CN108866077B

CN108866077B - Application of soybean protein

Info

Publication number: CN108866077B
Application number: CN201810749910.8A
Authority: CN
Inventors: 刘昀; 谭芳美; 郑易之; 孙楠; 吴佳辉; 程华; 张凛松
Original assignee: Shenzhen University
Current assignee: Shenzhen University
Priority date: 2018-07-10
Filing date: 2018-07-10
Publication date: 2020-06-30
Anticipated expiration: 2038-07-10
Also published as: CN108866077A

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to application of soybean protein. The soybean protein is used as an osmotic adjusting substance for improving the salt tolerance of organisms; wherein the coding sequence of the soybean protein is shown as SEQ ID NO. 1. The soybean protein provided by the invention can be used as an osmotic adjusting substance for improving the salt tolerance of organisms such as plants or escherichia coli and the like, and the soybean protein and the gene thereof have good application prospects in the stress resistance field of organisms, particularly plants.

Description

Application of soybean protein

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to application of soybean protein.

Background

Abiotic stresses such as saline-alkali stress, drought stress and the like are main environmental factors for limiting the growth and development of plants. These environmental factors cause a series of physiological metabolic reactions in plants, which are expressed by reversible inhibition of metabolism and growth, and even cause irreversible damage in severe cases, resulting in death of the whole plants. Therefore, it has been a subject of research to improve the stress resistance of plants.

The osmoregulation substance can make organism raise water-absorbing or water-retaining capacity of cell so as to adapt to water stress environment. The use of soluble proteins as osmolytes is very limited and, therefore, the prior art remains to be improved and developed.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide application of soybean protein, aiming at solving the technical problem that the types of soluble protein of the existing osmosis regulating substances are limited.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides an application of soybean protein, which is used as an osmotic adjusting substance for improving the salt tolerance of organisms; wherein the coding sequence of the soybean protein is shown as SEQ ID NO. 1.

The soybean protein (the gene code is Glyma15g12170.1, the coding sequence is shown in SEQ ID NO: 1) provided by the invention can enhance the salt tolerance of escherichia coli and the like through experimental verification, so that the soybean protein can be used as an osmotic adjusting substance for improving the salt tolerance of plants or organisms such as escherichia coli and the like, and the soybean protein and the gene thereof have good application prospects in the field of stress resistance of organisms, particularly plants.

Drawings

FIG. 1 is a graph showing the results of electrophoresis of soybean gene fragments amplified by PCR in example 1 of the present invention (M is DL10000 Marker).

FIG. 2 is a graph showing the results of electrophoresis for verifying recombinant bacteria by colony PCR in example 1 of the present invention (M is DL10000 Marker).

FIG. 3 is a graph showing the result of electrophoresis of the expression induction of the soybean protein Glyma15g12170.1 of example 5 of the present invention.

FIG. 4 is a graph showing the results of the growth of hollow vector transformants in different concentrations of high-salt LB solid medium and normal solid medium in example 7 of the present invention.

FIG. 5 is a graph showing the growth results of the recombinant plasmid-transformed bacteria of example 7 of the present invention in different concentrations of high-salt LB solid medium and normal solid medium.

FIG. 6 is a bar graph showing the survival rates of the hollow vector-transformed bacteria and the recombinant plasmid-transformed bacteria of example 7 of the present invention.

Detailed Description

In order to make the technical problems, technical solutions and advantageous effects to be solved by the present invention more clearly apparent, the present invention is further described in detail below with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The embodiment of the invention provides an application of soybean protein, wherein the soybean protein is used as an osmotic adjusting substance for improving the salt tolerance of organisms; wherein the coding sequence of the soybean protein is shown as SEQ ID NO. 1.

The soybean protein (the gene code is Glyma15g12170.1, the coding sequence is shown in SEQ ID NO: 1) provided by the embodiment of the invention can enhance the salt tolerance of escherichia coli and the like through experimental verification, so that the soybean protein and the gene thereof can be used as an osmotic adjusting substance for improving the salt tolerance of plants or organisms such as escherichia coli and the like, and have good application prospects in the stress resistance field of organisms (preferably plants and/or escherichia coli).

The coding sequence of the soybean protein Glyma15g12170.1 is shown as SEQ ID NO:1 as follows:

ATGGCCAGCGTTGAGGTTGCACAGCAAACACCAACAACAGTTCCAGAAAATGAAACAACCGAGGTAAGCAAGACCCAGGAAACAACCCCAGTCACTGAGGCTCCTGCAACAGAACAACCAGCAGCTGAGGTTCCTGCAACAGAACAACCAGCCGCTGAGGCTCCTGCCCCAGAATCAACCACCGAAGCACCAAAGGAAGAAACCACCGAGGCACCAACAGAAACAGTAGAAAAAACAACTACAGAAGTAGCCCCAGAGGAGCCTAAAGAAGTTCCAGTTGAGACCGAGGAGGTGGTGGCAAAGGAGACAGAGGAAGAGAAGCCAGCAGAAGAGAAATCAGAGGAGAAAACTGAAGAAGTGAAAGAAGAAGCAGAGGAGCCTAAAGAAACTACTGAAACAGAATCAGCAGCAGCAGCACCACCAGCAACCACAGAGGAAGAGAACAAACCAGCTGAGTCAGTTGAAACCCCAGTAGAGGTTCCTGTTGAGAAGACTGAAGCTTAG。

further, the preparation method of the soybean protein comprises the following steps:

s01: amplifying the coding sequence of the soy protein;

s02: constructing a recombinant plasmid containing the coding sequence;

s03: transforming the recombinant plasmid into a competent cell for induced expression;

s04: and carrying out protein separation and purification on the bacteria liquid after induction expression to obtain the soybean protein.

Further, in the above step S01, the primer pair for amplifying the coding sequence of the soybean protein is represented by SEQ ID NO. 2 and SEQ ID NO. 3:

SEQ ID NO:2：5’-CGCCCATATGGCCAGCGTTGAGGTTGC(Nde I)-3’，

SEQ ID NO:3：5’-ACCGCTCGAGCTAAGCTTCAGTCTTCTCAAC(Xho I)-3’。

the primer pair introduces homologous sequences of corresponding enzyme cutting sites according to sequence characteristics of a PMD19-T vector and a target gene, and respectively introduces homologous sequences at two ends of endonuclease (Nde I) and (Xho I) at the 5' end of the primer pair. Further, the template for amplifying the coding sequence of the soybean protein is soybean radicle cDNA, namely, the soybean radicle cDNA is taken as the template for PCR amplification to obtain a target gene fragment (CGCCCA)TATGGCCAGCGTTGAGGTTGCACAGCAAACACCAACAACAGTTCCAGAAA ATGAAACAACCGAGGTAAGCAAGACCCAGGAAACAACCCCAGTCACTGAGGCTCCTGCAACAGAACAACCAGCAGC TGAGGTTCCTGCAACAGAACAACCAGCCGCTGAGGCTCCTGCCCCAGAATCAACCACCGAAGCACCAAAGGAAGAA ACCACCGAGGCACCAACAGAAACAGTAGAAAAAACAACTACAGAAGTAGCCCCAGAGGAGCCTAAAGAAGTTCCAG TTGAGACCGAGGAGGTGGTGGCAAAGGAGACAGAGGAAGAGAAGCCAGCAGAAGAGAAATCAGAGGAGAAAACTGA AGAAGTGAAAGAAGAAGCAGAGGAGCCTAAAGAAACTACTGAAACAGAATCAGCAGCAGCAGCACCACCAGCAACC ACAGAGGAAGAGAACAAACCAGCTGAGTCAGTTGAAACCCCAGTAGAGGTTCCTGTTGAGAAGACTGAAGCTTAGCTCGAGCGGT). In the embodiment of the invention, soybean radicles at the R0 stage and the R15 stage are used as experimental materials, the heat treatment is carried out at 100 ℃ for 10min, then the centrifugation is carried out to obtain the supernatant, and the soluble protein obtained by enrichment is the heat stable protein. According to proteomics and structure prediction results, 1 protein is selected from high-expression proteins in the R0 stage (namely, the soybean seeds do not break through radicles of seed coats after water absorption and germination) for structural and functional analysis, and the protein is the soybean protein disclosed by the embodiment of the invention.

Further, in the step S02, the recombinant plasmid is obtained by recombining a protein expression vector PET-28a and the coding sequence of the soybean protein, and the preparation method of the specific recombinant plasmid comprises the steps of carrying out Nde I and Xho I double enzyme digestion on the protein expression vector PET-28a, and then connecting the enzyme digestion product with the coding sequence of the soybean protein by utilizing T4 ligase to obtain the recombinant plasmid, further, mixing the coding sequence of the soybean protein and the double enzyme digested protein expression vector PET-28a according to a molar ratio of 10:1, adding 0.5 mu L T4 ligase and 1 mu L10 × Buffer, supplementing the mixture to 10 mu L with water, and connecting the mixture at 16 ℃ overnight.

The sequence of the finally obtained recombinant plasmid SEQ ID NO. 4 is:

ATCCGGATATAGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTATTGCTCAGCGGTGGCAGCAGCCAACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGCTAAGCTTCAGTCTTCTCAACAGGAACCTCTACTGGGGTTTCAACTGACTCAGCTGGTTTGTTCTCTTCCTCTGTGGTTGCTGGTGGTGGTGCTGCTGCTGATTCTGTTTCAGTAGTTTCTTTAGGCTCCTCTGCTTCTTCTTTCACTTCTTCAGTTTTCTCCTCTGATTTCTCTTCTGCTGGCTTCTCTTCCTCTGTCTCCTTTGCCACCACCTCCTCGGTCTCAACTGGAACTTCTTTAGGCTCCTCTGGGGCTACTTCTGTAGTTGTTTTTTCTACTGTTTCTGTTGGTGCCTCGGTGGTTTCTTCCTTTGGTGCTTCGGTGGTTGATTCTGGGGCAGGAGCCTCAGCGGCTGGTTGTTCTGTTGCAGGAACCTCAGCTGCTGGTTGTTCTGTTGCAGGAGCCTCAGTGACTGGGGTTGTTTCCTGGGTCTTGCTTACCTCGGTTGTTTCATTTTCTGGAACTGTTGTTGGTGTTTGCTGTGCAACCTCAACGCTGGCCATATGGCTGCCGCGCGGCACCAGGCCGCTGCTGTGATGATGATGATGATGGCTGCTGCCCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGGGGAATTGTTATCCGCTCACAATTCCCCTATAGTGAGTCGTATTAATTTCGCGGGATCGAGATCTCGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGAGATCCCGGACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGGTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGTGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTCTGCGAAAACGCGGGAAAAAGTGGAAGCGGCGATGGCGGAGCTGAATTACATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGATTGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGCGGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGATGGTAGAACGAAGCGGCGTCGAAGCCTGTAAAGCGGCGGTGCACAATCTTCTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCAGGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCTTGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGACGGTACGCGACTGGGCGTGGAGCATCTGGTCGCATTGGGTCACCAGCAAATCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGGCTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAACGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAATGCTGAATGAGGGCATCGTTCCCACTGCGATGCTGGTTGCCAACGATCAGATGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGTGCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTATATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAACCAGCGTGGACCGCTTGCTGCAACTCTCTCAGGGCCAGGCGGTGAAGGGCAATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTAAGTTAGCTCACTCATTAGGCACCGGGATCTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCCCACGGGTGCGCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCATCAGTGACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCTAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAACTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAAGAATTAATTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCCATTCGCCA。

further, in the above step S03, the competent cell is an escherichia coli BL21Star competent cell. The step of inducing expression comprises: competent cells containing the recombinant plasmid were expanded and then induced with 150rmp at 16 ℃ by adding 1% IPTG stock solution. The strain containing recombinant plasmid is enlarged and cultured, IPTG stock solution with the final concentration of 0.1mM is added for overnight induction, the induced thalli are centrifugally collected, resuspended, crushed and centrifuged, and supernatant is taken to obtain the total soluble protein.

Further, in the above step S04, the protein separation and purification step includes nickel ion affinity chromatography.

In the embodiment of the invention, the survival rate of the recombinant bacteria containing the recombinant plasmid is verified under 500mM salt stress: inducing the recombinant bacteria containing the recombinant plasmid, diluting, respectively coating on normal and high-salt plates, and counting the number of bacterial plaques; the survival rate of the recombinant bacteria is calculated by taking the unloaded recombinant bacteria as a control, and whether the corresponding protein in the recombinant bacteria has salt tolerance can be proved. The result shows that compared with the survival rate of the unloaded recombinant bacteria, the survival rate of the recombinant bacteria expressing the soybean protein Glyma15g12170.1 is obviously higher than that of the unloaded recombinant bacteria, namely the protein is proved to have certain salt tolerance.

The invention is described in further detail with reference to a part of the test results, which are described in detail below with reference to specific examples.

EXAMPLE 1 cloning of the Gene

Introducing homologous sequences of corresponding enzyme cutting sites according to the characteristics of a PMD19-T vector and a gene sequence, and introducing homologous sequences at two ends of endonuclease (Nde I) and (Xho I) respectively at the 5' ends of an upstream primer and a downstream primer of an amplified soybean protein gene.

An upstream primer F: 5'-CGCCCATATGGCCAGCGTTGAGGTTGC-3' the flow of the air in the air conditioner,

a downstream primer R: 5'-ACCGCTCGAGCTAAGCTTCAGTCTTCTCAAC-3' are provided.

Taking the upstream primer F and the downstream primer R as a primer pair, taking soybean R0-stage radicle cDNA as a template, carrying out PCR amplification, taking a reaction system of 5 × Phusion HF Buffer 4 mu L, 2.5mM dNTP1.6 mu L, 10mM each of the upstream primer and the downstream primer, 1 mu L of cDNA template and 0.6 mu L of DMSO, supplementing water to 20 mu L, pre-reacting on a PCR instrument at 98 ℃ for 30s, reacting at 98 ℃ for 5s, determining annealing temperature according to a Tm value of the primers, determining 72 ℃ extension reaction time according to gene length, 10min at 72 ℃, separating a PCR product on 1% agarose gel electrophoresis of the reaction product, detecting by using an ultraviolet lamp, collecting a specific amplification product according to the operation of a nucleic acid recovery kit specification, mixing the amplification recovery product with a PMD19-T simple vector of TaKaRa according to a molar ratio of 10:1, adding an equal volume of Solution I aqueous reaction Buffer Solution I, mixing uniformly, centrifuging slightly, and connecting in a bath at 16 ℃ for overnight connection.

In this embodiment, primers are designed according to a Glyma15g12170.1 nucleic acid sequence in an NCBI database, a total cDNA of soybean radicle is used as a template, a PCR method is used for amplifying a selected target gene sequence, a PCR product is detected by 1% agarose gel electrophoresis, and the result shows that the target gene is effectively amplified, the size of the molecular weight of the gene is similar to that of an expected molecular weight (as shown in FIG. 1), and sequencing is performed after T-loading. After double enzyme digestion is carried out on the cloning vector and the protein expression vector PET-28a which are sequenced successfully, the enzyme digestion products are connected through T4 ligase to construct pET-28 a/recombinant plasmid, then the recombinant plasmid is transformed into escherichia coli BL21Star, and the recombinant bacteria are verified by a colony PCR method (as shown in figure 2). The result shows that the successfully constructed recombinant bacteria can be amplified to a target fragment, and the successful construction of the prokaryotic expression vector containing the target gene is indicated.

Example 2: preparation and transformation of super competence

Preparing Escherichia coli TOP10 and BL21Star competence according to the method provided by super competence kit provided by Shanghai, selecting streaked Escherichia coli monoclonal strain in 5mL LB liquid medium in super clean bench, culturing at 37 deg.C and 180rmp constant temperature shaking table for 12h, inoculating to the strain at a ratio of 1:5050mL of freshly prepared LB Medium to OD₆₀₀The value is about 0.6. The cells were collected in a 50mL centrifuge tube and centrifuged at 8,000g for 3 min. The supernatant was discarded, the cells were placed on ice for 10min, centrifuged at 4 ℃ and 5,000rmp for 5min, resuspended by Buffer A provided in the kit and placed on ice for 30min, centrifuged at 4 ℃ and 5,000rmp for 5min, the supernatant was discarded, the cells were resuspended by Buffer B (precooled at-20 ℃ before use) provided in the kit, and the aliquots were aliquoted in sterilized 1.5mL EP tubes, each tube was 100. mu.L, and kept in a freezer at-80 ℃ for further use.

mu.L of the ligation product was added to a medium containing 100. mu.L of E.coli competence and gently mixed. Coli competent cells were placed on ice for 30min, heat-shocked at 42 ℃ for 90s, ice for 5min, and 900. mu.L of freshly prepared LB liquid medium was added. Culturing at 37 deg.C in 180rmp constant temperature shaking table for 1h, spreading 300 μ L of bacterial solution on LB solid culture medium containing corresponding antibiotics, and culturing at 37 deg.C for 15h in inverted manner.

Example 3: plasmid extraction

Using the plasmid extraction kit from OMEGA, 1mL of the suspension was centrifuged at 8,000rmp in 1.5 EP 1.5m L for 1min, and the supernatant was discarded after 3 repetitions. Adding 200 μ L of Buffer I into an EP tube filled with thallus, fully blowing and uniformly mixing by using a pipette, adding 200 μ L of Buffer II, slightly reversing and uniformly mixing for 2 times, standing for 1min at room temperature, adding 300 μ L of Buffer III, reversing and uniformly mixing for 3 times, wherein the whole process does not exceed 5 min. Centrifugation at 12,000rmp for 15min at room temperature, aspiration of 500. mu.L of the supernatant, addition to a well-balanced nucleic acid collection column, centrifugation at 12,000rmp for 1min at room temperature, discarding of the waste solution, addition of 500. mu.L of HB Buffer to the nucleic acid collection column, centrifugation at 12,000rmp for 1min at room temperature, discarding of the waste solution, addition of 600. mu.L of WB Buffer (previously added with 800mL of absolute ethanol) in the kit, centrifugation at 12,000rmp for 1min at room temperature for 2 times, idling of the nucleic acid collection column, and centrifugation at 15,000rmp for 2min to remove the remaining WB Buffer. To the nucleic acid collection column, 30. mu.L of sterile water was added, and the plasmid was collected using a new EP tube and centrifuged at 12,000rmp for 2min at room temperature.

Example 4: construction of protein expression vectors

Carrying out double enzyme digestion reaction on a PMD19-T vector containing a target gene according to enzyme digestion sites designed by gene primers, wherein the reaction systems are 1 mu L of restriction enzymes, 1 mu g of plasmid and 2 mu L of reaction Buffer, supplementing water to 10 mu L, reacting for 5h, separating enzyme digestion products from reaction products on 1% agarose gel electrophoresis, detecting under an ultraviolet lamp, recovering a target gene fragment, mixing the target gene fragment and a PET-28a protein expression vector subjected to double enzyme digestion according to a molar ratio of 10:1, adding 0.5 mu L T4 ligase and 1 mu L of 10 × Buffer, supplementing water to 10 mu L, and connecting at 16 ℃ overnight.

Example 5: colony PCR validation of recombinants

The ligation product was transformed into competent cells of E.coli BL21Star, a small amount of plaque with transformants growing thereon was picked as a template, and the recombinants were verified by using the primers in example 1, and the PCR reaction system and procedure were the same as in example 1.

In this example, the successfully constructed recombinant pET-28 a/protein bacteria were cultured in an expanded manner, 0.1mM IPTG was added to induce the bacteria at 16 ℃ for 12 hours, the bacteria were collected by centrifugation and resuspended in Balance Buffer, the supernatant was obtained by ultrasonication and centrifugation of the cell membrane of the recombinant bacteria, and the total soluble protein of the recombinant bacteria was obtained by using pET-28a empty vector as a control before and after induction, as shown in FIG. 3, in which 1 to 4 in the figure were soybean protein Glyma15g12170.1 (named protein No. 12 in this example), soybean protein Glyma15g12170.1 after induction, BL21 before induction, and BL21 after induction (theoretical molecular weight 23.8KDa) as an electrophoresis pattern. As a result, it was found that expression of the recombinant bacteria was detected by SDS-PAGE electrophoresis.

Example 6 Induction expression, isolation and purification of Soy protein

The strain containing the recombinant plasmid was expanded and cultured to 500 ml LB liquid medium containing Kana stock solution of 1mM final concentration, cultured to OD600 of about 0.6, added with IPTG stock solution of 0.1mM final concentration, induced overnight at 16 ℃ at 150rmp, the induced cells were collected by centrifugation, resuspended with Balance Buffer, disrupted by sonication, centrifuged at 4 ℃ for 30min at 10,000rmp, and the supernatant was collected for subsequent separation and purification.

The protein was purified by affinity chromatography, setting the A pump flow rate at 3m L/min. The ethanol adsorbed to Sepharose was washed away with about 50mL of deionized water. Residual protein on the column was washed off with about 30mL of 0.5M sodium hydroxide. The sodium hydroxide was washed with about 80mL of deionized water. About 30mL of nickel sulfate was loaded and nickel ions were bound to Sepharose. Unbound nickel ions were washed away with about 70mL of deionized water. The column was equilibrated with approximately 50mL Balance Buffer. And (4) loading the protein solution. Proteins not bound to nickel ions were washed out with about 50mLBalance Buffer. Regulating the flow rate of the B pump to 10% (500 mM imidazole in the B pump) and washing off the proteins weakly bound with the nickel ions; gradually increasing B pump flow gradient elution and collecting protein. And (3) cleaning the purification column after protein collection, setting the flow of the pump B to be zero, and washing the purification column by using deionized water until the conductivity is zero. Nickel ions were washed away with 60mL EDTA. The purification column was washed with deionized water until the conductivity was zero. Residual protein in the column was washed off with 60mL of 0.5M sodium hydroxide. The purification column was washed with deionized water until the conductivity was zero. The column was sealed with 20% ethanol to prevent bacterial growth and the column was stored at 4 ℃. The theoretical molecular weight of soybean is 23.8 KDa.

And removing imidazole in the protein solution by using a protein desalting column. The flow rate of the A pump was set at 4mL/min, and about 50mL of deionized water was used to wash off the ethanol in the desalting column. The volume of the protein on the sample is less than 10mL, and the separation effect is influenced by the overlarge volume. And eluting the target protein by using deionized water. After desalting the protein, the desalting column was washed, and the residual protein was washed with 0.2M sodium hydroxide and the desalting column was activated. Washing with about 50m L deionized water to remove sodium hydroxide; sealing the column with 20% ethanol to prevent bacterial growth, and desalting the column at 4 deg.C.

The desalted protein solution was freeze-dried, redissolved with PBS buffer, mixed with 1U thrombin and 1mg of fusion protein according to the quantitative results, and digested at 4 ℃ overnight. The thrombin digestion product is separated and purified by a molecular sieve. Set pump flow rate 1mL/min, wash 1 column volume with deionized water. 2mL of the protein is loaded, and the target protein is eluted by deionized water. After the protein of interest is collected, the molecular sieve is washed and eluted with 0.2M sodium hydroxide for about 2 column volumes. Washing with deionized water until the conductivity peak is zero. The column was packed with 20% ethanol containing 0.2M sodium acetate to prevent bacterial growth.

In order to obtain the protein with function verification in the implementation, the total soluble protein in the recombinant bacteria expressed in escherichia coli is subjected to nickel ion affinity chromatography to separate and purify the target protein, and the parameters of a chromatographic column are as follows: column length: 20 cm; diameter: 16mm, filler: chemical Sepharose Fast Flow 4BTM, packing volume: 10 mL; the manufacturer: amersham Biosciences flow rate was 3 mL/min.

Example 7: determination of the survival Rate of recombinant bacteria under 500mM salt stress

Inoculating the recombinant plasmid transformed bacteria and the empty vector transformed bacteria into 5ml LB liquid medium containing sodium bicarbonate (10mg/ml) with the final concentration of 1mM, and culturing in a shaker at 200rpm/min and 37 ℃ overnight; transferring to 5ml LB liquid culture medium containing 1mM sodium bicarbonate (10mg/ml) at final concentration the next day, and culturing in a shaker at 37 deg.C at 200 r/min; expanding the concentration of the bacterial liquid to OD₆₀₀After 0.6-0.8 (OD of recombinant plasmid transformed bacteria and empty vector transformed bacteria)₆₀₀Adjusted to be consistent), adding 100mM IPTG at a final concentration of 0.2 ‰, inducing in 200r/min 30 deg.C shaking table for 4 hr, and measuring OD₆₀₀(recombinant plasmid-transformed bacteria and empty vector-transformed bacteria OD_{600 need}Adjusted to be consistent) and recorded.

After diluting the induced bacterial liquid by 10, 100 and 1000 times, 100ul of the liquid was applied to a high-salt LB solid medium (containing Carna at a final concentration of 1mM (10. mu.g/mL, a ratio of 1mM at a final concentration), IPTG at a final concentration of 4.8. mu.g/mL) and normal LB solid medium (containing Carna at a final concentration of 1mM (10. mu.g/mL) and IPTG at a final concentration of 4.8. mu.g/mL)) with 500mM NaCl, respectively; after the normal LB solid culture medium is cultured for 15h in an incubator at 37 ℃, the number of bacterial plaques on a plate capable of counting is recorded (the number of bacterial colonies on the plate is effective data between 30 and 300), after the high-salt culture medium is cultured for 48h in the incubator at 37 ℃, the number of bacterial plaques is recorded (the number of bacterial colonies on the plate is effective data between 30 and 300), finally, the survival rate is calculated, and a survival rate bar chart is drawn.

FIGS. 4 and 5 are graphs showing the growth results of the empty vector-transformed bacteria and the recombinant plasmid-transformed bacteria in different concentrations of the high-salt LB solid medium and the normal solid medium, respectively, wherein 10⁰、10^-1、10^-2、10^-3The dilution factor is 1, 10, 100 and 1000. FIG. 6 shows the survival of empty vector-transformed bacteria (shown by the abscissa pET-28 a) and recombinant plasmid-transformed bacteria (shown by the abscissa LOC 100814402)Rate bar graph.

In the embodiment, the recombinant bacteria are diluted after induction and respectively coated on normal and high-salt plates, and the number of bacterial plaques is counted (the number of bacterial colonies on the plates is between 30 and 300 and is effective data); the survival rate of the recombinant bacteria is calculated by taking the unloaded recombinant bacteria as a control, and whether the corresponding protein in the recombinant bacteria has salt tolerance can be proved. The result shows that the survival rate of the recombinant bacteria expressing the soybean protein Glyma15g12170.1 is obviously higher than that of the unloaded recombinant bacteria (as shown in figure 6) compared with that of the unloaded recombinant bacteria, and in addition, the point plate is also carried out, so that the survival rate of the recombinant bacteria expressing the soybean protein Glyma15g12170.1 is more intuitively shown to be higher than that of the unloaded recombinant bacteria (as shown in figures 4 and 5), and the protein is proved to have certain salt tolerance.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> Shenzhen university

<120> use of soybean protein

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>504

<212>DNA

<213>Glycine max

<400>1

atggccagcg ttgaggttgc acagcaaaca ccaacaacag ttccagaaaa tgaaacaacc 60

gaggtaagca agacccagga aacaacccca gtcactgagg ctcctgcaac agaacaacca 120

gcagctgagg ttcctgcaac agaacaacca gccgctgagg ctcctgcccc agaatcaacc 180

accgaagcac caaaggaaga aaccaccgag gcaccaacag aaacagtaga aaaaacaact 240

acagaagtag ccccagagga gcctaaagaa gttccagttg agaccgagga ggtggtggca 300

aaggagacag aggaagagaa gccagcagaa gagaaatcag aggagaaaac tgaagaagtg 360

aaagaagaag cagaggagcc taaagaaact actgaaacag aatcagcagc agcagcacca 420

ccagcaacca cagaggaaga gaacaaacca gctgagtcag ttgaaacccc agtagaggtt 480

cctgttgaga agactgaagc ttag 504

<210>2

<211>27

<212>DNA

<213> Artificial sequence

<400>2

cgcccatatg gccagcgttg aggttgc 27

<210>3

<211>31

<212>DNA

<213> Artificial sequence

<400>3

accgctcgag ctaagcttca gtcttctcaa c 31

<210>4

<211>5797

<212>DNA

<213> Artificial sequence

<400>4

atccggatat agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa 60

ggggttatgc tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt 120

tgttagcagc cggatctcag tggtggtggt ggtggtgctc gagctaagct tcagtcttct 180

caacaggaac ctctactggg gtttcaactg actcagctgg tttgttctct tcctctgtgg 240

ttgctggtgg tggtgctgct gctgattctg tttcagtagt ttctttaggc tcctctgctt 300

cttctttcac ttcttcagtt ttctcctctg atttctcttc tgctggcttc tcttcctctg 360

tctcctttgc caccacctcc tcggtctcaa ctggaacttc tttaggctcc tctggggcta 420

cttctgtagt tgttttttct actgtttctg ttggtgcctc ggtggtttct tcctttggtg 480

cttcggtggt tgattctggg gcaggagcct cagcggctgg ttgttctgtt gcaggaacct 540

cagctgctgg ttgttctgtt gcaggagcct cagtgactgg ggttgtttcc tgggtcttgc 600

ttacctcggt tgtttcattt tctggaactg ttgttggtgt ttgctgtgca acctcaacgc 660

tggccatatg gctgccgcgc ggcaccaggc cgctgctgtg atgatgatga tgatggctgc 720

tgcccatggt atatctcctt cttaaagtta aacaaaatta tttctagagg ggaattgtta 780

tccgctcaca attcccctat agtgagtcgt attaatttcg cgggatcgag atctcgatcc 840

tctacgccgg acgcatcgtg gccggcatca ccggcgccac aggtgcggtt gctggcgcct 900

atatcgccga catcaccgat ggggaagatc gggctcgcca cttcgggctc atgagcgctt 960

gtttcggcgt gggtatggtg gcaggccccg tggccggggg actgttgggc gccatctcct 1020

tgcatgcacc attccttgcg gcggcggtgc tcaacggcct caacctacta ctgggctgct 1080

tcctaatgca ggagtcgcat aagggagagc gtcgagatcc cggacaccat cgaatggcgc 1140

aaaacctttc gcggtatggc atgatagcgc ccggaagaga gtcaattcag ggtggtgaat 1200

gtgaaaccag taacgttata cgatgtcgca gagtatgccg gtgtctctta tcagaccgtt 1260

tcccgcgtgg tgaaccaggc cagccacgtt tctgcgaaaa cgcgggaaaa agtggaagcg 1320

gcgatggcgg agctgaatta cattcccaac cgcgtggcac aacaactggc gggcaaacag 1380

tcgttgctga ttggcgttgc cacctccagt ctggccctgc acgcgccgtc gcaaattgtc 1440

gcggcgatta aatctcgcgc cgatcaactg ggtgccagcg tggtggtgtc gatggtagaa 1500

cgaagcggcg tcgaagcctg taaagcggcg gtgcacaatc ttctcgcgca acgcgtcagt 1560

gggctgatca ttaactatcc gctggatgac caggatgcca ttgctgtgga agctgcctgc 1620

actaatgttc cggcgttatt tcttgatgtc tctgaccaga cacccatcaa cagtattatt 1680

ttctcccatg aagacggtac gcgactgggc gtggagcatc tggtcgcatt gggtcaccag 1740

caaatcgcgc tgttagcggg cccattaagt tctgtctcgg cgcgtctgcg tctggctggc 1800

tggcataaat atctcactcg caatcaaatt cagccgatag cggaacggga aggcgactgg 1860

agtgccatgt ccggttttca acaaaccatg caaatgctga atgagggcat cgttcccact 1920

gcgatgctgg ttgccaacga tcagatggcg ctgggcgcaa tgcgcgccat taccgagtcc 1980

gggctgcgcg ttggtgcgga tatctcggta gtgggatacg acgataccga agacagctca 2040

tgttatatcc cgccgttaac caccatcaaa caggattttc gcctgctggg gcaaaccagc 2100

gtggaccgct tgctgcaact ctctcagggc caggcggtga agggcaatca gctgttgccc 2160

gtctcactgg tgaaaagaaa aaccaccctg gcgcccaata cgcaaaccgc ctctccccgc 2220

gcgttggccg attcattaat gcagctggca cgacaggttt cccgactgga aagcgggcag 2280

tgagcgcaac gcaattaatg taagttagct cactcattag gcaccgggat ctcgaccgat 2340

gcccttgaga gccttcaacc cagtcagctc cttccggtgg gcgcggggca tgactatcgt 2400

cgccgcactt atgactgtct tctttatcat gcaactcgta ggacaggtgc cggcagcgct 2460

ctgggtcatt ttcggcgagg accgctttcg ctggagcgcg acgatgatcg gcctgtcgct 2520

tgcggtattc ggaatcttgc acgccctcgc tcaagccttc gtcactggtc ccgccaccaa 2580

acgtttcggc gagaagcagg ccattatcgc cggcatggcg gccccacggg tgcgcatgat 2640

cgtgctcctg tcgttgagga cccggctagg ctggcggggt tgccttactg gttagcagaa 2700

tgaatcaccg atacgcgagc gaacgtgaag cgactgctgc tgcaaaacgt ctgcgacctg 2760

agcaacaaca tgaatggtct tcggtttccg tgtttcgtaa agtctggaaa cgcggaagtc 2820

agcgccctgc accattatgt tccggatctg catcgcagga tgctgctggc taccctgtgg 2880

aacacctaca tctgtattaa cgaagcgctg gcattgaccc tgagtgattt ttctctggtc 2940

ccgccgcatc cataccgcca gttgtttacc ctcacaacgt tccagtaacc gggcatgttc 3000

atcatcagta acccgtatcg tgagcatcct ctctcgtttc atcggtatca ttacccccat 3060

gaacagaaat cccccttaca cggaggcatc agtgaccaaa caggaaaaaa ccgcccttaa 3120

catggcccgc tttatcagaa gccagacatt aacgcttctg gagaaactca acgagctgga 3180

cgcggatgaa caggcagaca tctgtgaatc gcttcacgac cacgctgatg agctttaccg 3240

cagctgcctc gcgcgtttcg gtgatgacgg tgaaaacctc tgacacatgc agctcccgga 3300

gacggtcaca gcttgtctgt aagcggatgc cgggagcaga caagcccgtc agggcgcgtc 3360

agcgggtgtt ggcgggtgtc ggggcgcagc catgacccag tcacgtagcgatagcggagt 3420

gtatactggc ttaactatgc ggcatcagag cagattgtac tgagagtgca ccatatatgc 3480

ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc tcttccgctt 3540

cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact 3600

caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag 3660

caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata 3720

ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc 3780

cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg 3840

ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc 3900

tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg 3960

gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc 4020

ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga 4080

ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg 4140

gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa 4200

aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg 4260

tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt 4320

ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgaaca 4380

ataaaactgt ctgcttacat aaacagtaat acaaggggtg ttatgagcca tattcaacgg 4440

gaaacgtctt gctctaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat 4500

aaatgggctc gcgataatgt cgggcaatca ggtgcgacaa tctatcgatt gtatgggaag 4560

cccgatgcgc cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca 4620

gatgagatgg tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat 4680

tttatccgta ctcctgatga tgcatggtta ctcaccactg cgatccccgg gaaaacagca 4740

ttccaggtat tagaagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg 4800

ttcctgcgcc ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta 4860

tttcgtctcg ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgatttt 4920

gatgacgagc gtaatggctg gcctgttgaa caagtctgga aagaaatgca taaacttttg 4980

ccattctcac cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt 5040

gacgagggga aattaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac 5100

caggatcttg ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg 5160

ctttttcaaa aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg 5220

ctcgatgagt ttttctaaga attaattcat gagcggatac atatttgaat gtatttagaa 5280

aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccacctg aaattgtaaa 5340

cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca 5400

ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga tagggttgag 5460

tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg 5520

gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct aatcaagttt 5580

tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag 5640

agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc 5700

gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc 5760

gcttaatgcg ccgctacagg gcgcgtccca ttcgcca 5797

Claims

1. Use of soy protein as osmolyte regulator for increasing the salt tolerance of escherichia coli; wherein the coding sequence of the soybean protein is shown as SEQ ID NO. 1.

2. The use of claim 1, wherein the soy protein is prepared by a process comprising the steps of:

amplifying the coding sequence of the soy protein;

constructing a recombinant plasmid containing the coding sequence;

transforming the recombinant plasmid into a competent cell for induced expression;

and (4) carrying out protein separation and purification on the bacteria liquid after induction expression to obtain the soybean protein.

3. The use according to claim 2, wherein the primer pair for amplifying the coding sequence of the soy protein is as shown in SEQ ID No. 2 and SEQ ID No. 3; and/or

The template for amplifying the coding sequence of the soybean protein is soybean radicle cDNA.

4. The use according to claim 2, wherein the recombinant plasmid is obtained by recombining a protein expression vector PET-28a with the coding sequence of the soybean protein.

5. The use of claim 4, wherein the recombinant plasmid is prepared by a process comprising: carrying out double enzyme digestion treatment on the protein expression vector PET-28a by Nde I and Xho I, and then connecting the enzyme digestion product with the coding sequence of the soybean protein by utilizing T4 ligase.

6. The use according to claim 5, wherein the coding sequence of the soybean protein is ligated to the double-digested protein expression vector PET-28a in a molar ratio of 10: 1.

7. The use of claim 2, wherein the competent cell is an E.coli BL21Star competent cell.

8. The use of claim 2, wherein the step of inducing expression comprises: competent cells containing the recombinant plasmid were expanded and then induced with 150rmp at 16 ℃ by adding 1% IPTG stock solution.

9. The use of claim 2, wherein the protein separation and purification step comprises nickel ion affinity chromatography.