CN108866120A

CN108866120A - Method for preparing L-ribose based on L-arabinose

Info

Publication number: CN108866120A
Application number: CN201710325540.0A
Authority: CN
Inventors: 金政会; 沈宇用; 吕寅锡
Original assignee: Korea Advanced Institute of Science and Technology KAIST
Current assignee: Korea Advanced Institute of Science and Technology KAIST
Priority date: 2017-05-10
Filing date: 2017-05-10
Publication date: 2018-11-23

Abstract

The present invention relates to a method for producing L-ribose based on L-arabinose, and more particularly, to a method for producing L-ribose based on L-arabinose, which comprises the steps of culturing a first microorganism introduced from a L-ribose production pathway from arabinose in a medium containing arabinose to produce L-ribose, removing the first microorganism from the medium, inoculating a second microorganism introduced into a L-ribulose metabolic pathway, culturing the second microorganism, consuming L-arabinose and L-ribulose, and recovering L-ribose produced, wherein the method for producing L-ribose according to the present invention removes all sugars except L-ribose by metabolism, thereby producing L-ribose with high purity in a fermentation product, and wherein the ribose produced is useful as a synthetic raw material for various L-type ribonic acid pharmaceuticals and the like, and is useful for the production of pharmaceuticals and the like.

Description

The production method of L- ribose based on L-arabinose

Technical field

The present invention relates to a kind of production method of L- ribose (L-ribose) more particularly to a kind of L- ribose (L-ribose) High-purity production method comprising：It (a), will in the culture medium for including L-arabinose (L-arabinose) as carbon source The first microorganism for importing L- ribulose (L-ribulose) and L- ribose (L-ribose) production ways is cultivated, and generates The step of L- ribulose and L- ribose；(b) after removing above-mentioned first microorganism in above-mentioned culture medium, L- ribulose generation will be imported The second microorganism for thanking to approach is inoculated with and is cultivated, and the step of consuming L-arabinose and L- ribulose；And it (c) will be upper The step of stating L- ribose produced recycling.

Background technique

Synthesis material substance of the L- ribose (L-ribose) as many L-type nucleotide sugar pharmaceuticals, it is disease-resistant for synthesizing Toxic agent, that is, methyl-L- ribofuranoside (methyl-L-riboflanoside；" Bezimidavir " TM), thus L- ribose and The world market valence of its derivative was once 1,100,000,000 dollars in 2001, was also used as novel anti-herpesvirus medicine recently (Antiherpes) BW1263W (Glaxo Wellcome) developed the and L-FMAU as the exploitation of B-mode property hepatitis treatment medicine (Bukwang&Triangle) etc. core intermediary uses, and its rush of demand, so that developing one kind can industrially utilize Production method become this field Many researchers concern object.

L- ribose mainly utilizes L-arabinose, L- xylose, D-Glucose, D- galactolipin, D-ribose or D-MANNOSE -1, 4- lactone produces (Akagi, M., et al., Chem.Pharm.Bull. (Tokyo) 50 by chemical synthesis:866,2002； Takahashi,H.,et al.,Org.Lett.4:2401,2002；Yun,M.,et al.,Tetrahedron Lett.46: 5903,2005).However chemical synthesis process there is a problem of in its production process it is various serious.It is high requirement has actually been caused Risk in terms of the working environment of temperature and high pressure needs complicated L- ribose due to the carbohydrate that incidentally generates after chemical reaction Separation and subtractive process, and its chemical refuse that generates in the process cause environmental pollution the problems such as.

In order to overcome defect as described above, the research of the biological production method of following L- ribose had once been carried out.Tool Body is said, is originated from the Arabinose isomerase of Klebsiella pneumoniae (Klebsiella pneumoniae), is originated from Amur vacation unit cell The L- rhamnoseisomerase (L-rhamnose isomerase) of bacterium (Pseudomonas stutzeri) is originated from rust brown strepto- The D- xylose isomerase (D-xylose isomerase) of bacterium (Streptomyces rubiginosus) and be originated from lactic acid cream Glucose-6-phosphate isomerase (the galactose-6-phosphate of coccus (Lactococcus lactis) Isomerase) there is extensive substrate specificity, so as to which L- ribulose is converted into L- ribose, but its conversion speed is very slow.

Also, using the engineering of enzymatic (Enzymatic) method, exists and need high-purity substrate (since enzyme has extensively Substrate specificity), small scale, enzyme it is unstable (even if immobilised enzymes L- sugar produces 50% or more enzyme internal loss in 2-3 days Activity) the shortcomings that, if chemical synthesis, exist even if using high-purity substrate, it is also difficult to ensure that L- solid is Non-specific, therefore essence Expense processed rises and product the shortcomings that becoming high price.

In contrast, using the engineering of fermentation method, have and can be used as the inexpensive substrate (biomass water that substrate utilizes low-purity Solution), substantially using the conversion of desmoenzyme therefore it is easy to ensure that L- stereospecificity, and using passing through amberlite The advantages of economic method for refining of rouge cheap can produce product, and Fermentation Engineering is the safety engineering of normal temperature and pressure.

Therefore, the biomass acidolysis object of the rare sugar of high price pentose L- can be used directly without purification, and utilized low The substrate (sugar alcohols such as L-arabinose, D-xylose or xylitol, arabitol) of valence passes through large-duty fermentation method Produce the sugared Switching Core technology of the rare sugar of L-, it will the key as the rare sugar production project of L-.

It is particularly based on the raw material i.e. L- ribose of the pharmaceuticals of L- nucleosides, if using fermentation method with 500 dollars of per kilogram or less For seasonable, not only close environment, and the chemical fabrication supplied than 2000 dollars of present per kilogram has enough competitiveness.

To the inventors have found that producing L- core from arabinose using the microorganism of tool L- ribose biosynthesis pathway Sugar, and when by-product of other microorganisms removal of utilization tool L- ribulose metabolic pathway in addition to L- ribose, it is able to produce height Purity L- ribose, so as to complete the present invention.

It is intended merely to improve the understanding to background of the present invention in the above content that the background technique part is recorded, it is possible to no Including first technology known for the people for having the usual knowledge of technical field.

Summary of the invention

The purpose of the present invention is to provide a kind of production methods of L- ribose.

Another object of the present invention is to provide a kind of weights imported from the approach of L-arabinose biosynthesis L- ribose Group microorganism.

Another object of the present invention is to provide a kind of recombinant microorganism for importing L- ribulose metabolic pathway.

To achieve the above object, the present invention provides a kind of production method of L- ribose (L-ribose) comprising：(a) exist It include that L- ribulose (L-ribulose) and L- will be imported in the culture medium of L-arabinose (L-arabinose) as carbon source First microorganism of ribose (L-ribose) production ways is cultivated, and the step of generating L- ribulose and L- ribose；(b) exist After removing above-mentioned first microorganism in above-mentioned culture medium, the second microorganism for importing L- ribulose metabolic pathway is inoculated with simultaneously Culture, and the step of consuming L-arabinose and L- ribulose；And (c) by above-mentioned L- ribose generated recycle the step of.

The present invention also provides a kind of Candida spps for having arabinose catabolism ability, have imported encoding arabinose sugar Gene, the encoding arabinose isomerase (arabinose of transport protein (arabinose transporter protein) Isomerase the gene of gene and encoding ribose isomerase (ribose isomerase)).

The present invention also provides a kind of Candida spps for having ribulose metabolic capability, have imported encoding arabinose sugar and have turned Transport gene, the encoding arabinose isomerase (arabinose of albumen (arabinose transporter protein) Isomerase the gene and coding L- core of gene, encoding ribulose phosphorylase kinase (L-ribulose kinase)) Ketose-5- phosphatase 24-epimerase (L-ribulose-5-phosphate-4-epimerase) gene.

L- ribose production method according to the present invention has by being metabolized removal except all carbohydrates of L- ribose, therefore from Tunning makes the effect of high-purity L-ribose, and L-type nucleotide sugar medicine of the above-mentioned ribose produced as multiplicity The synthetic raw material of product, when making pharmaceuticals etc. beneficial to using to highly beneficial.

Detailed description of the invention

Fig. 1 is the skeleton diagram of the approach from arabinose catabolism L- ribose imported in the diagram present invention.

Fig. 2 is the skeleton diagram of diagram L- ribose production method of the invention.

A is the expression casette for importing STP2 gene (to illustrate to import position), 23K AraA and RI gene in Fig. 3 Concept map, B as the polymerase chain reaction (PCR) for confirm the gene of importing as a result, Control is control group, STP2, There is not band (band) to confirm no gene in the polymerase chain reaction result of 23K AraA, RI；Confirm is experiment Group passes through conversion (transformation) experimental verification STP2,23K AraA, RI polymerase chain reaction result band (band) Correct position is appeared in, and shows that channel genes are good.

In Fig. 4 A be import STP2 gene, the concept map of the expression casette of AraA, AraB and AraD gene, B are confirmations The result of the gene of importing.

Fig. 5 be illustrate by Candida tropicalis import STP2 gene and 23K AraA gene, RI gene bacterial strain Ah Draw cultivated in culture medium contained by uncle's sugar and the curve graph of result that is measured of the L- ribose output that produces.

(A) of Fig. 6 is to illustrate to survey the amount of the L- ribose of the production of two step engineerings through the invention in culture medium The curve graph of fixed result, (B) are to illustrate the result that the sample liquids of each incubation step are passed through to liquid chromatography (LC) analysis Curve graph.

Specific embodiment

As long as no other definition, whole technology as used in this specification and scientific terms have belonging to the present invention The skilled expert of technical field is generally understood the identical meaning.Usual nomenclature as used in this specification is the art It is known and usually used.

The present invention will confirm, from after the micro-organisms L- ribose for importing L- ribose production ways, be removed with secondary fermentation When by-product, whether the purity of L- ribose is improved.

The present invention has carried out two step Fermentation Engineerings, imports in the first bacterial strain of Mycotoruloides with L-arabinose (L- Arabinose) original substrate produces the metabolic pathway of L- ribose (L-ribose) by L- ribulose (L-ribulose), from And from after biomass acidolysis object production L- ribose and L- ribulose, L-arabinose (L- is imported in the second bacterial strain of Mycotoruloides Arabinose) and the biodegradable metabolic pathway of L- ribulose (L-ribulose), the L-type by-product in addition to removing L- ribose Object sugar.As a result, the purity (purity) of L- ribose of the confirmation by the production of above-mentioned two steps Fermentation Engineering greatly improves.

I.e., encoding arabinose saccharide transporter (arabinose transporter has been imported in one embodiment of the invention Protein the gene and encoding ribose isomery of gene, encoding arabinose isomerase (arabinose isomerase)) The gene of enzyme (riboseisomerase), and by the first Candida tropicalis (Candida with arabinose catabolism ability Tropicalis) bacterial strain is cultivated in the culture medium for including arabinose as carbon source, and produces (Fig. 6, A, 1 after L- ribose^st Stage), above-mentioned first bacterial strain is removed, and has imported encoding arabinose saccharide transporter (arabinose transporter Protein gene, the gene of encoding arabinose isomerase (arabinose isomerase), encoding ribulose phosphorylation) The gene and coding L- ribulose-5- phosphatase 24-epimerase (L-ribulose- of kinase enzyme (L-ribulose kinase) Gene 5-phosphate-4-epimerase), by the second Candida tropicalis (Candida with L- ribulose metabolic capability Tropicalis) bacterial strain is cultivated in above-mentioned culture medium, and cultivation results can confirm, all L-type by-products in addition to L- ribose Sugar is removed and produces L- ribose (Fig. 6, A, 2 of high-purity^ndStage, Fig. 6, B).

To which one aspect of the present invention is related to a kind of L- ribose (L-ribose) production method comprising：(a) as carbon Source includes that will import L- ribulose (L-ribulose) and L- ribose (L- in the culture medium of L-arabinose (L-arabinose) Ribose) the first microorganism of production ways is cultivated, and the step of generating L- ribulose and L- ribose；(b) in above-mentioned training It supports after removing above-mentioned first microorganism in base, the second microorganism for importing L- ribulose metabolic pathway is inoculated with and is cultivated, And the step of consuming L-arabinose and L- ribulose；And (c) by above-mentioned L- ribose generated recycle the step of.

According to the present invention, as long as importing the metabolism that can produce L- ribose from arabinose as above-mentioned first microorganism The microorganism of approach can be used, which is characterized in that preferential to import selected from by encoding arabinose saccharide transporter Gene, the encoding arabinose isomerase (arabinose isomerase) of (arabinosetransporter protein) Gene and encoding ribose isomerase (ribose isomerase) gene composition group in gene more than any one, But it is not limited to this.

According to the present invention, as long as importing arabinose and L- ribulose biodegrade metabolism as above-mentioned second microorganism The microorganism of approach can be used, which is characterized in that preferential to import selected from by encoding arabinose saccharide transporter Gene, the encoding arabinose isomerase (arabinose isomerase) of (arabinosetransporter protein) Gene, encoding ribulose phosphorylase kinase (L-ribulose kinase) gene and coding L- ribulose -5- phosphoric acid It is more than any one in the group of the gene composition of 4- epimerase (L-ribulose-5-phosphate-4-epimerase) Gene, but and be not so limited.

According to the present invention, as long as the microorganism that can be fermented as above-mentioned first microorganism and the second microorganism can make With, which is characterized in that it is preferably Mycotoruloides (Candida) bacterial strain, more preferably selected from by monilia guilliermondii (C.guillermondi), Candida parapsilosis (C.parapsilosis), Candida tropicalis (C.tropicalis) form In group, but and it is not so limited.

According to the present invention, generally well-known cultural method can be used in the incubation of mentioned microorganism, in addition in the present invention Other than defined medium used in embodiment and specific cultural method, whey (whey), corn pulp (corn also can be used Steep liquor) etc. saccharified liquids and other culture mediums, and can be used fed-batch culture (fed-batch culture), The multiplicity such as continuous culture method (Lee et al., Bioprocess Biosyst.Eng., 26:63,2003；Lee et al.,Appl.Microbiol.Biotechnol.,58:663,2002；Lee et al.,Biotechnol.Lett.,25: 111,2003；Lee et al.,Appl.Microbiol.Biotechnol.,54:23,2000；Lee et al., Biotechnol.Bioeng.,72:41,2001)。

In turn, used culture medium can be used alone or be used in mixed way sugar and carbohydrate (e.g., grape as carbon source Sugar, xylose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), grease and fat (e.g., soybean oil, sunflower seeds Oil, peanut oil and coconut oil), fatty acid (e.g., palmitinic acid, stearic acid and linolenic acid), alcohol (e.g., glycerine and ethyl alcohol) and have Machine acid (e.g., acetic acid) etc.；Can be used alone or be used in mixed way organic compounds containing nitrogen as nitrogen source, (e.g., peptone, yeast extract Liquid, gravy, malt extract, corn impregnation liquid, bean powder and urea) or inorganic compound (e.g., ammonium sulfate, ammonium chloride, phosphoric acid Ammonium, ammonium carbonate and ammonium nitrate) etc.；It can be used alone or be used in mixed way potassium dihydrogen phosphate, dipotassium hydrogen phosphate, corresponding as phosphorus source Sodium salt etc.；It may include that the growth such as other metal salt (e.g., magnesium sulfate or ferric sulfate), amino acid and vitamins must or promote object Matter.

The method for recycling produced ribose in above-mentioned incubation step of the invention, can be used cultural method such as, trains in batches Support, the method appropriate well known in the art such as continuous culture or charging cultural method and ribose is collected from culture solution.

According to the present invention, it can be used the step of the first microorganism of removal by culture medium and microorganism in above-mentioned steps (b) The usual all methods separated, which is characterized in that it is preferential using centrifuge separation, but and be not so limited.

According to the present invention, it is characterised in that the gene imported in above-mentioned first microorganism or the second microorganism is password Son optimization, the method being replaced with the codon of the first microorganism or the second microorganism preference can be used in codon optimization, Such as, codon database (Codon Usage Database (http is utilized://www.kazusa.or.jp/codon/ Index.html data)) replace the codon of each gene.

According to the present invention, it is characterised in that above-mentioned imported gene duplication is including glyceraldehyde-3-phosphate dehydrogenase The promoter and selection markers URA3 gene of (glyceraldehyde-3-phosphate dehydrogenase), for removing In the box gene of the repetitive sequence (glu or arg gene) of selection markers, and it is imported into microorganism, but it is not limited to this, common Method of gene introduction can be used.

According to the present invention, it is characterised in that above-mentioned encoding arabinose saccharide transporter (arabinose transporter Protein gene) is STP2, and but it is not limited to this.

According to the present invention, it is characterised in that the base of above-mentioned encoding arabinose isomerase (arabinose isomerase) Because being AraA, but and it is not so limited.

According to the present invention, it is characterised in that the gene of above-mentioned encoding ribose isomerase (ribose isomerase) is RI, But it and is not so limited.

According to the present invention, it is characterised in that above-mentioned encoding ribulose phosphorylase kinase (L-ribulose kinase) Gene is AraB, but and is not so limited.

According to the present invention, it is characterised in that above-mentioned coding L- ribulose-5- phosphatase 24-epimerase (L-ribulose-5- Phosphate-4-epimerase gene) is AraD, and but it is not limited to this.

The invention further relates to a kind of Mycotoruloides (Candida) bacterial strains for having arabinose catabolism ability, have imported coding Gene, the encoding arabinose isomerase of arabinose transport protein (arabinose transporter protein) (arabinoseisomerase) gene of gene and encoding ribose isomerase (ribose isomerase).

The invention further relates to a kind of Mycotoruloides (Candida) bacterial strain for having ribulose metabolic capability, imported coding Ah Draw gene, the encoding arabinose isomerase of primary saccharide transporter (arabinose transporter protein) (arabinoseisomerase) gene of gene, encoding ribulose phosphorylase kinase (L-ribulose kinase) with And coding L- ribulose-5- phosphatase 24-epimerase (L-ribulose-5-phosphate-4-epimerase) gene.

According to the present invention, well known various method production can be used in above-mentioned Mycotoruloides (Candida) bacterial strain, and can fit The method disclosed with Korean Patent No. 10-124678, which is characterized in that it is preferential to be made by homologous recombination, but be not limited to This.

According to the present invention, it is characterised in that above-mentioned encoding arabinose saccharide transporter (arabinose transporter Protein gene) is STP2, and but it is not limited to this.According to the present invention, it is characterised in that above-mentioned encoding arabinose isomerase (arabinoseisomerase) gene is AraA, but and is not so limited.According to the present invention, it is characterised in that above-mentioned coding core The gene of sugared isomerase (ribose isomerase) is RI, but and is not so limited.According to the present invention, it is characterised in that above-mentioned volume The gene of code ribulose phosphate kinase enzyme (L-ribulose kinase) is AraB, but and is not so limited.According to the present invention, It is characterized in that above-mentioned coding L- ribulose-5- phosphatase 24-epimerase (L-ribulose-5-phosphate-4- Epimerase gene) is AraD, and but it is not limited to this.

In the following, present invention will be further described in detail through examples.For having for the people of the usual knowledge in this field very Obviously, these embodiments are only intended to illustrate the present invention, and the scope of the present invention is not limited to these embodiments.

Embodiment 1：The promoter of glyceraldehyde-3-phosphate dehydrogenase is replicated He Final stops subsequence

In order to replicate the glyceraldehyde-3-phosphate dehydrogenase of Candida tropicalis (Candida tropicalis) (glyceraldehyde-3-phosphate dehydrogenase；GAPDH promoter and terminator), utilize tropical beads Bacterium genomic DNA and following primer obtain the promoter sequence (sequence of 1455bp to progress polymerase chain reaction (PCR) Row number：And terminator sequence (the sequence number of 309bp 1)：2).

Promoter polymerase chain reaction (PCR) [94 DEG C, 30 seconds, repeat 30 times (94 DEG C, 30 seconds；55 DEG C, 1 minute； 72 DEG C, 30 seconds 1 minute), 72 DEG C, 7 minutes)]：

PGAP-F(BglII):5'-agatctaacgtggtatggttgtaagaaac-3'(sequence number：3)；And

PGAP-R(XbaI_BamHI):5'-ggatccgcgtctagatgtttaaattctttaattg-3'(sequence number： 4)。

Terminator polymerase chain reaction (PCR) [94 DEG C, 30 seconds, repeat 30 times (94 DEG C, 30 seconds；55 DEG C, 1 minute； 72 DEG C, 1 minute), 72 DEG C, 7 minutes]：

TGAP-F(XbaI_Xho):5'-tctagattgctcgagctatccaacaaactctag-3'(sequence number：5)；With And

TGAP-R(BamHI):5'-ggatcctctggtttagaagtagggactgtatg-3'(sequence number：6).

Sequence number 1：Promoter sequence

cagaaggtggcatattcctctgatcaggtgctttttttcggctgctgctgctcgtggtggtgtagtggtagtggtgt gtgtgcgtgtgcgtgagggaggccgctttttgctctctgactcctcccaatcagaagttgctgtagcagtgaaacaa cacaatggatgataatgccccgggcggtgcgtgtccgacacaaaccactacattttttagctgggagcatactgcca ctacgacccacccacccatggtcaacaaaaaaattctgacaaattataaaataacccttggattcccccttggaaaa atttttggtatttctctctttcttttccttttcctttccctcttctttttccctccatcaatcaattgacgttcagt aactcaattaattacatcacatccctcaattaaagaatttaaaca

Sequence number 2：Terminator sequence

ctatccaacaaactctaggggttgtgctttttgaaaaaaacatataggttttattgaaatagccacaatgtctgttg agaggacatttgatttgttttatattatcgtatatgtaccctggaatatattgcgttttttaacaaaagacaaacaa cggtctttagtttttttttcaatcaatcaatgttcgtgatcgtagagagaaggagaaaaaaagagtaaacataaaca aacatctttctttttacaaacgagtacaagcaacagccatgtcacaagatgccatacagtccctacttctaaaccag a

Embodiment 2：Codon optimization (the codon of STP2, AraA, 23K AraA, AraB, AraD, RI gene optimization)

According to codon database (http://www.kazusa.or.jp/codon/index.html) data, by Ah Draw arabinose transport protein (the arabinose transporter of primary mustard (Arabidopsis thaliana) Protein), the L-arabinose isomerase (L-arabinose of bacillus licheniformis (Bacillus licheniformis) isomerase；AraA), the ribulose phosphate kinase enzyme (L-ribulose of Escherichia coli (Escherichia coli) kinase；AraB), L- ribulose-5- phosphatase 24-epimerase (L-ribulose-5-phosphate-4-epimerase； ) and the L- ribose isomerase (L- of acinetobacter bacterial strain DL-28 (Acinetobacter sp.strain DL-28) AraD Ribose Isomerase, RI) gene codon, with the codon of Candida tropicalis (Candida tropicalis) preference Replacement, and synthesized by gene order number：Sequence table documented by 7 constitute CoSTP2, by sequence number：Sequence documented by 8 Table constitute CoAraA and by sequence number：Sequence table documented by 9 constitute CoAraB, by sequence number：Sequence documented by 10 List constitute CoAraD and by sequence number：The CoRI (GENEART, Germany) that sequence table documented by 11 is constituted.

The sequence table of the revealed gene of box gene of said gene missing is as shown in table 1 below.

【Table 1】

Embodiment 3：Formed expression CoSTP2, CoAraA, 23K AraA, CoAraB, CoAraD and CoRI box gene and Bacterial strain

The optimization gene that will be synthesized in example 2, is replicated in comprising glyceraldehyde-3-phosphate dehydrogenase (glyceraldehyde-3-phosphate dehydrogenase；GAPDH promoter) and for removing selection markers In the box gene of repetitive sequence (glu or arg gene), and obtain respectively XK3-CoSTP2, PAHfs-CoSTP2, PGtrpfs2-CoAraA, XK3-23K AraA, PAHfs-CoAraB, PAHfs2-CoAraD and XK4-CoRI (Fig. 3 and Fig. 4).

3-1：The bacterial strain of expression CoSTP2,23K AraA and CoRI gene is formed based on Candida tropicalis

Said gene box PAHfs-CoSTP2 is imported into wild Candida tropicalis bacterial strain, uracil is applied to and lacked Sunken screening with solid medium (yeast nitrogen 6.7g/L, glucose 20g/L, agar powder 15g/L), and at 30 DEG C stand two days into Row culture.The bacterial strain that clone is quiding gene box is formed on solid medium, is seeded in YM culture medium (glucose 20g/L, yeast extract 3g/L, malt extract 3g/L, peptone 5g/L) in 4mL, at 30 DEG C 12 hours with 150rpm into Row shaken cultivation.Then above-mentioned culture solution is applied to 5-FOA solid medium (yeast nitrogen 6.7g/L, glucose 20g/L, 5- FOA 0.8g/L, uracil 0.1g/L, agar powder 15g/L) in, and stand two days at 30 DEG C and cultivated.

It is formed by the bacterial strain that clone is the imported URA3 gene of removal in solid medium, is successively led in the same way Enter XK3-23K AraA, XK4-CoRI, and makes the variation Candida tropicalis K1STP2 of expression CoSTP2,23K AraA and CoRI 23KAraA RI, and confirmed channel genes to required position by polymerase chain reaction (PCR).

Polymerase chain reaction (PCR) condition be [94 DEG C, 30 seconds, repeat 30 times (94 DEG C, 30 seconds；55 DEG C, 1 minute；72 DEG C, 3 minutes), 72 DEG C, 7 minutes], and used following primer suit.

Primer sequence

XK_R:GTCTCTTCCATCTTAGCTAACATACC (sequence number 13)

RI_R:CTCGAGCTAGGAAATAGCGGTTTGC (sequence number 14)

23K AraA_R:GCTGGTGTCAACGCAGAATCGACC (sequence number 15)

HRG_R:AGATCTCCACGAACCATAAACCATTCC (sequence number 16)

STP2_R:CTCGAGCTAATCCTTGAAGTACTTCTTCCATC (sequence number 17)

As a result, as shown by B in fig. 3, being inserted into, being passed through in drawing lines 1 and 3 gene of drawing lines by XK_R and RI_R combination confirmation XK_R and 23K AraA_R combination confirmation is inserted into drawing lines 2 and 4 gene of drawing lines, is existed by HRG_R and STP2_R combination confirmation Drawing lines 5 and 6 gene of drawing lines are inserted into.

3-2：The bacterial strain of expression Costp2, CoAraA, CoAraB and CoAraD gene is formed from Candida tropicalis

With method identical with embodiment 3-1, PGtrpfs2-CoAraA, PAHfs-CoAraB, PAHfs2- are successively imported CoAraD, XK3-CoSTP2, and make the Candida tropicalis variation bacterium of expression CoAraA, CoAraB and CoAraD, CoSTP2 Strain, and confirmed channel genes to required position by polymerase chain reaction (PCR).

Polymerase chain reaction (PCR) condition identical with 3-1 is used, primer sequence is as follows.

Primer sequence

HRG_F:GGATCCGCATGTCTTTAGTTCTATGATG (sequence number 18)

TGAP_R:GGATCCTCTGGTTTAGAAGTAGGGACTGTATG (sequence number 19)

TRP_F:TTCGGAGACTGCACCTGTAAATCTTC (sequence number 20)

As a result it as shown in B in Fig. 4, is inserted by XK_R and STP2_R combination confirmation in 1 gene of drawing lines, passes through HRG_F It is inserted into TGAP_R combination confirmation in 2 gene of drawing lines, is inserted by HRG_R and TGAP_R combination confirmation in 3 gene of drawing lines, It is inserted by TRP_F and TGAP_R combination confirmation in 4 gene of drawing lines.

Embodiment 4：It include the fermentation liquid of L- ribose by the production of first step Fermentation Engineering

In production medium (arabinose 30g/L, glucose 20g/L, yeast extract 10g/L, potassium dihydrogen phosphate (KH₂PO₄) 5g/L and magnesium sulfate (MgSO₄7H₂O) 0.2g/L) in 50mL, after being inoculated with bacterial strain made in embodiment 3-1, With 200rpm shaken cultivation, culture adds Portugal after starting 12 hours, 20 hours, 26 hours and 32 hours respectively within 37 hours at 30 DEG C Grape sugar 2.5g/L is detected produced tunning.

As a result confirm that arabinose concentrations reduce, and produce ribulose and ribose (Fig. 5) as fermentation carries out.

Embodiment 5：It is identified through second step Fermentation Engineering and produces high-purity ribose

Confirmation produces 7 in the culture solution of embodiment 4:1:The L-arabinose of 2 ratios：L- ribulose：After L- ribose (Fig. 6 A, 1^stStage), it is centrifuged and (wants implied condition) removal bacterial strain and has recycled culture medium.

In above-mentioned culture medium inoculated embodiment 3-2 after made bacterial strain, cultivate under the same conditions, consumption L- I Uncle's sugar and L- ribulose, are confirmed (Fig. 6, B) by liquid chromatography for the L- ribose (L-ribose) of production.

As above the specific part of the content of present invention is described in detail, and the tool usual skill in this field understands these specific notes Only preferential embodiment is stated, the scope of the present invention is not limited to this.Therefore, essential scope of the invention should be according to appended power Sharp requirement and its equivalent are defined.

Sequence table

<110>Korea Advanced Institute of Science and Technology

<120>The production method of L- ribose based on L-arabinose

<130> PF-B1871-CN

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 1455

<212> DNA

<213>Artificial sequence

<220>

<223>GAPDH_ promoter

<400> 1

aacgtggtat ggttgtaaga aacatattgc aactggagat agcgatcgtt caatttattc 60

cgattttgtg ggggaagtcg cccgctggtg ggcgtgcgcg aatggcaaaa gaaactcgac 120

catgcttttc atcatccctt aacagagcaa tcatatttta aacgttcaag caaaaagaaa 180

cgttggtttc ggctaatgat cacctgaaag gcaaaatcct tccatgtatg aacatgtagg 240

ttattccttt tttttgcaac accctcgggc agttgttcat attcccggaa aacaccacca 300

ctcggggcta agtggaagtt ctacaatccc ggggaaataa ggagccccgg tgagcacgcg 360

cacacaccac cttcacttca ttttgtccga gggaagcagc acgtgaagtc ggaacacgag 420

aggagcattt cttctatttt tttcttctct actgtgagtg catgattata tatgtaatca 480

aaagcgatca acttatggta gggtcgtgca cggcgcaccg ggttccaaaa tgatctgtga 540

gggacaaaat tctttttttt ttccagcatg ccgctggtgg caaataccgt ggtggtatga 600

tgcaccctat gccattgatt cacaccacca ccattaatca acaattgaga gaggacaaaa 660

gtgaactatt ggtggtcgtc aggttatact cgtcagcttc ggaatattac gtcccttcag 720

tttgtgaaat gtcatcctgg cgatgttcga gagagatcag tccgagagcg cgtggtagga 780

gaaacggagc actgcagcaa caaaaaaaaa atccaaaccc aggggggagg aagaagaaca 840

gccagggaaa ttgttcaccg acctgaccgt aaatttgctg ctgaaagaaa cgtgtcaaac 900

aagaccaatt ggctcaattg accctgaggg agtactttgt ctgccaccaa tgcttccacc 960

aaaacgctac ttttgttttg caatcggatg gtgtgggtct ggggtccacc tgttttgtta 1020

agctacagaa ggtggcatat tcctctgatc aggtgctttt tttcggctgc tgctgctcgt 1080

ggtggtgtag tggtagtggt gtgtgtgcgt gtgcgtgagg gaggccgctt tttgctctct 1140

gactcctccc aatcagaagt tgctgtagca gtgaaacaac acaatggatg ataatgcccc 1200

gggcggtgcg tgtccgacac aaaccactac attttttagc tgggagcata ctgccactac 1260

gacccaccca cccatggtca acaaaaaaat tctgacaaat tataaaataa cccttggatt 1320

cccccttgga aaaatttttg gtatttctct ctttcttttc cttttccttt ccctcttctt 1380

tttccctcca tcaatcaatt gacgttcagt aactcaatta attacatcac atccctcaat 1440

taaagaattt aaaca 1455

<210> 2

<211> 309

<212> DNA

<213>Artificial sequence

<220>

<223>GAPDH_ terminator

<400> 2

ctatccaaca aactctaggg gttgtgcttt ttgaaaaaaa catataggtt ttattgaaat 60

agccacaatg tctgttgaga ggacatttga tttgttttat attatcgtat atgtaccctg 120

gaatatattg cgttttttaa caaaagacaa acaacggtct ttagtttttt tttcaatcaa 180

tcaatgttcg tgatcgtaga gagaaggaga aaaaaagagt aaacataaac aaacatcttt 240

ctttttacaa acgagtacaa gcaacagcca tgtcacaaga tgccatacag tccctacttc 300

taaaccaga 309

<210> 3

<211> 29

<212> DNA

<213>Artificial sequence

<220>

<223> PGAP-F(BglII)

<400> 3

agatctaacg tggtatggtt gtaagaaac 29

<210> 4

<211> 34

<212> DNA

<213>Artificial sequence

<220>

<223> PGAP-R(XbaI_BamHI)

<400> 4

ggatccgcgt ctagatgttt aaattcttta attg 34

<210> 5

<211> 33

<212> DNA

<213>Artificial sequence

<220>

<223> TGAP-F(XbaI_Xho)

<400> 5

tctagattgc tcgagctatc caacaaactc tag 33

<210> 6

<211> 32

<212> DNA

<213>Artificial sequence

<220>

<223> TGAP-R(BamHI)

<400> 6

ggatcctctg gtttagaagt agggactgta tg 32

<210> 7

<211> 1497

<212> DNA

<213>Artificial sequence

<220>

<223> costp2

<400> 7

atggctgttg gttccatgaa cgttgaagaa ggtactaagg ctttcccagc taagttgact 60

ggtcaagttt tcttgtgttg tgttattgct gctgttggtg gtttgatgtt cggttacgat 120

attggtattt ccggtggtgt tacctccatg gatactttct tgttggattt cttcccacac 180

gtctacgaaa agaagcacag agttcacgaa aacaactact gtaaattcga cgaccaattg 240

ttgcaattgt tcacctcttc cttgtacttg gctggtattt tcgcttcctt catttcatcc 300

tacgtttcca gagctttcgg tagaaagcca accattatgt tggcttctat cttcttcttg 360

gttggtgcta ttttgaactt gtccgctcaa gaattgggta tgttgattgg tggtagaatc 420

ttgttgggtt tcggtattgg tttcggtaat caaaccgttc cattgttcat ttccgaaatt 480

gctccagcta gatacagagg tggtttgaac gttatgttcc aattcttgat taccatcggt 540

attttggctg cttcctacgt caactacttg acctccacct tgaagaacgg ttggagatac 600

tccttgggtg gtgctgctgt tccagctttg attttgttga ttggttcctt cttcattcac 660

gaaaccccag cttcattgat tgaaagaggt aaggacgaaa agggtaagca agttttgaga 720

aagatcagag gtatcgaaga tatcgaattg gaattcaacg aaatcaagta cgctaccgaa 780

gttgctacca aggttaagtc cccattcaaa gaattgttca ccaagtccga aaacagacca 840

ccattggttt gtggtacttt gttgcaattc ttccaacaat tcaccggtat caacgttgtt 900

atgttctacg ctccagtttt gttccaaacc atgggttccg gtgataacgc ttccttgatt 960

tccaccgttg tcaccaacgg tgtcaacgct attgctaccg ttatttcctt gttggttgtt 1020

gatttcgctg gtagaagatg tttgttgatg gaaggtgcct tgcaaatgac cgctacccaa 1080

atgaccattg gtggtatttt gttggctcac ttgaagttgg ttggtccaat taccggtcac 1140

gctgttccat tgatcgtttt gattttgatc tgtgtctacg tttccggttt cgcttggtcc 1200

tggggtccat tgggttggtt ggttccatcc gaaatctacc cattggaagt tagaaacgct 1260

ggttacttct gtgctgttgc tatgaacatg gtctgtacct ttattatcgg tcaattcttc 1320

ttgtccgcct tgtgtagatt cagatccttg ttgttcttct tcttcggtat catgaacatc 1380

atcatgggtt tgttcgtcgt tttcttcttg cctgaaacta agggtgttcc aattgaagaa 1440

atggctgaaa agagatggaa aacccaccca agatggaaga agtacttcaa ggattag 1497

<210> 8

<211> 1425

<212> DNA

<213>Artificial sequence

<220>

<223> CoAraA

<400> 8

atgttgacca ccggtaagaa agaattctgg ttcgttgttg gttcccaaca cttgtacggt 60

gaagaaacct tggctgaagt tagagcccac gctcaagcta tgaccgatgc tttgaacgaa 120

tccgctgttt tgccataccc attggtcttg caagatttgg ctgtcaacgc tgataagatt 180

acctccatta tgaaggaagt caactacaga gatgaagttg ctggtgttat tacctggatg 240

cacaccttct caccagctaa gatgtggatt agaggtacta agttgttgca aaagccattg 300

ttgcacttgg ctacccaatt caacgaatcc attccatggc caaccattga tatggatttc 360

atgaacttga atcaatccgc tcacggtgat agagaatacg gtttcattaa cgccagattg 420

aagaagcaaa acaaggttgt tgtcggttac tgggaaagac cagaagttca acaacaaatt 480

gctgaatgga tggatgttgc tgttgcttac aacgaatcct tcaacattaa ggttgctaga 540

ttcggtgaca acatgagaaa cgttgctgtt accgaaggtg ataagattga agctcaaatt 600

caattcggtt ggaccgttga ttacttcggt attggtgatt tggtccaata cgtcaacgct 660

gttaccgatg aagaaatcaa cagattgttc gctgaatacg ctgacttgta cgaattcgat 720

tacggtactt actccagaga agattgggaa aagtccgtta aggttcaagc ttcctacgaa 780

attgccatca agagattctt ggatgatggt ggttacaacg ctttcaccac caacttcgaa 840

gatttgtacg gtatgaagca attgccaggt ttggctgttc aaagattgat ggctcaaggt 900

tacggtttcg ctggtgaagg tgattggaaa accgctgctt tggatagatt gttgaaggtt 960

atgtccagaa atcaatccac cggtttcatg gaagattaca cctacgaatt ggctgctggt 1020

caagaatcca tcttgcaatc ccacatgttg gaagttgatc catccttggc ttccaacaag 1080

ccaaagatta tcgtttcccc attgggtatt ggtgacagag aagatccagc tagattggtt 1140

ttcgatggta aggctggtga tggtgttgtt gtttccatgg ctgatttcgg tactcactac 1200

aagttgttga tcaacgaagt ttccgctttc gaaccaaccg ttccagctcc aaacttgcca 1260

gttgctagag ttttgtggga agttaagcca aacttccaag atggtgttaa ggcttggttg 1320

gaaaacggtg gtggtcacca cactgttgtt tctttgttct tgaccaccga tcaaatgatt 1380

acctacgcta agttggtcga cttggaatac gttgttatca agtaa 1425

<210> 9

<211> 1701

<212> DNA

<213>Artificial sequence

<220>

<223> CoAraB

<400> 9

atggctatcg ccattggttt ggatttcggt tccgattccg ttagagcttt ggctgttgat 60

tgtgctaccg gtgaagaaat tgctacctcc gttgaatggt atccaagatg gcaaaagggt 120

caattctgtg atgctccaaa caatcaattc agacaccacc caagagacta cattgaatcc 180

atggaagctg ctttgaaaac cgttttggct gaattgtccg ttgaacaaag agctgctgtt 240

gttggtattg gtgttgattc caccggttcc accccagctc caattgatgc tgatggtaac 300

gttttggctt tgagaccaga attcgctgaa aacccaaacg ctatgttcgt tttgtggaag 360

gatcacaccg ctgttgaaga agctgaagaa attaccagat tgtgtcacgc tccaggtaac 420

gttgattact ccagatatat tggtggtatc tactcctccg aatggttctg ggctaaaatc 480

ttgcacgtta ccagacaaga ttccgctgtt gctcaatccg ctgcttcctg gattgaattg 540

tgtgattggg ttccagcttt gttgtccggt actaccagac cacaagatat tagaagaggt 600

agatgttccg ctggtcacaa gtccttgtgg cacgaatcct ggggtggttt gccaccagct 660

tcattcttcg atgaattgga cccaattttg aacagacact tgccatcccc attgttcacc 720

gatacctgga ccgctgatat tccagttggt actttgtgtc cagaatgggc tcaaagattg 780

ggtttgccag aatccgttgt tatttccggt ggtgctttcg attgtcacat gggtgctgtt 840

ggtgctggtg ctcaaccaaa cgctttggtt aaggttattg gtacttccac ctgtgacatt 900

ttgattgctg ataagcaatc cgttggtgaa agagctgtta agggtatttg tggtcaagtt 960

gatggttccg ttgttccagg ttttattggt ttggaagctg gtcaatccgc tttcggtgat 1020

atctacgctt ggtttggtag agttttgggt tggccattgg aacaattggc tgctcaacac 1080

ccagaattga aaactcaaat caacgcttcc caaaagcaat tgttgccagc tttgaccgaa 1140

gcttgggcta agaacccatc cttggatcac ttgccagttg ttttggattg gttcaacggt 1200

agaagaaccc caaacgctaa tcaaagattg aagggtgtta tcaccgactt gaacttggct 1260

accgatgctc cattgttgtt cggtggtttg attgctgcta ctgctttcgg tgctagagct 1320

attatggaat gtttcaccga tcaaggtatc gctgtcaaca acgttatggc tttgggtggt 1380

attgccagaa agaatcaagt tatcatgcaa gcttgttgtg acgtcttgaa cagaccattg 1440

caaatcgttg cttccgatca atgttgtgct ttgggtgctg ctattttcgc tgctgttgct 1500

gctaaggttc acgctgacat tccatccgct caacaaaaga tggcttccgc tgttgaaaag 1560

accttgcaac catgttccga acaagctcaa agattcgaac aattgtatag aagataccaa 1620

caatgggcta tgtccgctga acaacactac ttgccaacct ccgctccagc tcaagctgct 1680

caagccgttg ctaccttgta a 1701

<210> 10

<211> 696

<212> DNA

<213>Artificial sequence

<220>

<223> CoAraD

<400> 10

atgttggaag atttgaagag acaagtcttg gaagctaact tggctttgcc aaagcacaac 60

ttggttacct tgacctgggg taacgtttcc gctgttgata gagaaagagg tgttttcgtt 120

attaagccat ccggtgttga ttactccgtt atgaccgctg atgatatggt tgttgtttcc 180

attgaaaccg gtgaagttgt tgaaggtact aagaagccat cctccgatac cccaacccac 240

agattgttgt accaagcttt cccatccatt ggtggtatcg ttcacaccca ctccagacac 300

gctaccattt gggctcaagc tggtcaatcc attccagcta ccggtactac ccacgctgat 360

tacttctacg gtactattcc atgtaccaga aagatgaccg atgctgaaat caacggtgaa 420

tacgaatggg aaaccggtaa cgttatcgtt gaaaccttcg aaaagcaagg tattgatgct 480

gctcaaatgc caggtgtttt ggttcactcc cacggtccat tcgcttgggg taagaacgct 540

gaagatgctg ttcacaacgc tatcgttttg gaagaagttg cttacatggg tattttctgt 600

agacaattgg ctccacaatt gccagatatg caacaaacct tgttggataa gcactacttg 660

agaaagcacg gtgctaaggc ttactacggt caataa 696

<210> 11

<211> 750

<212> DNA

<213>Artificial sequence

<220>

<223> CoRI

<400> 11

atgaccagaa cctccatcac tagaagagaa tacgatgaat gggttagaga agctgctgct 60

ttgggtaagg ctttgagata cccaattacc gaaaagatgg tcaacgattc cgctggtatc 120

gttttcggtg ctgatcaata cgatgctttc aagaacggta tgtggtccgg tgaaccatac 180

gaagctatga ttattttcga atccttgaac gaaccagctg ttgatggttt gccaaccggt 240

gctgctccat acgctgaata ctccggtttg tgtgataagt tgatgatcgt tcacccaggt 300

aagttctgtc caccacacca ccacggtaga aagaccgaat cctacgaagt tgttttgggt 360

gaaatggaag ttttctactc cccaacccca tccgctgaat ccggtgttga attgttgaac 420

ttctccggta tgccagttgg ttccccatgg ccagaaggtg ttgctttgcc aaagggtaga 480

gaatcctcct acgaaaagtt gacctcctac gttagattga gagctggtga tccaaagttc 540

gttatgcaca gaaagcactt gcacgctttc agatgtccac cagattccga tgttccattg 600

gttgttagag aagtttccac ctactcccac gaaccaaccg aagctgctgc cggtaaccac 660

gctccaattc catcctggtt gggtatgcac gataacgatt tcgtttccga tgctgctaac 720

accggtagat tgcaaaccgc tatttcctag 750

<210> 12

<211> 1425

<212> DNA

<213>Artificial sequence

<220>

<223> 23K_AraA

<400> 12

atgttgaaca ccgaaaacta cgaattctgg ttcgttaccg gttcccaatc cttgtacggt 60

gaagaaacct tgagatccgt tgaaaaggat gctaaagaaa tcgtcgaaaa gttgaacgct 120

tcccaccaat tgccataccc aatcgttttc aagttggttg ctaccaccgc tgataacatt 180

accaaggtta tgaaggaagc taactacaac gatcacgttg ctggtgttat tacctggatg 240

cacaccttct caccagctaa gaactggatt agaggtacta agttgttgca aaagccattg 300

ttgcacttgg ctacccaatt cttgaacaag attccatacg ataccatcga cttcgactac 360

atgaacttga atcaatccgc tcacggtgat agagaatacg ctttcattaa cgctagattg 420

agaaagaaca acaagatcat ttccggttac tggggtgatg aagatgttca aaaggctatg 480

gctaagtgga tggatgttgc tgttgcttac aacgaatcct tcaagattaa ggttgttacc 540

ttcgctgaca agatgagaaa cgttgctgtt accgatggtg ataaggttga agctcaaatc 600

aagttcggtt ggaccgttga ttactggggt gttggtgatt tggttgctga agttaacgct 660

gtttccgaag ctgatattga tgctaagtac gctgacttgc aaaaagaata cgatttcgtc 720

gaaggtcaaa acaccccaga aaagttcgaa cacaacgtta agtaccaaat cagagaatac 780

ttcggtttga agaaattcat ggacgataga ggttacaccg ctttcaccac caacttcgaa 840

gatttggttg gtttggaaca attgccaggt ttggctgctc aattgttgat ggctgaaggt 900

tacggtttcg ctggtgaagg tgattggaaa accgctgctt tggatagatt gttgaagatt 960

atggctcaca acgaaaagac cgttttcatg gaagattaca ccttggattt gagacaaggt 1020

cacgaagcta ttttgggttc ccacatgttg gaagttgatc catccattgc ttccgataag 1080

ccaagagttg aagttcaccc attggatatt ggtgataagg atgatccagc tagattggtt 1140

ttcaccggta tgcaaggtga tgctgttgat gttaccatgg ctgattacgg tgatgaattc 1200

aagttgatgt cctacgatgt tagaggtaac aagccagaag ctgatacccc acacttgcca 1260

gttgctaagc aattgtggac cccaaagcaa ggtttgagag aaggtgctgt tggttggttg 1320

accgttggtg gtggtcacca caccgttttg tccttcgctg ttgattccga acaattgcaa 1380

gatttgtccc acttgttcga tttgacctac gttaacatca agtag 1425

<210> 13

<211> 26

<212> DNA

<213>Artificial sequence

<220>

<223> XK_R

<400> 13

gtctcttcca tcttagctaa catacc 26

<210> 14

<211> 25

<212> DNA

<213>Artificial sequence

<220>

<223> RI_R

<400> 14

ctcgagctag gaaatagcgg tttgc 25

<210> 15

<211> 24

<212> DNA

<213>Artificial sequence

<220>

<223> 23K AraA_R

<400> 15

gctggtgtca acgcagaatc gacc 24

<210> 16

<211> 27

<212> DNA

<213>Artificial sequence

<220>

<223> HRG_R

<400> 16

agatctccac gaaccataaa ccattcc 27

<210> 17

<211> 32

<212> DNA

<213>Artificial sequence

<220>

<223> STP2_R

<400> 17

ctcgagctaa tccttgaagt acttcttcca tc 32

<210> 18

<211> 28

<212> DNA

<213>Artificial sequence

<220>

<223> HRG_F

<400> 18

ggatccgcat gtctttagtt ctatgatg 28

<210> 19

<211> 32

<212> DNA

<213>Artificial sequence

<220>

<223> TGAP_R

<400> 19

ggatcctctg gtttagaagt agggactgta tg 32

<210> 20

<211> 26

<212> DNA

<213>Artificial sequence

<220>

<223> TRP_F

<400> 20

ttcggagact gcacctgtaa atcttc 26

Claims

1. a kind of production method of L- ribose, which is characterized in that include the following steps：

(a) in the culture medium for including L-arabinose as carbon source, the of L- ribulose and L- ribose production ways will be imported One microorganism is cultivated, thus the step of generating L- ribulose and L- ribose；

(b) after removing first microorganism in the medium, the second microorganism of L- ribulose metabolic pathway will be imported It is inoculated with and is cultivated, thus the step of consuming L-arabinose and L- ribulose；And

(c) the step of L- ribose of the generation being recycled.

2. the production method of L- ribose according to claim 1, which is characterized in that imported choosing in first microorganism The base of the gene of free encoding arabinose saccharide transporter, the gene of encoding arabinose isomerase and encoding ribose isomerase The gene of one or more of group because of composition.

3. the production method of L- ribose according to claim 1, which is characterized in that imported choosing in second microorganism The gene of free encoding arabinose saccharide transporter, the gene of encoding arabinose isomerase, encoding ribulose phosphorylase kinase The gene of one or more of the group that the gene of enzyme and the gene for encoding L- ribulose -5- phosphoric acid -4- epimerase form.

4. the production method of L- ribose according to claim 1, which is characterized in that first microorganism and second micro- life Object is selected from by monilia guilliermondii (C.guillermondi), Candida parapsilosis (C.parapsilosis) and Candida tropicalis (C.tropicalis) in the group formed.

5. the production method of L- ribose according to claim 1, which is characterized in that the carbon source further includes glucose, wood Sugar, glycerol, galactolipin, fructose, granulated sugar, mannose, maltose and cellobiose.

6. the production method of L- ribose according to claim 2 or 3, which is characterized in that the gene is codon optimization Gene.

7. the production method of L- ribose according to claim 2 or 3, which is characterized in that the encoding arabinose sugar transport The gene of albumen is STP2.

8. the production method of L- ribose according to claim 2 or 3, which is characterized in that the encoding arabinose sugar isomery The gene of enzyme is AraA.

9. the production method of L- ribose according to claim 2, which is characterized in that the gene of the encoding ribose isomerase It is RI.

10. the production method of L- ribose according to claim 3, which is characterized in that the encoding ribulose phosphorylase The gene of kinases is AraB.

11. the production method of L- ribose according to claim 3, which is characterized in that the coding L- ribulose -5- phosphorus The gene of acid -4- epimerase is AraD.

12. a kind of Candida spp for having arabinose catabolism ability, which is characterized in that imported encoding arabinose sugar transport The gene of the gene of albumen, the gene of encoding arabinose isomerase and encoding ribose isomerase.

13. a kind of Candida spp for having ribulose metabolic capability, which is characterized in that imported encoding arabinose sugar transport egg The gene of white gene, encoding arabinose isomerase, the gene of encoding ribulose phosphorylase kinase and coding L- core ketone The gene of sugar -5- phosphoric acid -4- epimerase.

14. Candida spp according to claim 12 or 13, which is characterized in that the Candida spp be selected from by Monilia guilliermondii (C.guillermondi), Candida parapsilosis (C.parapsilosis) and Candida tropicalis (C.tropicalis) in the group formed.

15. Candida spp according to claim 12 or 13, which is characterized in that the encoding arabinose sugar transport egg White gene is STP2.

16. Candida spp according to claim 12 or 13, which is characterized in that the encoding arabinose isomerase Gene be AraA.

17. Candida spp according to claim 12, which is characterized in that the gene of the encoding ribose isomerase is RI。

18. Candida spp according to claim 13, which is characterized in that the encoding ribulose phosphorylase kinase Gene be AraB.

19. Candida spp according to claim 13, which is characterized in that the coding L- ribulose -5- phosphoric acid -4- The gene of epimerase is AraD.