val Phe Gly Arg Asp Cys Arg Asp Leu Leu Asp Ser

355 360 365

Trp Thr Lys Gly Pro Glu Ala Tyr Lys Gly Thr Thr Thr Ala Gly Phe

370 375 380

Pro Asn Leu Phe Phe Leu Met Gly Pro Asn Thr Gly Leu Gly His Asn

385 390 395 400

Ser Met Val Tyr Met Ile Glu Ser Gln Ile Ala Tyr Val Leu Asp Ala

405 410 415

Leu Lys Leu Met Lys Arg Arg Glu Leu Leu Ser Leu Glu Val Lys Ala

420 425 430

Pro Val Gln Glu Arg Tyr Asn Glu Tyr Leu Gln Arg Lys Leu Asp Arg

435 440 445

Ser Val Trp Ser Val Gly Gly Cys Lys Ser Trp Tyr Leu His Pro Val

450 455 460

Ser Gly Arg Asn Cys Thr Leu Trp Pro Gly Phe Thr Trp Arg Phe Arg

465 470 475 480

Ala Leu Thr Arg Gln Phe Asp Ala Ser Ala Tyr His Leu Thr Thr Thr

485 490 495

Pro Leu Ala Ala Leu Ser Asn Glu Ala Arg Gln Gln Ala Glu Gly Val

500 505 510

Pro Ala

<210> 3

<211> 27

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

ccggaattca tgagtaccca acccacc 27

<210> 4

<211> 27

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

cccaagcttt catgcgggta ccccttc 27

<210> 5

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

ggcttcaccc aagccccgca ggtgatgaag ctg 33

<210> 6

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

ctgcggggct tgggtgaagc ccagcacccg ccc 33

<210> 7

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

ctggctgcct gcaattccac ggtgatcacc gaa 33

<210> 8

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

cgtggaattg caggcagcca gggccggata gta 33

<210> 9

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 9

agagtcaacc tttaccctgg ctgcgcctgc gac 33

<210> 10

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 10

gccagggtaa aggttgactc tccaggtgcc gcc 33

<210> 11

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

gccaattccg ttgtgatcac cgaaggcatc cgc 33

<210> 12

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

ggtgatcaca acggaattgg cggcagccag ggc 33

Claims (12)

1. a kind of Baeyer-Villiger monooxygenase, which is characterized in that it is following (a) or protein (b)：

Protein (a)：The protein that the amino acid sequence shown in SEQ ID No.2 forms；

Protein (b)：By replacing, missing or adding several amino acid and having in amino acid sequence shown in SEQ ID No.2 The protein as derived from (a) of Baeyer-Villiger monooxygenase activity.

2. a kind of Baeyer-Villiger monooxygenase according to claim 1, which is characterized in that the protein (b) be By the 56th asparagine residue, the 141st serine residue, the 257th in the amino acid sequence as shown in SEQ ID No.2 Single-point replaces with other amino acid residues respectively for phenylalanine residue, the 310th alanine residue, the 313rd threonine residues Or the protein of the amino acid sequence formed after being combined to single-point replacement.

3. a kind of Baeyer-Villiger monooxygenase according to claim 2, which is characterized in that the protein (b) be One of following sequence：

(1) the 56th asparagine residue of the amino acid sequence as shown in SEQ ID No.2 is replaced with into shape after leucine residue At amino acid sequence protein；

(2) the 141st serine of the amino acid sequence as shown in SEQ ID No.2 is replaced with formed after leucine residue it is new The protein of amino acid sequence；

(3) it is formed after the 257th phenylalanine of the amino acid sequence as shown in SEQ ID No.2 being replaced with glutamine residue Amino acid sequence protein；

(4) the 310th alanine of the amino acid sequence as shown in SEQ ID No.2 is replaced with being formed after cysteine residues The protein of amino acid sequence；

(5) the 313rd threonine of the amino acid sequence as shown in SEQ ID No.2 is replaced with formed after valine residue it is new The protein of amino acid sequence；

(6) the 141st serine residue of the amino acid sequence as shown in SEQ ID No.2 is replaced with into leucine residue, the 257th Position phenylalanine residue replaces with glutamine residue, and the 310th alanine residue, which replaces with, to be formed after cysteine residues The protein of amino acid sequence；

(7) the 56th asparagine residue of the amino acid sequence as shown in SEQ ID No.2 is replaced with into leucine residue, the 141 serine residues replace with leucine residue, and the 257th phenylalanine residue replaces with glutamine residue, and the 310th Alanine residue replaces with cysteine residues, and the 313rd threonine residues replace with the new amino formed after valine residue The protein of acid sequence.

4. a kind of isolated nucleic acid, which is characterized in that nucleic acid encode Baeyer- as described in any one of claim 1-3 Villiger monooxygenase.

5. a kind of recombinant expression carrier comprising nucleic acid as claimed in claim 4.

6. a kind of recombinant expression transformants comprising recombinant expression carrier as claimed in claim 5.

7. a kind of preparation method of Baeyer-Villiger monooxygenase, which is characterized in that the preparation method includes following step Suddenly：Recombinant expression transformants as claimed in claim 6 are cultivated, the Baeyer-Villiger monooxygenase of recombinant expression is obtained.

8. a kind of Baeyer-Villiger monooxygenase as described in any one of claim 1-3 is preparing α as catalyst, Application in ω-dicarboxylic acids, which is characterized in that include the following steps：

(1) use Baeyer-Villiger monooxygenase as claimed in any one of claims 1-3 as catalyst, catalysis Substrate long-chain ketone acid or long-chain ketone ester oxidation prepare ester acid or diester；

(2) ketone ester or diester that extraction step (1) obtains carry out ester hydrolysis reaction in aqueous slkali, generate α, ω-binary carboxylic Acid.

9. application as claimed in claim 8, it is characterised in that：The long-chain ketone acid or long-chain ketone ester have following general formula：

Wherein, the long-chain ketone acid is as shown in Equation 1, wherein：M=5-9, n=7-8；

The long-chain ketone ester is as shown in Equation 2, wherein：M=5-9, n=7-8, R are-CH₃Or-C₂H₅。

10. application as claimed in claim 8 or 9, it is characterised in that：The step (1) uses any in such as claim 1-3 Baeyer-Villiger monooxygenase catalysis long-chain ketone acid or long-chain ketone ester described in carry out regioselective oxidation reaction, NADPH oxidation simultaneously generates NADP⁺。

11. the application as described in claim 8 or 9 or 10, it is characterised in that：In the step (1), glucose dehydrogenase is coupled The glucose dehydrogenation reaction of catalysis, by NADP⁺Enzyme process reducing/regenerating is NADPH.

12. application of the recombinant expression transformants as claimed in claim 6 as catalyst in preparation α, ω-dicarboxylic acids, It is characterized in that, includes the following steps：

(1) use recombinant expression transformants as claimed in claim 6 as catalyst, catalysis substrate long-chain ketone acid or long-chain ketone ester Oxidation prepares ester acid or diester；

(2) ketone ester or diester that extraction step (1) obtains carry out ester hydrolysis reaction in aqueous slkali, generate α, ω-binary carboxylic Acid.