CN108872578A - A kind of new method of diagnosis and monitoring carcinoma of mouth - Google Patents
A kind of new method of diagnosis and monitoring carcinoma of mouth Download PDFInfo
- Publication number
- CN108872578A CN108872578A CN201710330835.7A CN201710330835A CN108872578A CN 108872578 A CN108872578 A CN 108872578A CN 201710330835 A CN201710330835 A CN 201710330835A CN 108872578 A CN108872578 A CN 108872578A
- Authority
- CN
- China
- Prior art keywords
- saliva
- excretion body
- concentration
- carcinoma
- mouth
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Urology & Nephrology (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of monitoring oral leukoplakias to carcinoma of mouth conversion and diagnoses the new method of carcinoma of mouth, the concentration variation including monitoring oral leukoplakia subject oral cavity excretion body, to judge to the risk of pathological state locating for disease and canceration.
Description
Technical field
The present invention relates to a kind of new methods that painless, easy monitoring oral leukoplakia is converted to carcinoma of mouth, including monitor by
The variation of the concentration of examination person's saliva excretion body, so that it is determined that pathologic stage locating for oral leukoplakia, realization finds cancer before canceration
Become high-risk patient to realize the early stage of carcinoma of mouth in time to remedy measures are applied in fact, effectively prevent.
Background technique
Carcinoma of mouth is one of most common 10 kinds of cancers in the world, accounts for the 80% of head-neck malignant tumor, in global range
There are about 5,000,000 oral cancer patients, wherein more with oral squamous cell carcinoma (oral squamous cell carcinoma, OSCC)
See, five year survival rate is about 35-57%, and there are about 130,000 oral cancer patients death every year[1-2].Carcinoma of mouth take place mostly in it is old
Year people.Although progress is achieved in terms of diagnostic techniques, surgical operation and chemotherapy, radiotherapy in recent years, unfortunately patient
5 annual survival rates still hover 50% or so.The key for effectively preventing carcinoma of mouth is correctly to identify there is canceration potential
Mouth disease, also referred to as precancerous lesion.If can accomplish that early stage correctly diagnoses, continues to monitor, intervening in time, for carcinoma of mouth
Prevention and treatment be of great significance.
Oral precancerous lesion refers to that certain clinical i.e. histologies of oromaxillo-facial region have change, and the disease with cAMP content
Become, including fibroid change, papilloma, chronic ulcer, mucous membrane under hickie, erythema, lichen planus, lupus erythematosus discoides, mucous membrane
Blackspot and mole etc., wherein oral leukoplakia is acknowledged as one of most typical precancerous lesion, canceration in the speckle disease of oral cavity
Rate is up to 10-36%.
Oral leukoplakia (Oral leukoplakia, OLK) is also referred to as oral cavity mucous membrane white spot, is by Hungary dermatologist
Er no Sohuimmer was named first in 1887, referred to the white or canescence dyskeratosis betided on mucous membrane of mouth
Lesion.Oral cavity mucous membrane white spot is common in mid-aged population, is apt to occur on the mucous membranes such as lip, cheek, tongue, palate, general no conscious sympton, just
Be creamy white patch when rising, surface is smooth, it is flat or it is slightly higher go out normal mucosa.Hickie is that carcinoma of mouth can be with from precancerous lesion to development
Several years to the more than ten years are undergone, the process of canceration is also the process of a multistage, multi-step, will be undergone in hyperplasia → squamous
Skin metaplasia → slight, moderate, severe abnormality hyperplasia → carcinoma in situ → infiltrating carcinoma differentiation[3-4], and most of oral leukoplakia can
It is chronically at benign state and canceration does not occur, only small part experience precancerous lesion, precancerous condition develops into cancer.In recent years, mouth
Chamber cancer morbidity has the tendency that increasing and obvious rejuvenation.Although to the surgical operation of carcinoma of mouth, radiotherapy and chemotherapy technology not
Disconnected progress, but 5 annual survival rates of patient are still less than 50%.Wherein 5 years survival rates of tumour limitation person are about 80%, and are occurred
Transferrer then drops to 20%[5]。
Carcinoma of mouth overall survival is lower, and the reason is that various, patient assessment is a critically important factor too late,
Most carcinoma of mouth have arrived middle and advanced stage when finding.The key of early detection carcinoma of mouth is to the oral precancerous lesion with canceration potential
Accomplish correctly to diagnose, continue to monitor and early detection.If oral cancer patient can early diagnose and get timely medical treatment, pre-
After can substantially improve.Therefore how to strive for that the clues and traces of early detection oral cavity canceration just become the hot spot of numerous scholar's researchs.
Currently, have for detecting carcinoma of mouth method mainly clinical examination, histopathological examination, exfoliative cytology inspection,
Living tissue dyeing, optical check, detection of tumour cell molecular marker etc..
Clinical examination is presently the most easy method, and doctor can be found that intraoral disease using visual examination, palpation inspection
Damage.If the clinical experience deficiency of doctor and the compliance of patient are poor, it is unable to regular follow-up, can all influence clinical observation effect
Fruit.It is with clinical examination it cannot be determined whether there is cAMP content only, it is also necessary to which histopathological examination is further made a definite diagnosis.
Exfoliative cytology inspection is a kind of detection method that comparison is easy, includes that DNA image is fixed using auxiliary examination methods
Amount analysis, micronucleus assay etc. may determine that whether disease damage tissue occurs canceration.But the success or not of this technical application is depended on
In the experience of operator and quantity, the position of swipe cell etc..
Living tissue dyeing is a kind of method that non-damage diagnoses early stage carcinoma of mouth.Its principle is to utilize canceration
Organize and lesions showed tissue site different to the dye levels of coloring agent.Coloring agent has toluidine blue, Lugol's Staining, methylene blue etc..
The most commonly used is toluidine blues for the department of stomatology at present, but its false positive rate is high, is easy to appear mistaken diagnosis.
Optical inspection is a kind of Examined effect based on tissue optical property, is studied in tumor screening field at present
More, this kind of technology includes tissue spectroscopy Examined effect, autofluorescence imaging technique and VELscope etc..At present in the oral cavity
Mainly VELscope technology, the VELscope of application launch a kind of blue laser, and for wavelength between 400-460nm, it can
To excite the green fluorescence in oral cavity tissue autofluorescence group.This change optically can disclose the new old of mucosa cells
Metabolism, biochemistry and structural information, and can be with localization region canceration.The application of this technology, which is all based on, at present exists
Pathological biopsy is determined there are under conditions of the paraplasm of mucous membrane of mouth or canceration, so also needing further clinical verification.
Recent tumour cell molecular marker analyte detection etc. is concerned by people.For detecting the pernicious change of oral precancerous lesion
Biomarker can be roughly divided into four classes：1. marker relevant to cell Proliferation, such as proliferating cell nuclear antigen, kernel group
At area's AgNOR, 67 Mi b-1 of Ki, Telomerase etc.；2. marker relevant to Apoptosis, such as Bcl-2/Bax,
Survivin, epoxide hydrolase 2 etc..；3. specific gene, such as p53 gene and its expression product；4. chromosome aberration, such as micro-
Satellite mark and loss of heterozygosity, DNA content etc.[6].The discovery such as Mendez, there is 314 compared with normal tissue, in carcinoma of mouth
Gene expression is variant, wherein 239 gene expression up-regulations, 75 down regulation of gene expression[7].More and more researches show that salivas
Biomarker in liquid is related to the occurrence and development of carcinoma of mouth and prognosis, however the biomarker of carcinoma of mouth is gone back at present
The index of none or one group can obtain generally acknowledged sure effect.
Despite the presence of above-mentioned many carcinoma of mouth detection methods, but histopathological examination is still oral leukoplakia and oral cavity
The goldstandard of cancer diagnosis.After operator comprehensively considers according to the clarity on lesion size, position, boundary, Biopsy is determined also
It is incisional biopsy.The high-risk phase of lesion is not necessarily uniformly distributed, and must observe suspicious points, when necessary multidigit point biopsy.
Since inspection operation itself has traumatic and irritation to lesion, postoperative scar can also affect on observation, into one
Step limits the repeatability of the inspection.The prison converted for being in simple hyperplasia or the hickie in paraplasm stage to carcinoma of mouth
For survey, histopathological examination is difficult to because it needs to obtain living tissue repeatedly as conventional monitoring means.
The monitoring needs of leukoplakia cancer inspect periodically lesion, record its variation, to make to its canceration risk
Appropriate assessment, strives finding high-risk patient before hickie is converted to carcinoma of mouth, appropriate treatment is taken it in time, because of patient
Once being changed into oral squamous cell carcinoma by oral cavity mucous membrane white spot, 5 years survival rates are less than 50%[8].It is, thus, sought for
A kind of accurately and timely to monitor the method that hickie is converted to carcinoma of mouth, this method not only needs to reflect the dynamic mistake of lesions transformation
Journey, and want easy to implement, patient can receive.
The inventors of the present application found that the oral cavity mucous membrane white spot of simple hyperplasia is to hickie with paraplasm, turn of carcinoma of mouth
Change, significant change occurs for the concentration of patient's saliva excretion body, i.e., when hickie is in simple hyperplasia state, saliva excretion body it is dense
It spends not significant relative to normal person's difference；But when hickie proceeds to the paraplasm stage, the concentration of saliva excretion body is relative to just
Ordinary person is significantly raised, significant difference；Once paraplasm is converted into carcinoma of mouth, the concentration of saliva excretion body is anti-relative to normal person
And it is decreased obviously, and significant difference.With pathological change of the hickie from simple hyperplasia, paraplasm to canceration, patient's saliva
The concentration generation of excretion body first increases the dynamic changing process reduced afterwards.This discovery prompt can be by measuring outside patient's saliva
The conversion of the different pathological stages of the concentration monitor hickie of body is secreted, it is also possible to pass through periodic monitoring patient saliva excretion body
Concentration monitors the pathologic process that hickie is converted to carcinoma of mouth.The concentration of saliva excretion body is expected to become diagnosis hickie and oral cavity
The new method of cancer and prediction leukoplakia cancer risk, monitoring leukoplakia cancer process etc..
Summary of the invention
The present invention provides the aided diagnosis methods of a kind of repeatable implementation, easy-to-use hickie and carcinoma of mouth.Together
When, the present invention also provides a kind of method that monitoring oral leukoplakia is converted to carcinoma of mouth, including periodic monitoring oral leukoplakia are tested
The concentration of person's saliva excretion body, judges lesion state in which (stage), makes adaptable follow-up plan and therapeutic scheme.
Meanwhile the concentration by monitoring subjects saliva's excretion body, the canceration trend of oral leukoplakia is judged, finds oral cavity in time
Cancer high-risk patient, and suitable treatment is carried out to it.
Therefore, one aspect of the present invention is related to：
1. a kind of aided diagnosis method of carcinoma of mouth, the concentration including detecting oral leukoplakia subjects saliva excretion body,
Described in subjects saliva's excretion body concentration compared to normal person be remarkably decreased prompt subject oral cavity hickie be converted into carcinoma of mouth.
2. 1 aided diagnosis method, wherein the concentration of subjects saliva's excretion body is significantly increased compared to normal person,
It prompts the subject oral cavity hickie with paraplasm, needs to look over one's shoulder its development.
3. a kind of method that monitoring oral leukoplakia is converted to carcinoma of mouth, the saliva excretion including monitoring oral leukoplakia subject
The concentration of body, wherein the concentration of saliva excretion body significantly increases prompt hickie relative to normal person with paraplasm, needs tight
Close monitoring, but the concentration of saliva excretion body is remarkably decreased relative to normal person prompts oral leukoplakia from paraplasm to oral cavity
Cancer conversion.
4. a kind of prediction oral leukoplakia is to the method for carcinoma of mouth conversion risk, the saliva including monitoring oral leukoplakia subject
The concentration of excretion body, wherein the concentration of saliva excretion body significantly increases prompt oral leukoplakia relative to normal person and converts to carcinoma of mouth
Risk increase.
5. 4 method, wherein the concentration of saliva excretion body is by being relative to just relative to the significant increase transitions of normal person
Ordinary person is remarkably decreased the possibility that prompt oral leukoplakia has been converted into carcinoma of mouth from paraplasm.
6. a kind of screening method of carcinoma of mouth, the concentration including detecting subjects saliva's excretion body, wherein the subject
The concentration of saliva excretion body is remarkably decreased the possibility that prompt subject suffers from carcinoma of mouth compared to normal person.
7. the method for any one of 1-6, wherein the carcinoma of mouth is oral squamous cell carcinoma.
8. a kind of method of pathologic stage locating for auxiliary diagnosis oral leukoplakia, including detection oral leukoplakia subjects saliva
The concentration of excretion body, wherein the concentration of the saliva excretion body relative to normal person without significant difference, prompt oral leukoplakia to be in
The concentration in simple hyperplasia stage, the saliva excretion body is significantly increased relative to normal person, prompts oral leukoplakia with abnormal increasing
Raw, the concentration of subjects saliva's excretion body is remarkably decreased prompt subject oral cavity hickie compared to normal person and is converted into oral cavity
Cancer.
9. 8 method, wherein the carcinoma of mouth is oral squamous cell carcinoma.
10. the auxiliary discrimination method of doubtful oral leukoplakia, the level including miRNA185 in measurement saliva excretion body, wherein
The level is remarkably decreased the possibility that prompt subject suffers from oral leukoplakia than normal person.
11. 10 method, including being that the subject that miRNA185 level is remarkably decreased further measures to measurement result
The concentration of subjects saliva's excretion body determines pathologic stage locating for oral leukoplakia, wherein the concentration of excretion body and normal
People prompts the oral leukoplakia of the subject to be in the simple hyperplasia stage compared to no significant difference, saliva excretion bulk concentration relative to
Normal person significantly increases the oral leukoplakia of prompt subject with paraplasm, and the concentration of saliva excretion body is aobvious relative to normal person
Writing reduces, and the oral leukoplakia of subject is prompted to have been converted into the possibility of carcinoma of mouth.
12. 11 method, wherein the carcinoma of mouth is oral squamous cell carcinoma.
On the other hand, the present invention relates to：
1. the reagent or instrument that detect saliva excretion body are preparing reagent used in carcinoma of mouth aided diagnosis method or examination
Purposes in agent box or instrument, the method includes detecting the concentration of oral leukoplakia subjects saliva excretion body, wherein described
The concentration of subjects saliva's excretion body is remarkably decreased prompt subject oral cavity hickie compared to normal person and is converted into carcinoma of mouth.
2. 1 secondary purpose prompts wherein the concentration of subjects saliva's excretion body is significantly increased compared to normal person
The subject oral cavity hickie needs to look over one's shoulder its development with paraplasm.
3. the reagent or instrument that detect saliva excretion body make in the method that preparation monitoring oral leukoplakia is converted to carcinoma of mouth
Purposes in reagent or kit or instrument, the method includes monitoring the saliva excretion body of oral leukoplakia subject
Concentration, wherein the concentration of saliva excretion body significantly increases prompt hickie relative to normal person with paraplasm, needs tight
Monitoring, but the concentration of saliva excretion body is remarkably decreased relative to normal person, prompts oral leukoplakia from paraplasm to carcinoma of mouth
Conversion.
4. detecting the method for the reagent or instrument of saliva excretion body in preparation prediction oral leukoplakia to carcinoma of mouth conversion risk
Used in purposes in reagent or kit or instrument, the method includes monitoring outside the saliva of oral leukoplakia subject
The concentration of body is secreted, wherein the concentration of saliva excretion body significantly increases what prompt oral leukoplakia was converted to carcinoma of mouth relative to normal person
Risk increases.
5. 4 purposes, wherein the concentration of saliva excretion body is by being relative to just relative to the significant increase transitions of normal person
Ordinary person is remarkably decreased the possibility that prompt oral leukoplakia has been converted into carcinoma of mouth from paraplasm.
6. the reagent or instrument that detect saliva excretion body are preparing reagent or reagent used in the screening method of carcinoma of mouth
Purposes in box or instrument, the method includes detecting the concentration of subjects saliva's excretion body, wherein the subjects saliva
The concentration of excretion body is remarkably decreased the possibility that prompt subject suffers from carcinoma of mouth compared to normal person.
7. the purposes of any one of 1-6, wherein the carcinoma of mouth is oral squamous cell carcinoma.
8. detecting the side of reagent or the instrument pathologic stage locating for preparation auxiliary diagnosis oral leukoplakia of saliva excretion body
Reagent or kit used in method or the purposes in instrument, the method includes outside detection oral leukoplakia subjects saliva
Secrete the concentration of body, wherein the concentration of the saliva excretion body relative to normal person without significant difference, prompt oral leukoplakia to be in single
The concentration of pure proliferative phase, the saliva excretion body is significantly increased relative to normal person, prompts oral leukoplakia with paraplasm,
The concentration of subjects saliva's excretion body is remarkably decreased prompt subject oral cavity hickie compared to normal person and is converted into carcinoma of mouth.
9. 8 purposes, wherein the carcinoma of mouth is oral squamous cell carcinoma.
10. the method that the reagent for detecting miRNA185 level in saliva excretion body identifies doubtful oral leukoplakia in preparation auxiliary
Used in purposes in reagent or kit, the method includes the levels of miRNA185 in measurement saliva excretion body, wherein
The level is remarkably decreased the possibility that prompt subject suffers from oral leukoplakia than normal person.
11. 10 purposes, the method includes to measurement result be the subject that is remarkably decreased of miRNA185 level into
One pacing determines the concentration of subjects saliva's excretion body to determine pathologic stage locating for oral leukoplakia, and wherein excretion body is dense
Degree is compared with normal people no significant difference and the oral leukoplakia of the subject is prompted to be in the simple hyperplasia stage, and saliva excretion body is dense
Spending significantly to increase relative to normal person prompts the oral leukoplakia of subject with paraplasm, the concentration of saliva excretion body relative to
Normal person significantly reduces, and the oral leukoplakia of subject is prompted to have been converted into the possibility of carcinoma of mouth.
12. 11 purposes, wherein the carcinoma of mouth is oral squamous cell carcinoma.
On the other hand, the invention further relates to：
1. a kind of method by detecting the concentration auxiliary diagnosis carcinoma of mouth of oral leukoplakia subjects saliva excretion body is being made
Reagent used in the method for the standby auxiliary diagnosis carcinoma of mouth or the purposes in kit, the reagent or kit are with packaging
Inset, with the concentration auxiliary diagnosis carcinoma of mouth by detection oral leukoplakia subjects saliva excretion body on the package insert
The explanation of method, the method includes detecting the concentration of oral leukoplakia subjects saliva excretion body, wherein the subjects saliva
The concentration of excretion body is remarkably decreased prompt subject oral cavity hickie compared to normal person and is converted into carcinoma of mouth.
2. 1 auxiliary diagnosis purposes, wherein the concentration of subjects saliva's excretion body is significantly increased compared to normal person,
It prompts the subject oral cavity hickie with paraplasm, needs to look over one's shoulder its development.
3. a kind of concentration monitor oral leukoplakia by monitoring the saliva excretion body of oral leukoplakia subject turns to carcinoma of mouth
The method of change reagent used in preparation this method or the purposes in kit, the reagent or kit are inserted with packaging
Page, concentration monitor oral leukoplakia with the saliva excretion body by monitoring oral leukoplakia subject on the package insert is to mouth
The explanation of the method for chamber cancer conversion, the method includes monitoring the concentration of the saliva excretion body of oral leukoplakia subject, wherein saliva
The concentration of liquid excretion body significantly increases prompt hickie relative to normal person and needs to look over one's shoulder with paraplasm, but outside saliva
The concentration for secreting body is remarkably decreased relative to normal person, and oral leukoplakia is prompted to convert from paraplasm to carcinoma of mouth.
4. a kind of concentration prediction oral leukoplakia by monitoring the saliva excretion body of oral leukoplakia subject turns to carcinoma of mouth
The method reagent used in preparation this method for changing risk or the purposes in kit, the reagent or kit are with packaging
Inset, concentration prediction oral leukoplakia with the saliva excretion body by monitoring oral leukoplakia subject on the package insert to
Carcinoma of mouth converts the explanation of the method for risk, the method includes monitoring the concentration of the saliva excretion body of oral leukoplakia subject,
The risk that wherein concentration of saliva excretion body significantly increases that prompt oral leukoplakia is converted to carcinoma of mouth relative to normal person increases.
5. 4 purposes, wherein the concentration of saliva excretion body is by being relative to just relative to the significant increase transitions of normal person
Ordinary person is remarkably decreased the possibility that prompt oral leukoplakia has been converted into carcinoma of mouth from paraplasm.
6. a kind of method by detecting the concentration screening carcinoma of mouth of subjects saliva's excretion body makes in preparation this method
Purposes in reagent or kit, the reagent or kit have package insert, have on the package insert and pass through inspection
The explanation for surveying the method for the concentration screening carcinoma of mouth of subjects saliva's excretion body, the method includes detecting subjects saliva's excretion
The concentration of body, wherein the concentration of subjects saliva's excretion body, which is remarkably decreased prompt subject compared to normal person, suffers from carcinoma of mouth
Possibility.
7. the purposes of any one of 1-6, wherein the carcinoma of mouth is oral squamous cell carcinoma.
8. pathology locating for a kind of concentration auxiliary diagnosis oral leukoplakia by detecting oral leukoplakia subjects saliva excretion body
The method in stage reagent used in preparation this method or the purposes in kit, the reagent or kit are inserted with packaging
Page, with the concentration auxiliary diagnosis oral leukoplakia institute by detection oral leukoplakia subjects saliva excretion body on the package insert
The explanation for locating the method for pathologic stage, the method includes detecting the concentration of oral leukoplakia subjects saliva excretion body, wherein institute
The concentration of saliva excretion body is stated relative to normal person without significant difference, oral leukoplakia is prompted to be in simple hyperplasia stage, the saliva
The concentration of liquid excretion body is significantly increased relative to normal person, prompts oral leukoplakia with paraplasm, outside the subjects saliva
The concentration for secreting body is remarkably decreased prompt subject oral cavity hickie compared to normal person and is converted into carcinoma of mouth.
9. 8 purposes, wherein the carcinoma of mouth is oral squamous cell carcinoma.
10. a kind of method that the horizontal auxiliary by miRNA185 in measurement saliva excretion body identifies doubtful oral leukoplakia exists
Reagent used in this method or the purposes in kit are prepared, the reagent or kit have package insert, the packaging
Identify the explanation of the method for doubtful oral leukoplakia on inset with the horizontal auxiliary by miRNA185 in measurement saliva excretion body,
The method includes measurement saliva excretion body in miRNA185 level, wherein level than normal person be remarkably decreased prompt it is tested
Person suffers from the possibility of oral leukoplakia.
11. 10 purposes, the method includes to measurement result be the subject that is remarkably decreased of miRNA185 level into
One pacing determines the concentration of subjects saliva's excretion body to determine pathologic stage locating for oral leukoplakia, wherein the concentration of excretion body
Being compared with normal people no significant difference prompts the oral leukoplakia of the subject to be in simple hyperplasia stage, saliva excretion bulk concentration
The oral leukoplakia of prompt subject is significantly increased relative to normal person with paraplasm, the concentration of saliva excretion body is relative to just
Ordinary person significantly reduces, and the oral leukoplakia of subject is prompted to have been converted into the possibility of carcinoma of mouth.
12. 11 purposes, wherein the carcinoma of mouth is oral squamous cell carcinoma.
Definition
" precancerous lesion (precancerous lesion) " of the present invention, which refers to, is not cancer, but is easier to change
For a kind of disease damage of cancer.Wherein, " oral precancerous lesion " (oral precancerous/premalignant lesion, OPL)
Referring to has morphological change and the pathological change of oral cavity with canceration Potential feasibility, and clinically common is oral epithelium precancerosis
Become, such as fibroid change under clinical common hickie, erythema, lichen planus, lupus erythematosus discoides, mucous membrane, papilloma, chronic
Ulcer, mucous membrane blackspot and mole etc..
" oral leukoplakia " of the present invention is the damage betided on mucous membrane of mouth based on white, cannot be wiped,
Other definable damages cannot be diagnosed as in clinical and histopathology method, belong to precancerous lesion or potential pernicious disease
Suffer from (Potentially Malignant Disorders, PMD) scope, does not include the removal of the local factors such as smoking, local friction
The pure that can subside afterwards crosses keratosis.Oral leukoplakia of the invention is also referred to as hickie.
Oral leukoplakia can be divided into the hickie and hickie companion (having) exception of simple hyperplasia state according to its Histopathologic appearance
Hyperplasia, the former is known as the simple hyperplasia stage of hickie (simple hyperplasia), the hickie of simple hyperplasia or hickie, pathology in the present invention
It shows as：Epithelial proliferation has hyperortholeratosis or hyperparakeratosis, or both while occurring for mixing angling；Epithelium list
Pure property hyperplasia is benign lesion, shows as epithelium hyperortholeratosis, and granulosa is obvious and acanthosis, without atypical cell.On
Pi Ding dashes forward extending and thicker, but still neat and basilar memebrane is clear.There are lymphocyte, thick liquid cell leaching in lamina propria and submucosa
Profit.Hickie with paraplasm or the paraplasm stage for hickie, canceration potential with the increase of epithelial dysplasia degree and
Increase.The histopathologic change of epithelial dysplasia is：Epithelium basal cell loss of polarity；It is thin to there is one layer or more substrate sample
Born of the same parents；Caryoplasm ratio increases；Prominent epithelial peg is in drop-wise；Epithelium level disorder；Mitotic figure increases, it is seen that a small number of exceptions have silk point
It splits；There is mitosis in epithelium superficial 1/2；Cell pleomorphism；The dense dye of nucleus；Kernel increases；The decline of cell adhesion power；In spine
Single or packed cell angling in cellular layer；According to the number that above-mentioned project occurs be divided into it is light, in, severe epithelial dysplasia.
Oral precancerous lesion, such as oral leukoplakia are not cancers, but if without treating in time, and by various bad thorns
Swash, can develop into carcinoma of mouth.The histopathologic change of carcinoma of mouth is：In the squamous cell carcinoma broken up, iuntercellular is visible
Intercellular bridge may occur in which stratiform angling object in the center of cancer nests, be keratin pearl or cancer pearl.It is acerous to break up poor squamous cell carcinoma
Change pearl to be formed, or even also cell-free bridge, oncocyte is in apparent atypia and sees more Mitotic index.
" excretion body (exosome) " is shape by a series of regulation processes such as cell processes " endocytosis-fusion-outlet "
At, and can secrete to extracellular molecular diameter be 40~100nm subcellular lipid bilayer vesicle, in contain and cell origin phase
The substances such as protein, miRNA and the mRNA of pass.Excretion body both can be by the direct activated receptor cell of membrane receptor, can also be with
Transport protein matter, mRNA, miRNA even organelle enter in recipient cell, while can also carry in different pathological status
Under cell contained by special " information ", into body fluid (including saliva, blood etc.), thus on physiology and pathology all
It plays an important role.
The method for separating from body fluid and extracting excretion body is [9] known in the art, and ultracentrifugation, magnetic bead is mostly used to exempt from
The method of epidemic disease capture, precipitating or filtering, the separation of early period is carried out to excretion body.Its size and shape are analyzed using Electronic Speculum later
State analyzes cell surface marker using flow cytometer, passes through the side such as protein immunoblot (Western blot) and ELISA
Method analyzes albumen, or RNA is analyzed by qPCR and new-generation sequencing (NGS), including the objects such as detection miRNA and mRNA
Matter[10]。
" significant increase " or " significantly reducing (decline) " refers to that the degree that (decline) is raised and lowered is compared with normal people and has
Significance,statistical.
Detailed description of the invention
Fig. 1 is shown seen in the typical pathologic of H&E dyeing hickie different phase.
Fig. 2 shows normal population, and hickie simple hyperplasia, hickie are in paraplasm and oral cancer patient's pathological tissue
CAM 120/80 (E-cadherin) and vimentin (Vimentin) expression.The figure in the cancerous tissue of oral cavity as it can be seen that find
There is exception, statistical analysis discovery in CAM 120/80 and Vimentin, and Normal oral mucosa, oral leukoplakia increases merely
Raw, hickie is substantially reduced with CAM 120/80 expression in paraplasm and oral cavity cancerous tissue (early stage infiltrates), counter wave
Shape protein expression level gradually increases, and staining power is gradually increased as normal mucosa is transferred to the development of cancer, between group
Statistically significant (the P of difference<0.01).
Fig. 3 shows normal population, hickie simple hyperplasia, hickie in paraplasm and oral cancer patient's pathological tissue
The expression of PI3K/AKT access and EMT GAP-associated protein GAP.In progression by normal mucosa canceration, the phosphorylation degree of PI3K
It obviously increases, and it is the 500% of normal mucosa group that AKT expression, which gradually rises,.Document report PI3K/AKT signal path
The generation of activation induction EMT.This experimental result confirms that CAM 120/80 expression is transferred to carcinoma of mouth with normal mucosa
Develop and gradually decreases, opposite waveform expressing quantity apparent increase (P<0.001).
Fig. 4 shows oral cavity mucous membrane tissue miRNA185 in situ hybridization result.As described in Example 1, experimental analysis miR-
185 expression and expressive site in oral cavity mucous membrane tissue.As a result, it has been found that in Normal oral mucosa, it is seen that great Liang Shang
Occurs strong brown purple color reaction in chrotoplast core and packet slurry, strong positive is presented in miR-185 expression；Increase merely in oral cavity mucous membrane white spot
With in paraplasm and carcinoma of mouth case, miR-185 expression is obviously reduced raw, hickie；In carcinoma of mouth case, miR-185
It expresses and disappears in cancer epithelial tissue.
Fig. 5 A-C shows saliva excretion body qualification result.Under transmission electron microscope as it can be seen that from above-mentioned normal group, hickie group, hyperplasia
Group, carcinoma of mouth group are collected, the sample particle of purifying is uniform in size, form is consistent, rounded or oval film property vesicles form,
Visible vesica has complete coating after dyeing, inside has low electron dense object, diameter is about in 100 rans (figure
5A).It is collected by dynamic light scattering discovery, the sample size of purifying is 108nm and finds it with Gao Jing by zeta potential analysis
Negative electrical charge (Fig. 5 B).By protein immunoblot detect find these particles express excretion body specific structural proteins CD81,
CD63 or Foltillin-1 (Fig. 5 C).
Fig. 6 A-B shows that saliva excretion body carries small molecule Microrna matrix analysis result.Fig. 6 A is the results show that oral cavity is glutinous
Microrna content possessed by the excretion body of film hickie saliva differs markedly from the excretion body from Healthy People.Fig. 6 B, which is shown, to be come
From the opposite normal person of miR-185 of oral cavity mucous membrane white spot simple hyperplasia, hickie companion paraplasm, oral cancer patient's saliva excretion body
It substantially reduces.
Fig. 7 A shows nanosight analysis as a result, it is about 100 to receive that display saliva of buccal cavity excretion body high-frequency, which appears in diameter,
The particle section of rice, illustrates that excretion body size is about 100 nanometers of diameter.Fig. 7 B shows saliva of buccal cavity excretion bulk concentration in carcinoma of mouth
Dynamic change in conversion process.
Fig. 8 shows the comparison result of hickie different stages of development saliva excretion bulk concentration.
Embodiment
The change of signal of interest access in 1 oral precancerous lesion Carcinogenesis of embodiment
Method
Choosing clinical and pathological diagnosis is oral cavity mucous membrane white spot (simple hyperplasia), hickie with paraplasm and leukoplakia cancer
The tissue specimen of (oral squamous cell carcinoma) patient is as research object.The illustrative H&E of the tissue specimen dyes pathology institute
See as shown in Figure 1.
It is grouped according to pathological diagnosis result：It is divided into hickie simple hyperplasia group (N=15)；Hickie is with paraplasm group (N
=10), canceration group, also referred to as carcinoma of mouth group (N=15).
Normal group (N=5) tissue specimen is selected from and excludes oral mucosal disease, needs cut-out normal because of operative treatment
Organize and be ready to provide the tissue for research patient.
1. immunohistochemistry detects
By normal group, hickie group, paraplasm group, carcinoma of mouth group tissue samples be fixed on the formalin solution of buffering
In, slice, slice thickness is 4 μm, is directed to CAM 120/80 (E-cadherin) and waveform on tissue sections in the steps below
Albumen (Vimentin) implements immunohistochemistry detection：Be added anti-CAM 120/80 antibody (5 μ g/ml, Abcam, Cambridge,
) or anti-vimentin antibodies (1 MA:500, Abcam, Cambridge, MA), 4 DEG C of conditioned responses are stayed overnight, then at room temperature,
With Alexa568 goat anti-rabbit iggs (1:1000, Invitrogen, Carlsbad, CA) and Alexa
488 goat anti-mouse IgGs (1:1000, Invitrogen, Carlsbad, CA) it incubates 1 hour.Next, by cell sealing in
In Vectashield sealing solution (Vector Laboratories, Burlingame, CA) containing DAPI, and by confocal
Laser microscope (LSM510, Carl Zeiss Co.Ltd, Jena, Germany) is checked.
2. protein immunoblot (Western blot)
It is from the sample dissociation object (10 μ g) of histotomy protein isolate immunoblotting and enterprising in 10-12%SDS-PAGE glue
Row immunoprecipitation then uses anti-CAM 120/80 (1:500；Abcam, Cambridge, MA) antibody, anti-vimentin (1:
500；Abcam) antibody, anti-phosphorylation AKT (1:5000；Abcam) antibody or anti-phosphorylation PI3K (1:500；Abcam) antibody into
Row immunoblotting is exposed to X-ray film (Amersham Biosciences, Piscataway, NJ, USA) after dry.Removing
Above-mentioned trace and with anti-beta-actin (1:2,000；Abcam it) incubates to confirm that the sample size loaded in each experiment is identical.
3. in situ hybridization positions miR-185 expression
By miR-185 or control sequence in 1X in situ hybridization (ISH) buffer (Exiqon Inc., Woburn, MA USA)
Column probe (Exiqon Inc.) hybridizes 60 minutes with fixed histotomy at 55 DEG C, is then buffered using the SSC of various concentration
Liquid is washed at 55 DEG C.Such as following detection probes：Use the anti-digoxin alkaline phosphatase antibodies (1 of monoclonal:800)(Roche,
Indianapolis, IN USA) it incubates 60 minutes, then under the conditions of 30 DEG C, use nitro blue tetrazolium and the chloro- 3'- of the bromo- 4- of 5-
Polyphosphate substrate (Roche) incubates 2 hours.Finally, it is sliced, is used using Nuclear Fast RedTM counterstainCulture medium (VWR, Radnor, PA) sealing, and pass through Laser Scanning Confocal Microscope inspection.
As a result
1. immunohistochemistry testing result is shown, from normal group, hickie simple hyperplasia group, hickie with paraplasm group to oral cavity
Cancer group, the staining power of CAM 120/80 gradually lowers in sample tissue, and the staining power of vimentin gradually increases, poor between group
Different statistically significant (P<0.05), referring to fig. 2.
Oral leukoplakia is the most common mucous membrane of mouth pre-malignant lesion.Oral leukoplakia passes through during converting to carcinoma of mouth
The process of mucous membrane paraplasm is gone through, pathological manifestations are transition (EMT) of the epithelial tissue form to interstitial tissue form.In the process
Middle epithelial cell obtains mesenchyma, fibroblast sample feature, and intercellular adhesion declines, movement enhancing.
The important molecule event of EMT is the up-regulation of the lower reconciliation vimentin of CAM 120/80.Experiment discovery from hickie group,
Paraplasm group is to carcinoma of mouth group, and the staining power of CAM 120/80 gradually lowers in sample tissue, and the dyeing of vimentin is strong
Degree gradually increases, and the generation during converting from hickie to carcinoma of mouth with EMT event is proved from molecular level.These realities
The clinic of the patient of the discovery and such laboratory sample source tested on the molecular level of sample and pathological diagnosis match.
2. protein immunoblot (Western blot) experiment discovery, from normal group, hickie group, paraplasm group to oral cavity
The phosphorylation degree of cancer group, PI3K obviously increases, and AKT phosphorylation level gradually rises the 500% (P for normal mucosa group<
0.01), CAM 120/80 expression gradually decreases, opposite waveform expressing quantity apparent increase (P<0.001), see Fig. 3.
It is abnormal to find that CAM 120/80 and Vimentin occur in the cancerous tissue of oral cavity, statistical analysis discovery, normally
Mucous membrane of mouth, oral leukoplakia simple hyperplasia, hickie is with CAM 120/80 in paraplasm and oral cavity cancerous tissue (early stage infiltrates)
Expression is substantially reduced, and opposite waveform protein expression level gradually increases, and staining power is transferred to cancer with normal mucosa
The development of disease and gradually increase, the statistically significant (P of group difference<0.01).
In EMT signal path, the activation of PI3K/AKT axis is its main feature.Protein blot experiment confirm from hickie to
In the progression of carcinoma of mouth, the phosphorylation degree of PI3K and AKT are obviously increased, and PI3K/AKT axis is activated, CAM 120/80
It lowers, vimentin up-regulation occurs with EMT.Discovery and such laboratory sample on the molecular level of these laboratory samples come
The clinic of the patient in source and pathological diagnosis match.
3. in situ hybridization positions miR-185 expression experiment and finds that strong positive (purple is presented in miR-185 expression in normal group sample
Color)；In hickie group sample, miR-185 expression is obvious to be weakened, and visible few portion in paraplasm group and carcinoma of mouth group sample
Divide in epithelial nucleus and packet slurry and slight brown purple color reaction occur, miR-185, which is expressed, is presented slight positive or miR-185 table
Up to almost disappearing, Fig. 4 is seen.
Recently, a variety of miRNA for being directly targeted EMT transcription factor and structural components of cells are had reported.Above-mentioned experiment knot
Fruit discovery, hickie simple hyperplasia group, hickie are compared just with paraplasm group with the level of miR-185 in carcinoma of mouth group Patient Sample A
Often control is remarkably decreased.
In conclusion experiment discovery turns from oral leukoplakia simple hyperplasia to oral cavity mucous membrane white spot with paraplasm, carcinoma of mouth
During change, 3K/AKT-mTOR Pathway Activation, EMT occurs, while miR-185 expression decline even lacks.
2 saliva of buccal cavity excretion body of embodiment carries miR-185, consistently reacts oral precancerous lesion process
Method
Excretion body：Oral cavity mucous membrane white spot (simple hyperplasia), hickie companion are suffered from from the clinic of above-described embodiment 1 and pathological diagnosis
Collected as follows in (having) paraplasm, the patient of carcinoma of mouth (oral squamous cell carcinoma) and normal person's saliva of buccal cavity,
Purify saliva of buccal cavity excretion body.
Above-mentioned patient or normal person do not gargle before taking saliva, and fasting water 1 hour.Seat when taking saliva, head is naturally low,
Saliva spues into disposable pallet naturally in mouthful, about 2 milliliters or so, not cough.By the saliva of collection be immediately placed in it is small from
In heart pipe, 4 DEG C of preservations.
By 4 DEG C of sample, 410,000 × g is centrifuged 20 minutes removing microcapsule bubbles (microvesicle), and supernatant passes through 0.22
μm membrane filtration it is secondary, with Ti70 fixed angle ultracentrifuge (Beckman Coulter, Brea, CA, US) with 100,
000 × g is centrifuged to obtain excretion body set group, and washed once with PBS, then with DEG C centrifugation of 100,000 × g, 41 hour, is then
When for test or -80 DEG C save backup.
1. saliva excretion body is identified
(1) the morphological feature observation of excretion body
It takes 20 μ l drop of excretion body suspension on the load sample copper mesh of aperture 2nm, stands 10 minutes at room temperature, with filter paper from strainer
Liquid is blotted in side, and 3% Salkowski's solution, 30 μ l is added dropwise, redyes 5 minutes under room temperature environment, is blotted with filter paper and redye liquid, and
After drying at room temperature, this copper mesh is placed in the sample room of transmission electron microscope, observe excretion volume morphing and shoots electromicroscopic photograph.
(2) saliva excretion body Characters Identification
The size and film potential of excretion body are measured by dynamic light scattering and eletrokinetic potential analyzer.
(3) analysis of excretion body specific structural proteins
15% separation gel and 5% concentration glue are prepared, takes 40 μ l of excretion body suspension to mix with 10 μ l of 5XSDS sample-loading buffer and boils
Boiling 5 minutes, be added in gel loading hole, be concentrated glue constant pressure 80V, separation gel constant pressure 120V, 200mA constant current 1.5 hours.By gel
In protein be transferred on nitrocellulose filter by wet robin, at room temperature with containing 5% skim milk confining liquid closing at
1h is managed, after the elution of 1XTBST buffer, it is anti-under the conditions of 4 DEG C that 1 monoclonal antibody of CD81, CD63 and Flottilin is added
It should stay overnight, after eluting again, the goat-anti rabbit secondary antibody of horseradish peroxidase-labeled is added, gently shake 1h at room temperature.Through
After 1XTBST buffer washes film 3 times, detected with chemiluminescent substrate (ECL, Thermo Fisher Scientific.).
2. saliva excretion body carries the matrix analysis of small molecule Microrna
It is extracted always using microRNeasy Plus kit (Qiagen, Valencia, CA USA) from saliva excretion body
RNA, and reverse transcription is carried out using miScript II RT kit (Qiagen) according to the manufacturer's instructions.According to manufacturer
The transcript that is obtained by Microrna matrix analysis of specification and verified by qRT-PCR.QRT-PCR is standardized
To U6snRNA primer.
As a result
1. as it can be seen that being collected from above-mentioned normal group, hickie group, paraplasm group and carcinoma of mouth group, purifying under transmission electron microscope
Sample particle is uniform in size, form is consistent, rounded or oval double adipose membrane vesicles forms, there is visible vesica after dyeing
Complete lipid bilayer membrane structure, inside has low electron dense object, diameter is about in 100 rans, referring to Fig. 5 A.
It is collected by dynamic light scattering discovery, the sample size of purifying is 108 nanometers, and is found by zeta potential analysis
It is with high net negative charge, referring to Fig. 5 B.
By protein immunoblot detect find these particles express excretion body specific structural proteins CD81, CD63 or
Foltillin-1, referring to Fig. 5 C.
2. we are had found for the first time from oral cavity mucous membrane white spot (simple hyperplasia), hickie with exception by Microrna matrix
Hyperplasia, oral cancer patient's saliva excretion body possessed by Microrna content differ markedly from the excretion body from normal person, join
See Fig. 6 A.From oral cavity mucous membrane white spot (simple hyperplasia), hickie with paraplasm, oral cancer patient saliva excretion body
MiR185 (nucleotide sequence：5 ' uggagagaaaggcaguuccuga 3 ') it is remarkably decreased with respect to normal person, referring to Fig. 6 B.This
It was found that showing that excretion body carries miR-185 disease information, it is present in saliva, to detect the miR- of saliva excretion body carrying
185 can be used to distinguish normal and suffer from suffering from oral disease, described for example white with mucous membrane of mouth with suffering from oral disease
Spot (simple hyperplasia), hickie are with paraplasm, oral cancer patient.
Dynamic change of the 3 saliva of buccal cavity excretion body of embodiment in carcinoma of mouth conversion process
Method
Quantitative analysis is carried out by the following method to the saliva excretion body collected, purified in above-described embodiment 2.
The saliva excretion body sample of purifying passes through NanoSight nano particle follow-up analysis (Malvern
Instruments, Westborough, MA) assessment excretion body size and frequency.
By using NanoSight NS300 instrument (2.3 Nanoparticle Tracking of NanoSight NTA
And Analysis Release Version Build 0025) implement nano particle follow-up analysis.It is fast by using being equipped with
NanoSight LM10 system (NanoSight, Wiltshire, the United of fast video capture and particle Trancking Software
Kingdom it) measures the rate of Brownian movement and then analyzes the size distribution of excretion body prepared product and it is quantified.The 1 of 400 μ l
Purified excretion body is diluted in × PBS/5mM EDTA solution, sample injection is entered into the sample room NanoSight later, is determined outer
Secrete the average value ± SD size distribution of body.
As a result
Research confirms that the excretion body for carrying Microrna s is discharged into saliva, and contains with the generation of disease, development
The dynamic change of amount, as shown in Figure 7.Hickie (simple hyperplasia) patient carries excretion body content relative to normal person in saliva
There is no significant difference；And disease is developed to hickie with the paraplasm stage, the excretion body content carried in saliva significantly rises
Height is compared with normal person is presented significant difference；And canceration once occurs, excretion body, which is carried, after being converted into carcinoma of mouth, in saliva contains
Amount declines instead, declines degree with normal person and compares significant difference, has statistical significance.Excretion body content is carried in saliva
The dynamic change mistake declined afterwards is first increased as hickie (simple hyperplasia) is totally presented one to the development of paraplasm, canceration
Journey, referring to Fig. 7.The content of saliva excretion body changes with the simple hyperplasia of hickie to the variation of paraplasm and canceration, undoubtedly
Can be used to indicate pathological development and the variation of disease, auxiliary oral cavity mucous membrane white spot (simple hyperplasia), hickie with paraplasm and
The diagnosis of carcinoma of mouth.
In addition, since the content of saliva excretion body changes with the variation of oral cavity mucous membrane white spot disease pathology, thus available
Come the pathological development process of the dynamic monitoring disease, the patient of early detection oral cavity canceration.
On the other hand, due to carrying excretion body content in saliva as hickie simple hyperplasia is to paraplasm, the hair of canceration
The dynamic changing process that exhibition presentation first raising (referring to Fig. 8 A) declines (referring to Fig. 8 B) afterwards records the saliva of patient by monitoring
The content of excretion body it is also predicted that oral cavity carcinogenesis risk, if excretion body content, which persistently increases, implies oral cavity canceration
Risk is gradually increased (Fig. 8 A), if the content of excretion body switchs to decline (Fig. 8 B) from raising, prompts hickie lesion that cancer has occurred
A possibility that change.
The content of saliva excretion body can also be applied to clinical diagnosis antidiastole in conjunction with the detection of above-mentioned miR-185.Such as
Upper described, the excretion body being discharged into saliva carries miRNAs, and passes through the study found that the patient of hickie (simple hyperplasia), white
Spot is remarkably decreased with the miR-185 that saliva excretion body in the patient and oral cancer patient of paraplasm carries than normal person, is had
Statistical significance.This discovery can be used to separate normal person and the patient with hickie, paraplasm or carcinoma of mouth.For example,
During physical examination or mouth disease screening, can not judge subject's mucous membrane to be normal or when with hickie, can detecte by
MiR-185 is horizontal in examination person's saliva excretion body, if under miR-185 level is more significant than normal person in subjects saliva's excretion body
Drop prompts subject to suffer from hickie, to have auxiliary diagnosis meaning to hickie suspected patient.
If miR-185 level is remarkably decreased than normal person in subjects saliva's excretion body, need to further determine that described
Pathologic stage locating for hickie and when carrying out canceration risk assessment to it, can measure outside subjects saliva as further described above
Secrete body content.If saliva excretion body content, without significant difference, prompts patient to suffer from hickie (simple hyperplasia) relative to normal person；
If saliva excretion body content is significantly increased relative to normal person, show hickie with paraplasm, and it is aobvious relative to normal person
Writing reduces, and prompts hickie that canceration occurs.
Bibliography：
1.Noguti J,De Moura CF,De Jesus GP,et al.Metastasis from oral cancer:
an overview.Cancer Genomics Proteomics 2012；9:329-35.
2.Lingen MW,Pinto A,Mendes RA,et al.Genetics/epigenetics of oral
premalignancy:current status and future research.Oral Dis 2011；17Suppl 1:7-
22.
3.Nogami T,Kuyama K,Yamamoto H.Histopathological and
immunohistochemical study of malignant transformation of oral leukoplakia,
with special reference to apoptosis-related gene products and proliferative
activity.Acta Otolaryngol 2003；123:767-75.
4.Thompson L.World Health Organization classification of tumours:
pathology and genetics of head and neck tumours.Ear Nose Throat J 2006；85:74.
It is looked into and risk assessment [J/CD] China dentistry research magazine (electricity 5. the clinic of woods plum oral precancerous lesion is picked up
Sub- version), 2008,2 (5)：427-430.
6. the hilllock Jiang Jin, present Research [J] clinic medical officer's magazine of the tight ball oral precancerous lesion marker that shakes, 2006,34
(2)：224-227.2006 the 2nd phase of volume 34 April in year：224-227.
7.Mendez E, Cheng C, Farwell DG, et al.Transcriptional
Expressionprofiles of oral squamous cell carcinomas [J] .Cancer, 2002,95 (7)：
1482-1494.
It is looked into and risk assessment [J/CD] China dentistry research magazine (electricity 8. the clinic of woods plum oral precancerous lesion is picked up
Sub- version), 2008,2 (5)：427-430.
9.Witwer KW,Buzás EI,Bemis LT,et al.Standardization of sample
collection,isolation and analysis methods in extracellular vesicle research.
[J].J Extracell Vesicles,2013,27:2.
10.Kim KM,Abdelmohsen K,Mustapic M,et al.RNA in extracellular
vesicles.[J].Wiley Interdiscip Rev RNA.2017,doi:10.1002/wrna.1413.
Claims (10)
1. a kind of aided diagnosis method of carcinoma of mouth, the concentration including detecting oral leukoplakia subjects saliva excretion body, wherein institute
The concentration for stating subjects saliva's excretion body is remarkably decreased prompt subject oral cavity hickie compared to normal person and is converted into carcinoma of mouth.
2. the aided diagnosis method of claim 1, wherein the concentration of subjects saliva's excretion body significantly rises compared to normal person
Height prompts the subject oral cavity hickie with paraplasm, needs to look over one's shoulder its development.
3. a kind of method that monitoring oral leukoplakia is converted to carcinoma of mouth, the saliva excretion body including monitoring oral leukoplakia subject
Concentration, wherein the concentration of saliva excretion body significantly increases prompt hickie relative to normal person with paraplasm, needs tightly to supervise
Depending on, but the concentration of saliva excretion body is remarkably decreased relative to normal person, and oral leukoplakia is prompted to turn from paraplasm to carcinoma of mouth
Change.
4. a kind of prediction oral leukoplakia is to the method for carcinoma of mouth conversion risk, the saliva excretion including monitoring oral leukoplakia subject
The concentration of body, wherein the concentration of saliva excretion body significantly increases the wind that prompt oral leukoplakia is converted to carcinoma of mouth relative to normal person
Danger increases.
5. method for claim 4, wherein the concentration of saliva excretion body by relative to the significant increase transitions of normal person be relative to
Normal person is remarkably decreased the possibility that prompt oral leukoplakia has been converted into carcinoma of mouth from paraplasm.
6. a kind of screening method of carcinoma of mouth, the concentration including detecting subjects saliva's excretion body, wherein the subjects saliva
The concentration of excretion body is remarkably decreased the possibility that prompt subject suffers from carcinoma of mouth compared to normal person.
7. the method for any one of claim 1-6, wherein the carcinoma of mouth is oral squamous cell carcinoma.
8. a kind of method of pathologic stage locating for auxiliary diagnosis oral leukoplakia, including detection oral leukoplakia subjects saliva excretion body
Concentration, wherein the concentration of the saliva excretion body relative to normal person without significant difference, prompt oral leukoplakia to be in simple and increase
Raw stage, the concentration of the saliva excretion body are significantly increased relative to normal person, prompt oral leukoplakia with paraplasm, described
The concentration of subjects saliva's excretion body is remarkably decreased prompt subject oral cavity hickie compared to normal person and is converted into carcinoma of mouth.
9. the auxiliary discrimination method of doubtful oral leukoplakia, the level including miRNA185 in measurement saliva excretion body, the wherein water
It is flat that the possibility that prompt subject suffers from oral leukoplakia is remarkably decreased than normal person.
10. method for claim 9, including being that the subject that miRNA185 level is remarkably decreased further measures to measurement result
The concentration of subjects saliva's excretion body determines pathologic stage locating for oral leukoplakia, wherein the concentration of excretion body and normal person
The oral leukoplakia of the subject is prompted to be in the simple hyperplasia stage compared to no significant difference, saliva excretion bulk concentration is relative to just
Ordinary person significantly increases the oral leukoplakia of prompt subject with paraplasm, and the concentration of saliva excretion body is significant relative to normal person
It reduces, the oral leukoplakia of subject is prompted to have been converted into the possibility of carcinoma of mouth.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710330835.7A CN108872578B (en) | 2017-05-11 | 2017-05-11 | Novel method for diagnosing and monitoring oral cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710330835.7A CN108872578B (en) | 2017-05-11 | 2017-05-11 | Novel method for diagnosing and monitoring oral cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108872578A true CN108872578A (en) | 2018-11-23 |
| CN108872578B CN108872578B (en) | 2021-07-02 |
Family
ID=64319519
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710330835.7A Active CN108872578B (en) | 2017-05-11 | 2017-05-11 | Novel method for diagnosing and monitoring oral cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108872578B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108753726A (en) * | 2018-06-11 | 2018-11-06 | 西南医科大学 | A kind of excretion body and its preparation method and application containing ECRG4 mRNA |
| CN111374642A (en) * | 2020-03-24 | 2020-07-07 | 傅建华 | Instrument for deep visual oral mucosa disease observation and oral cancer screening |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103119447A (en) * | 2010-09-24 | 2013-05-22 | 勒芬天主教大学 | Cancer phospholipidome |
| WO2015089316A1 (en) * | 2013-12-12 | 2015-06-18 | Cornell University | Methods for preventing and treating oral cancers |
| WO2015183018A1 (en) * | 2014-05-28 | 2015-12-03 | 재단법인 의약바이오컨버젼스연구단 | Nanoparticles comprising aminoacyl trna synthetase and anticancer composition comprising same |
| WO2016079194A1 (en) * | 2014-11-20 | 2016-05-26 | Stichting Katholieke Universiteit | A novel auto-active and intracellular mutant of met |
| CN105675774A (en) * | 2016-01-19 | 2016-06-15 | 上海交通大学 | Preparation method of saliva extracellular vesicles and application of saliva extracellular vesicles to molecular diagnosis |
-
2017
- 2017-05-11 CN CN201710330835.7A patent/CN108872578B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103119447A (en) * | 2010-09-24 | 2013-05-22 | 勒芬天主教大学 | Cancer phospholipidome |
| WO2015089316A1 (en) * | 2013-12-12 | 2015-06-18 | Cornell University | Methods for preventing and treating oral cancers |
| WO2015183018A1 (en) * | 2014-05-28 | 2015-12-03 | 재단법인 의약바이오컨버젼스연구단 | Nanoparticles comprising aminoacyl trna synthetase and anticancer composition comprising same |
| WO2016079194A1 (en) * | 2014-11-20 | 2016-05-26 | Stichting Katholieke Universiteit | A novel auto-active and intracellular mutant of met |
| CN105675774A (en) * | 2016-01-19 | 2016-06-15 | 上海交通大学 | Preparation method of saliva extracellular vesicles and application of saliva extracellular vesicles to molecular diagnosis |
Non-Patent Citations (13)
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108753726A (en) * | 2018-06-11 | 2018-11-06 | 西南医科大学 | A kind of excretion body and its preparation method and application containing ECRG4 mRNA |
| CN108753726B (en) * | 2018-06-11 | 2020-10-09 | 西南医科大学 | Exosome containing ECRG4mRNA and preparation method and application thereof |
| CN111374642A (en) * | 2020-03-24 | 2020-07-07 | 傅建华 | Instrument for deep visual oral mucosa disease observation and oral cancer screening |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108872578B (en) | 2021-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Weng et al. | Extracellular vesicles, the cornerstone of next-generation cancer diagnosis? | |
| JP6712737B2 (en) | Biomarker, disease-related gene search method, and renal cancer marker | |
| KR20200139117A (en) | Method for Diagnosing a Disease Using Morphology of Luterial | |
| Lin et al. | Label-free diagnosis of breast cancer based on serum protein purification assisted surface-enhanced Raman spectroscopy | |
| Liu et al. | Gold nanopyramid arrays for non-invasive surface-enhanced Raman spectroscopy-based gastric cancer detection via sEVs | |
| EP2596348B1 (en) | System and method for analyzing samples labeled with 5, 10, 15, 20 tetrakis (4-carboxyphenyl) porphine (tcpp) | |
| CN108872578A (en) | A kind of new method of diagnosis and monitoring carcinoma of mouth | |
| CN107741416B (en) | SERS (surface enhanced Raman scattering) probe and substrate marked by multiple antibodies as well as preparation method and application of SERS probe and substrate | |
| US11092550B2 (en) | Method for identification of low grade cervical cytology cases likely to progress to high grade/cancer | |
| Shi et al. | Discovery of extracellular vesicle-delivered miR-185-5p in the plasma of patients as an indicator for advanced adenoma and colorectal cancer | |
| Cai et al. | Serum fingerprinting by slippery liquid-infused porous SERS for non-invasive lung cancer detection | |
| Jonak et al. | Analyzing bronchoalveolar fluid derived small extracellular vesicles using single-vesicle SERS for non-small cell lung cancer detection | |
| EP2984487B1 (en) | Method for estimating the risk of dysplasia progressing to cancer in a subject | |
| CN115656083A (en) | Extracellular vesicle nano infrared spectrum detection device for tumor detection and malignancy and metastatic evaluation and application | |
| Lundgren et al. | Exfoliative cytology in laryngology: Comparison of cytologic and histologic diagnoses in 350 microlaryngoscopic examinations–A prospective study | |
| CN110527726A (en) | The excretion body detection device and application for detecting for non-small cell lung cancer and judging by stages | |
| WO2021213298A1 (en) | Immunofluorescence kit for detecting ca199 expression of peripheral blood circulating tumor cells of pancreatic cancer patient and detection method | |
| Lee et al. | Early-stage diagnosis of bladder cancer using surface-enhanced Raman spectroscopy combined with machine learning algorithms in a rat model | |
| O'Dea | Raman microspectroscopy for the discrimination of thyroid and lung cancer subtypes for application in clinical cytopathology | |
| EP4122598B1 (en) | A system for dissociation of solid biopsy and a method for inspection | |
| WO2020233572A1 (en) | Polypeptide magnetic nanoparticle, preparation method therefor and use thereof | |
| RU2065167C1 (en) | Method of diagnosis of vulva precancerous state | |
| Yesilay et al. | 4.2 SERS in label-free detection of cancer from proteins, cells, and tissues | |
| EP2783011B1 (en) | Methods for detecting of benign conditions | |
| Kerr et al. | Methodologies and considerations for bladder cancer detection with raman based urine cytology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |