CN108841959A - A kind of oral cavity and head-neck malignant tumor neurological susceptibility prediction kit and system - Google Patents

Abstract

The present invention relates to a kind of oral cavities and head-neck malignant tumor neurological susceptibility to predict kit comprising following components：STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, STR-6 primer；Further, further include：Pcr amplification reaction liquid, LIZ-500 molecular weight internal standard, deionized formamide.Oral cavity of the present invention and head-neck malignant tumor neurological susceptibility prediction kit can be used for the diagnosis and neurological susceptibility prediction in oral cavity and head-neck malignant tumor.The present invention also provides a kind of oral cavity and head-neck malignant tumor neurological susceptibility forecasting systems.

Description

A kit and system for predicting susceptibility to oral cavity and head and neck malignancies

technical field

The present invention relates to the field of biomedicine. Specifically, it relates to a susceptibility prediction kit for oral cavity and head and neck malignancies and a susceptibility prediction system for oral cavity and head and neck malignancies. More specifically, the present invention relates to a kit for detecting STRs of genes related to the susceptibility to oral cavity and head and neck malignancies by means of short tandem repeats (Short tandem repeats, referred to as STR) site fragment analysis method, and through combined discriminant analysis Statistical method, in order to provide early warning of the susceptibility of oral cavity and head and neck malignant tumors of the subjects, and can also distinguish benign and malignant tumors of patients with oral cavity and head and neck tumors.

Background technique

Tumor is a disease closely related to genetics. To study the molecular genetic basis of tumors, and then propose tumor-specific genetic markers, it is hoped that it can be used for routine detection, clinical diagnosis, personalized treatment, and disease tracking after recovery. Etc. provides a simple and feasible method. However, the variability of individual patients and the crossover of biomolecular events related to different developmental stages have brought great difficulties to this work.

A large number of studies have shown that genetic polymorphisms of tumor-related genes play a key role in the occurrence and development of malignant tumors. However, the occurrence and development of tumor is a very complex process, and it is obviously impossible and unscientific to diagnose the disease by the change of a single molecular genetic marker. With the existing technical means, it is not possible to provide a more accurate early warning of tumor susceptibility only through genetic information, and the current early identification and prediction methods for benign and malignant tumors still need to be improved.

Contents of the invention

In order to solve the above-mentioned problems existing in the prior art, the present invention relates to the joint detection of multiple STR sites with high correlation with the occurrence of oral cavity and head and neck malignant tumors by STR site fragment analysis method, combined with the discriminant analysis statistical method, Early warning of susceptibility to oral and head and neck malignancies.

The present invention is based on the inventor's following discovery: the inventor analyzed the STRs of the genomic DNA of the oral cavity and head and neck malignant tumor subjects and the healthy control subjects, and found that a large number of oral cavity and head and neck malignant tumors Samples and control samples were verified, and it was found that the number of short tandem sequence repeats at each independent STR site had no significant correlation with the subject's cancer of the oral cavity and head and neck, while the number of short tandem sequence repeats at some specific STR sites There is a close relationship between the combination of the subject and the subject suffering from oral cavity and head and neck malignancies.

To this end, the present invention proposes a set of isolated STR loci that are highly associated with oral cavity and head and neck malignancies. According to an embodiment of the present invention, these isolated STR sites comprise the nucleotide sequences shown in STR-1 to STR-6 (Table 1). With the help of these isolated STR loci as a reference, it is possible to effectively predict the susceptibility to malignant tumors of the oral cavity and head and neck, or to distinguish benign and malignant tumors of the oral cavity and head and neck.

Table 1

Site code starting point Belonging gene short tandem sequence STR-1 X chromosome, position 66657655 AR CAG STR-2 Chromosome 4, position 55633758 Bat-25 T STR-3 Chromosome 5, position 111646983 D5S346 GT STR-4 Chromosome 6, position 151806531 ER1 TA STR-5 Chromosome 14, position 64253561 ER2 TG STR-6 Chromosome 4, position 154587748 FGA AAAG

For the detailed description of the above STR sites, those skilled in the art can obtain relevant databases (such as GeneBank, Nucleotide, etc.), and will not be repeated here. The inventors are surprised to find that by analyzing the cell genome of the subject to obtain the repetition times of the short tandem sequences of each of the above STR sites, and performing statistical analysis methods such as discriminant analysis with the number of repetitions as an independent variable, the oral cavity and scalp can be analyzed. Early warning of susceptibility to cervical cancer and identification of benign and malignant tumors of the oral cavity and head and neck.

On this basis, one of the technical problems solved by the present invention is to provide a susceptibility prediction kit for oral cavity and head and neck malignancies, which includes the following components: STR-1 primers, STR-2 primers, STR- 3 primers, STR-4 primer, STR-5 primer, and STR-6 primer, the above primers were respectively used to amplify the target fragments containing the short tandem sequences listed in Table 1, so as to determine the number of repetitions of the short tandem sequences.

Preferably, the oral cavity and head and neck cancer susceptibility prediction kit of the present invention further includes: PCR amplification reaction solution, LIZ-500 molecular weight internal standard, and deionized formamide.

In the oral cavity and head and neck cancer susceptibility prediction kit of the present invention, preferably, the above-mentioned STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, STR-6 primer The sequences are shown in Table 2 below. More preferably, the concentration of each of the above primers is 10 μM:

Table 2

In Table 2, HEX, FAM, and ROX are all fluorescent groups for labeling the 5' end, HEX is hexachloro-6-methylfluorescein, FAM is 6-carboxyfluorescein, and ROX is the ROX reference dye.

In the oral cavity and head and neck cancer susceptibility prediction kit of the present invention, preferably, the PCR amplification reaction solution is a mixture of the following reagents: TaqDNA polymerase (5U/μL), Tris-HCl (100mM, in pH 8.8 at 25°C), KCl (500 mM), ethylphenylpolyethylene glycol (0.8% (v/v)), MgCl ₂ (25 mM), dNTPs (10 mM), deionized water.

More preferably, the PCR amplification reaction solution is stored at -20°C.

In the oral cavity and head and neck cancer susceptibility prediction kit of the present invention, preferably, the LIZ-500 molecular weight internal standard can be stored at -20°C;

In the oral cavity and head and neck cancer susceptibility prediction kit of the present invention, preferably, the deionized formamide can be stored at 2-8°C.

Preferably, the oral cavity and head and neck cancer susceptibility prediction kit of the present invention further includes instructions for use.

The instruction manual records the method of using the above-mentioned susceptibility prediction kit for oral cavity and head and neck malignancies, which includes the following steps:

(1) extract sample DNA;

(2) PCR reaction

(2-1) Take out STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, STR-6 primer, PCR amplification reaction solution from the refrigerator, equilibrate to room temperature, each After the components are fully dissolved, quickly centrifuge for 10 seconds;

(2-2) Take 30-300ng sample DNA, add 60μL of PCR amplification reaction solution, add deionized water to make up to 115.2μL, mix well, and centrifuge quickly for 10 seconds, and then divide the mixture into 19.6μL/well 6 PCR reaction tubes;

(2-3) Add STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, and STR-6 primer to step (2-2) at 0.8 μL/well In 6 PCR reaction tubes; cover the PCR reaction tube cap, record the sample loading situation, centrifuge quickly for 10 seconds, then transfer the PCR reaction tube to the corresponding position of the sample slot of the PCR amplification instrument, and record the order of placement, and start PCR amplification Reaction; amplification reaction conditions are: 95°C for 3 minutes; 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds, 10 cycles; 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, 20 cycles ; 6 minutes at 72°C to obtain 6 sets of PCR amplification products;

(3) STR fragment analysis

(3-1) Take 990 μL of deionized formamide, add 10 μL of LIZ-500 molecular weight internal standard, mix well, and centrifuge quickly for 10 seconds, add 10 μL/well to the sequencing reaction tube respectively, and centrifuge quickly for 10 seconds;

(3-2) Add the above 6 groups of PCR amplification products to 6 sequencing reaction tubes respectively at 1 μL/well, and centrifuge quickly for 10 seconds; Heating for 5 minutes, immediately place the sequencing reaction tube on the ice-water mixture to rapidly cool to 0°C, and centrifuge for 10 seconds; then transfer the sequencing reaction tube to the corresponding position of the sample tank of the STR site fragment analyzer, and record the placement Sequence for fragment analysis and detection;

(4) Result analysis and judgment

(4-1) According to the fragment analysis results, record the fragment lengths of the two alleles at each site of STR-1, STR-2, STR-3, STR-4, STR-5, and STR-6 respectively:

The smaller fragment length value among the two alleles of STR-1 is recorded as L ₁ , and the larger fragment length value among the two alleles of STR-1 is recorded as L ₂ ;

The smaller fragment length value among the two alleles of STR-2 is recorded as L ₃ , and the larger fragment length value among the two alleles of STR-2 is recorded as L ₄ ;

The smaller fragment length value among the two alleles of STR-3 is recorded as L ₅ , and the larger fragment length value among the two alleles of STR-3 is recorded as L ₆ ;

The smaller fragment length value among the two alleles of STR-4 is recorded as L ₇ , and the larger fragment length value among the two alleles of STR-4 is recorded as L ₈ ;

The smaller fragment length value among the two alleles of STR-5 is recorded as L ₉ , and the larger fragment length value among the two alleles of STR-5 is recorded as L ₁₀ ;

The smaller fragment length value among the two alleles of STR-6 is recorded as L ₁₁ , and the larger fragment length value among the two alleles of STR-6 is recorded as L ₁₂ ;

(4-2) The number of repetitions of the short tandem sequence is calculated according to the length of the fragment and the following formula, denoted as X ₁ -X ₁₂ , where round represents rounding to an integer:

X ₁ =round[(L ₁ -191)/3]; X ₂ =round[(L ₂ -191)/3];

X ₃ =round(L ₃ -379); X ₄ =round(L ₄ -379);

X ₅ = round[(L ₅ -202)/2]; X ₆ = round[(L ₆ -202)/2];

X ₇ = round[(L ₇ -359)/2]; X ₈ = round[(L ₈ -359)/2];

X ₉ =round[(L ₉ -278)/2]; X ₁₀ =round[(L ₁₀ -278)/2];

X ₁₁ =round[(L ₁₁ -200)/4]; X ₁₂ =round[(L ₁₂ -200)/4];

(4-3) Substituting the number of repetitions of the above-mentioned short tandem sequence into the pre-set discriminant function:

F _HNC ＝8.338X ₁ -5.839X ₂ +9.039X ₃ +82.475X ₄ +1.717X ₅ +3.121X ₆ +0.525X ₇ +4.394X ₈ +1.202X ₉ -5.911X ₁₀ +2.864X ₁₁ +7.707X ₁₂ -2.238X ₁₃ -1262.984

F _HNN ＝8.432X ₁ -5.903X ₂ +8.883X ₃ +83.361X ₄ +1.452X ₅ +3.054X ₆ +0.502X ₇ +4.228X ₈ +1.046X ₉ -5.766X ₁₀ +2.850X ₁₁ +7.293X ₁₂ -4.865X ₁₃ -1265.756

Wherein, if the subject is female, then X ₁₃ =0, if the subject is male, then X ₁₃ =1;

(4-4) Prediction of susceptibility to oral and head and neck malignancies:

Comparing the F _HNC value and F _HNN value, if F _HNC > F _HNN , it is predicted that the probability of the subject suffering from oral cavity and head and neck cancer is ≥ 75.0%; if F _HNC ≤ F _HNN , it is predicted that the subject will not suffer from oral cancer And the probability of head and neck cancer ≥ 75.0%.

In the present invention,

Preferably, the extraction of sample DNA in step (1) can use a purchased commercial genomic DNA extraction kit and operate according to the instructions of the kit. The sample can be the whole blood of the subject, oral swab or oral tissue, preferably the whole blood of the subject.

Preferably, all centrifuges in the method are used at a rotational speed of preferably 3000 g/min.

The probability of suffering from oral cavity and head and neck malignant tumors mentioned in the present invention is the sum of the probability of suffering from oral cavity and head and neck malignant tumors and the probability of suffering from oral cavity, head and neck malignant tumors in the future. Therefore, it can be used not only for the diagnosis of oral and head and neck malignant tumors, but also for the risk warning of oral and head and neck malignant tumors in the future. Regular and regular physical examinations can reduce the risk of oral and head and neck cancers.

The second technical problem to be solved by the present invention is to provide a method for predicting the susceptibility of oral cavity and head and neck malignant tumors, that is, to use the above kit and operate according to the method described in the instructions.

The third technical problem solved by the present invention is to provide the application of the oral cavity and head and neck cancer susceptibility prediction kit in the preparation of oral cavity and head and neck cancer diagnosis products.

The fourth technical problem solved by the present invention is to provide a susceptibility prediction system for oral cavity and head and neck malignancies, which includes:

A device for obtaining the number of repetitions of the STR site short tandem sequence of the sample DNA;

A data processing and judging device, which includes the following modules:

The data input module is used to input the age, gender, and repeat times of the short tandem sequence of the subject;

The database management module is used for the operation management of data storage, modification, deletion, query and printing;

The data calculation module is used to calculate the result of the discriminant function according to the number of repetitions of the STR site short tandem sequence in the data input module;

The analysis, discrimination and result output module is used to compare the results of the discriminant function, so as to predict the susceptibility of oral cavity and head and neck malignant tumors, and output the results.

in,

The number of repetitions of the short tandem sequence at the STR site is the number of repetitions of the following 6 pairs of short tandem sequences at the STR site:

Site code starting point Belonging gene short tandem sequence STR-1 X chromosome, position 66657655 AR CAG STR-2 Chromosome 4, position 55633758 Bat-25 T STR-3 Chromosome 5, position 111646983 D5S346 GT STR-4 Chromosome 6, position 151806531 ER1 TA STR-5 Chromosome 14, position 64253561 ER2 TG STR-6 Chromosome 4, position 154587748 FGA AAAG

The discriminant functions include:

The first discriminant function F _HNC =8.338X ₁ -5.839X ₂ +9.039X ₃ +82.475X ₄ +1.717X ₅ +3.121X ₆ +0.525X ₇ +4.394X ₈ +1.202X ₉ -5.911X ₁₀ +2.864X ₁₁ +7.707X ₁₂ -2.238X ₁₃ -1262.984

The second discriminant function F _HNN =8.432X ₁ -5.903X ₂ +8.883X ₃ +83.361X ₄ +1.452X ₅ +3.054X ₆ +0.502X ₇ +4.228X ₈ +1.046X ₉ -5.766X ₁₀ +2.850X ₁₁ +7.293X ₁₂ -4.865X ₁₃ -1265.756

In the discriminant function,

X1 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR- ₁ ;

X2 is the number of repetitions of the short tandem sequence of the larger fragment in the _two alleles of STR-1;

X ₃ is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR-2;

_X4 is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-2;

X5 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR- ₃ ;

X6 is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR- ₃ ;

X7 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR- ₄ ;

_X8 is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-4;

_X9 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR-5;

X ₁₀ is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-5;

X ₁₁ is the repetition number of the short tandem sequence of the smaller fragment in the two alleles of STR-6;

X ₁₂ is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-6;

If the subject is female, then X ₁₃ =0, and if the subject is male, then X ₁₃ =1.

Among them, X ₁ ^- X ₁₂ is calculated according to the fragment length and the following formula, where round means rounding to an integer:

X ₁ =round[(L ₁ -191)/3]; X ₂ =round[(L ₂ -191)/3];

X ₃ =round(L ₃ -379); X ₄ =round(L ₄ -379);

X ₅ = round[(L ₅ -202)/2]; X ₆ = round[(L ₆ -202)/2];

X ₇ = round[(L ₇ -359)/2]; X ₈ = round[(L ₈ -359)/2];

X ₉ =round[(L ₉ -278)/2]; X ₁₀ =round[(L ₁₀ -278)/2];

X ₁₁ =round[(L ₁₁ -200)/4]; X ₁₂ =round[(L ₁₂ -200)/4];

In X ₁ ^- X ₁₂ , L ₁ is the smaller fragment length value among the two alleles of STR-1, and L ₂ is the larger fragment length value among the two alleles of STR-1;

L ₃ is the smaller fragment length value among the two alleles of STR-2, and L ₄ is the larger fragment length value among the two alleles of STR-2;

L ₅ is the smaller fragment length value among the two alleles of STR-3, and L ₆ is the larger fragment length value among the two alleles of STR-3;

L ₇ is the smaller fragment length value among the two alleles of STR-4, and L ₈ is the larger fragment length value among the two alleles of STR-4;

L ₉ is the smaller fragment length value among the two alleles of STR-5, and L ₁₀ is the larger fragment length value among the two alleles of STR-5;

L ₁₁ is the smaller fragment length value among the two alleles of STR-6, and L ₁₂ is the larger fragment length value among the two alleles of STR-6;

The analysis, discrimination and result output module compares the calculation result of the first discriminant function F _HNC with the calculation result of the second discriminant function F _HNN , and if F _HNC >F _HNN , then output "the subject suffers from oral cavity and head and neck disease". If F _HNC ≤ F _HNN , then output the prediction result of “the probability of the subject not suffering from oral cavity and head and neck cancer ≥ 75.0%”.

The device for obtaining the number of repetitions of the STR site short tandem sequence of the sample DNA may include a STR site fragment analyzer, a PCR amplification instrument, etc.; the data processing and determination device may be a computer or other equipment.

The fifth technical problem solved by the present invention is to provide the oral cavity and head and neck cancer susceptibility prediction system to be used in the preparation of oral cavity and head and neck malignant tumor prediction products, oral cavity and head and neck malignant tumor diagnosis products, oral cavity and head and neck cancer Applications in health supplement products.

The sixth technical problem solved by the present invention is to provide a product for predicting oral cavity and head and neck malignant tumors, a product for diagnosing oral cavity and head and neck malignant tumors, or an auxiliary product for oral cavity and head and neck health, which includes The oral cavity and head and neck cancer susceptibility prediction system.

The sample used in the present invention is human genome DNA, and in theory, human genome DNA will not change during a person's lifetime. Human genome DNA encodes all life activities of human beings, so in theory, by detecting genome DNA, the risk of a subject suffering from a certain disease can be predicted early, even at birth. The present invention is based on this theory, so using The kit and system of the present invention can not only play the role of early warning, but also play the role of diagnosis.

The occurrence and development of tumor is a very complex process. To study the molecular genetic basis of tumors, it is hoped that it can provide simple and feasible methods for routine detection, clinical diagnosis, personalized treatment, and follow-up of the disease after recovery. However, the variability of individual patients and the crossover of biomolecular events related to different developmental stages have brought great difficulties to this work. It is obviously impossible and unscientific to use single molecular genetic changes to diagnose tumors. The inventor applied modern molecular biology techniques to jointly analyze multiple STRs of the subject's genomic DNA, combined with statistical analysis methods such as discriminant analysis, thereby inventing an early warning system for the susceptibility of oral cavity and head and neck malignancies. A kit for differentiating benign from malignant tumors of the oral cavity and head and neck.

Description of drawings

Fig. 1 is a schematic diagram of the modules contained in the data processing and determination device in the oral cavity and head and neck cancer susceptibility prediction system of the present invention.

Detailed ways

The specific implementation manner of the present invention will be described below in conjunction with the accompanying drawings and examples, so as to better understand the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. Embodiments of the present invention are described in detail below, examples of which are shown in the drawings, wherein the same or similar reference numerals designate the same or similar elements or elements having the same or similar functions throughout. The embodiments described below by referring to the figures are exemplary only for explaining the present invention and should not be construed as limiting the present invention.

The PCR amplification instrument in the embodiment is the Mastercycler nexus amplification instrument (purchased from U.S. eppendorf company);

The STR site fragment analyzer in the embodiment is a 3730XL sequence analyzer (purchased from ABI, USA);

The DNA extraction kit in the embodiment is a blood DNAout kit (purchased from Beijing Tianenze Company);

The rotational speed of all the centrifuges in the examples is 3000g/min.

Example 1 A Prediction System for Susceptibility to Malignant Tumors of the Mouth and Head and Neck

A susceptibility prediction system for oral cavity and head and neck malignancies, comprising:

A device for obtaining the number of repetitions of the STR site short tandem sequence of the sample DNA;

Data processing and judging device, it comprises following module (as Fig. 1):

The data input module is used to input the age, gender, and repeat times of the short tandem sequence of the subject;

The database management module is used for the operation management of data storage, modification, deletion, query and printing;

The data calculation module is used to calculate the result of the discriminant function according to the number of repetitions of the STR site short tandem sequence in the data input module;

The analysis, discrimination and result output module is used to compare the results of the discriminant function, so as to predict the susceptibility of oral cavity and head and neck malignant tumors, and output the results.

in,

The number of repetitions of the short tandem sequence at the STR site is the number of repetitions of the following 6 pairs of short tandem sequences at the STR site:

The discriminant functions include:

The first discriminant function F _HNC =8.338X ₁ -5.839X ₂ +9.039X ₃ +82.475X ₄ +1.717X ₅ +3.121X ₆ +0.525X ₇ +4.394X ₈ +1.202X ₉ -5.911X ₁₀ +2.864X ₁₁ +7.707X ₁₂ -2.238X ₁₃ -1262.984

The second discriminant function F _HNN =8.432X ₁ -5.903X ₂ +8.883X ₃ +83.361X ₄ +1.452X ₅ +3.054X ₆ +0.502X ₇ +4.228X ₈ +1.046X ₉ -5.766X ₁₀ +2.850X ₁₁ +7.293X ₁₂ -4.865X ₁₃ -1265.756

In the discriminant function,

X1 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR- ₁ ;

X2 is the number of repetitions of the short tandem sequence of the larger fragment in the _two alleles of STR-1;

X ₃ is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR-2;

_X4 is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-2;

X5 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR- ₃ ;

X6 is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR- ₃ ;

X7 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR- ₄ ;

_X8 is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-4;

_X9 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR-5;

X ₁₀ is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-5;

X ₁₁ is the repetition number of the short tandem sequence of the smaller fragment in the two alleles of STR-6;

X ₁₂ is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-6;

If the subject is female, then X ₁₃ =0, and if the subject is male, then X ₁₃ =1.

Among them, X ₁ ^- X ₁₂ is calculated according to the fragment length and the following formula, where round means rounding to an integer:

X ₁ =round[(L ₁ -191)/3]; X ₂ =round[(L ₂ -191)/3];

X ₃ =round(L ₃ -379); X ₄ =round(L ₄ -379);

X ₅ = round[(L ₅ -202)/2]; X ₆ = round[(L ₆ -202)/2];

X ₇ = round[(L ₇ -359)/2]; X ₈ = round[(L ₈ -359)/2];

X ₉ =round[(L ₉ -278)/2]; X ₁₀ =round[(L ₁₀ -278)/2];

X ₁₁ =round[(L ₁₁ -200)/4]; X ₁₂ =round[(L ₁₂ -200)/4];

In X ₁ ^- X ₁₂ , L ₁ is the smaller fragment length value among the two alleles of STR-1, and L ₂ is the larger fragment length value among the two alleles of STR-1;

L ₃ is the smaller fragment length value among the two alleles of STR-2, and L ₄ is the larger fragment length value among the two alleles of STR-2;

L ₅ is the smaller fragment length value among the two alleles of STR-3, and L ₆ is the larger fragment length value among the two alleles of STR-3;

L ₇ is the smaller fragment length value among the two alleles of STR-4, and L ₈ is the larger fragment length value among the two alleles of STR-4;

L ₉ is the smaller fragment length value among the two alleles of STR-5, and L ₁₀ is the larger fragment length value among the two alleles of STR-5;

L ₁₁ is the smaller fragment length value among the two alleles of STR-6, and L ₁₂ is the larger fragment length value among the two alleles of STR-6;

The analysis, discrimination and result output module compares the calculation result of the first discriminant function F _HNC with the calculation result of the second discriminant function F _HNN , and if F _HNC >F _HNN , then output "the subject suffers from oral cavity and head and neck disease". If F _HNC ≤ F _HNN , then output the prediction result of “the probability of the subject not suffering from oral cavity and head and neck cancer ≥ 75.0%”.

Example 2 A kit for predicting susceptibility to oral cavity and head and neck malignancies

A kit for predicting susceptibility to oral cavity and head and neck malignancies, comprising the following components: STR-1 primers, STR-2 primers, STR-3 primers, STR-4 primers, STR-5 primers, and STR-6 primers , PCR amplification reaction solution, LIZ-500 molecular weight internal standard, deionized formamide, instruction manual.

The concentrations of the above STR-1 primers, STR-2 primers, STR-3 primers, STR-4 primers, STR-5 primers, and STR-6 primers are all 10 μM, and the primer sequences are shown in the following table:

The PCR amplification reaction solution is a mixture of the following reagents: TaqDNA polymerase (5U/μL), Tris-HCl (100mM, pH 8.8 at 25°C), KCl (500mM), ethylphenyl polyethylene glycol (0.8 % (v/v)), MgCl ₂ (25 mM), dNTP (10 mM), deionized water.

The PCR amplification reaction solution is stored at -20°C; the LIZ-500 molecular weight internal standard is stored at -20°C; and the deionized formamide is stored at 2-8°C.

The kit above also includes instructions for use.

Example 3 Using the system of Example 1 and the kit of Example 2 to predict the risk of the subject suffering from oral cavity and head and neck cancer

Subject: Male, 64 years old, visited the Department of Otorhinolaryngology, China-Japan Friendship Hospital of Jilin University. After fully informing the purpose and purpose of the examination, and on the premise of his willingness, he signed an informed consent and collected 1mL of anticoagulant blood through a peripheral vein. .

Use the kit of embodiment 2, carry out the following steps according to the method recorded on the kit instruction manual:

(1) Extract sample DNA: Use a DNA extraction kit to extract blood genomic DNA;

(2) PCR reaction

(2-1) Take out STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, STR-6 primer, PCR amplification reaction solution from the refrigerator, equilibrate to room temperature, each After the components are fully dissolved, quickly centrifuge for 10 seconds;

(2-2) Take 100ng of sample DNA, add 60μL of PCR amplification reaction solution, add deionized water to make up to 115.2μL, mix well, and centrifuge quickly for 10 seconds, and then divide the mixture into 6 pieces according to 19.6μL/well In the PCR reaction tube;

(2-3) Add STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, and STR-6 primer to step (2-2) at 0.8 μL/well In 6 PCR reaction tubes; cover the PCR reaction tube cap, record the sample loading situation, centrifuge quickly for 10 seconds, then transfer the PCR reaction tube to the corresponding position of the sample slot of the PCR amplification instrument, and record the order of placement, and start PCR amplification Reaction; amplification reaction conditions are: 95°C for 3 minutes; 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds, 10 cycles; 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, 20 cycles ; 6 minutes at 72°C to obtain 6 sets of PCR amplification products;

(3) STR fragment analysis

(3-1) Take 990 μL of deionized formamide, add 10 μL of LIZ-500 molecular weight internal standard, mix well, and centrifuge quickly for 10 seconds, add 10 μL/well to the sequencing reaction tube respectively, and centrifuge quickly for 10 seconds;

(3-2) Add the above 6 groups of PCR amplification products to 6 sequencing reaction tubes respectively at 1 μL/well, and centrifuge quickly for 10 seconds; Heating for 5 minutes, immediately place the sequencing reaction tube on the ice-water mixture to rapidly cool to 0°C, and centrifuge for 10 seconds; then transfer the sequencing reaction tube to the corresponding position of the sample tank of the STR site fragment analyzer, and record the placement Sequence for fragment analysis and detection;

(4) Result analysis and judgment

(4-1) According to the fragment analysis results, record the fragment lengths of the two alleles at each site of STR-1, STR-2, STR-3, STR-4, STR-5, and STR-6 respectively: STR-1 two The smaller fragment length value in the two alleles is recorded as L ₁ , the larger fragment length value in the two alleles of STR-1 is recorded as L ₂ ; the smaller fragment length in the two alleles of STR-2 The value is recorded as L ₃ , and the larger fragment length value of the two alleles of STR-2 is recorded as L ₄ ; the smaller fragment length value of the two alleles of STR-3 is recorded as L ₅ , and the fragment length value of the two The larger fragment length value among the two alleles is recorded as L ₆ ; the smaller fragment length value among the two alleles of STR-4 is recorded as L ₇ , and the larger fragment length among the two alleles of STR-4 The value is recorded as L ₈ ; the smaller fragment length value among the two alleles of STR-5 is recorded as L ₉ , and the larger fragment length value among the two alleles of STR-5 is recorded as L ₁₀ ; The smaller fragment length value among the two alleles is recorded as L ₁₁ , and the larger fragment length value among the two alleles of STR-6 is recorded as L ₁₂ ; the results show: L ₁ =268.23, L ₂ =301.26, L ₃ = 404.18, L ₄ = 404.18, L ₅ = 229.04, L ₆ = 246.20, L ₇ = 404.57, L ₈ = 404.57, L ₉ = 312.08, L ₁₀ = 324.94, L ₁₁ = 260.53, L ₁₂ = 264.09.

(4-2) Calculated according to the fragment length and the following formula, denoted as X ₁ -X ₁₂ , where round means rounding to an integer:

X ₁ =round[(L ₁ -191)/3]=26; X ₂ =round[(L ₂ -191)/3]=37;

X ₃ =round(L ₃ -379)=25; X ₄ =round(L ₄ -379)=25;

X ₅ =round[(L ₅ -202)/2]=14; X ₆ =round[(L ₆ -202)/2]=22;

X ₇ =round[(L ₇ -359)/2]=23; X ₈ =round[(L ₈ -359)/2]=23;

X ₉ =round[(L ₉ -278)/2]=17; X ₁₀ =round[(L ₁₀ -278)/2]=23;

X ₁₁ =round[(L ₁₁ -200)/4]=15; X ₁₂ =round[(L ₁₂ -200)/4]=16;

The patient is male, X ₁₃ =1.

Using the computer running the oral cavity and head and neck malignancy susceptibility prediction system described in Example 1, the susceptibility prediction of the subject suffering from oral cavity and head and neck malignancies:

Input the age, gender, and repeat times of the short tandem sequence of the STR site into the system through the data input module, and calculate the result of the discriminant function through the data calculation module:

The first discriminant function F _HNC =8.338X ₁ -5.839X ₂ +9.039X ₃ +82.475X ₄ +1.717X ₅ +3.121X ₆ +0.525X ₇ +4.394X ₈ +1.202X ₉ -5.911X ₁₀ +2.864X ₁₁ +7.707X ₁₂ -2.238X ₁₃ -1262.984＝1279.963

The second discriminant function F _HNN =8.432X ₁ -5.903X ₂ +8.883X ₃ +83.361X ₄ +1.452X ₅ +3.054X ₆ +0.502X ₇ +4.228X ₈ +1.046X ₉ -5.766X ₁₀ +2.850X ₁₁ +7.293X ₁₂ -4.865X ₁₃ -1265.756＝1277.208

After the analysis, discrimination and result output module compares the F _HNC value and the F _HNN value, if F _HNC >F _HNN , the prediction result of "the probability of the subject suffering from oral cavity and head and neck cancer ≥ 75.0%" is output.

The subject underwent a biopsy of the laryngeal tumor tissue after seeing a doctor, and the pathological examination confirmed that it was laryngeal squamous cell carcinoma, and the clinical diagnosis result was consistent with the prediction result of the kit of the present invention.

Example 4 Using the system of Example 1 and the kit of Example 2 to predict the risk of the subject suffering from oral cavity and head and neck cancer

Subject: Female, 62 years old, was treated at the Department of Otolaryngology, China-Japan Friendship Hospital of Jilin University. After being fully informed of the purpose and use of the examination, and on the premise of her willingness, she signed an informed consent and collected 1 mL of anticoagulant blood via a peripheral vein. .

Referring to the prediction method in Example 3, the blood samples were processed and tested in the same way, and the results showed: L ₁ =268.24, L ₂ =273.70, L ₃ =403.20, L ₄ =403.20, L ₅ =228.74, L ₆ =228.74, L ₇ =384.97, L ₈ =388.57, L ₉ =311.79, L ₁₀ =322.41, L ₁₁ =256.61, L ₁₂ =256.61.

Calculated according to the fragment length and the following formula, recorded as X ₁ -X ₁₂ , where round represents rounding to an integer:

X ₁ =round[(L ₁ -191)/3]=26; X ₂ =round[(L ₂ -191)/3]=28;

X ₃ =round(L ₃ -379)=24; X ₄ =round(L ₄ -379)=24;

X ₅ =round[(L ₅ -202)/2]=13; X ₆ =round[(L ₆ -202)/2]=13;

X ₇ =round[(L ₇ -359)/2]=13; X ₈ =round[(L ₈ -359)/2]=15;

X ₉ =round[(L ₉ -278)/2]=17; X ₁₀ =round[(L ₁₀ -278)/2]=22;

X ₁₁ =round[(L ₁₁ -200)/4]=14; X ₁₂ =round[(L ₁₂ -200)/4]=14;

The patient is female, X ₁₃ =0.

Using the computer running the oral cavity and head and neck malignancy susceptibility prediction system described in Example 1, the susceptibility prediction of the subject suffering from oral cavity and head and neck malignancies:

Input the age, gender, and repeat times of the short tandem sequence of the STR site into the system through the data input module, and calculate the result of the discriminant function through the data calculation module:

The first discriminant function F _HNC =8.338X ₁ -5.839X ₂ +9.039X ₃ +82.475X ₄ +1.717X ₅ +3.121X ₆ +0.525X ₇ +4.394X ₈ +1.202X ₉ -5.911X ₁₀ +2.864X ₁₁ +7.707X ₁₂ -2.238X ₁₃ -1262.984＝1160.663

The second discriminant function F _HNN =8.432X ₁ -5.903X ₂ +8.883X ₃ +83.361X ₄ +1.452X ₅ +3.054X ₆ +0.502X ₇ +4.228X ₈ +1.046X ₉ -5.766X ₁₀ +2.850X ₁₁ +7.293X ₁₂ -4.865X ₁₃ -1265.756＝1163.504

After the analysis, discrimination and result output module compares the F _HNC value and the F _HNN value, F _HNC ≤ F _HNN , and outputs the prediction result of "the probability that the subject will not suffer from oral cavity and head and neck cancer ≥ 75.0%".

The subject was diagnosed as chronic pharyngitis after seeing a doctor, and the clinical diagnosis result was consistent with the prediction result of the kit of the present invention.

Example 5 Using the system of Example 1 and the kit of Example 2 to predict the risk of the subject suffering from oral cavity and head and neck cancer

Subject: Male, 39 years old, was treated in the Department of Stomatology, China-Japan Friendship Hospital of Jilin University. Tongue tumor tissue biopsy was performed. After being fully informed of the purpose and use of the examination, and on the premise of his voluntary consent, he signed an informed consent form and underwent peripheral medical examination. 1 mL of anticoagulated blood was collected intravenously.

Referring to the prediction method in Example 3, the blood samples were processed and tested in the same way, and the results showed: L ₁ =260.25, L ₂ =260.25, L ₃ =402.1, L ₄ =402.1, L ₅ =229.03, L ₆ =246.15, L ₇ =386.85, L ₈ =400.5, L ₉ =312.16, L ₁₀ =318.59, L ₁₁ =256.99, L ₁₂ =260.51.

Calculated according to the fragment length and the following formula, recorded as X ₁ -X ₁₂ , where round represents rounding to an integer:

X ₁ =round[(L ₁ -191)/3]=23; X ₂ =round[(L ₂ -191)/3]=23;

X ₃ =round(L ₃ -379)=23; X ₄ =round(L ₄ -379)=23;

X ₅ =round[(L ₅ -202)/2]=14; X ₆ =round[(L ₆ -202)/2]=22;

X ₇ =round[(L ₇ -359)/2]=14; X ₈ =round[(L ₈ -359)/2]=21;

X ₉ =round[(L ₉ -278)/2]=17; X ₁₀ =round[(L ₁₀ -278)/2]=20;

X ₁₁ =round[(L ₁₁ -200)/4]=14; X ₁₂ =round[(L ₁₂ -200)/4]=15;

The patient is male, X ₁₃ =1.

Using the computer running the oral cavity and head and neck malignancy susceptibility prediction system described in Example 1, the susceptibility prediction of the subject suffering from oral cavity and head and neck malignancies:

Input the age, gender, and repeat times of the short tandem sequence of the STR site into the system through the data input module, and calculate the result of the discriminant function through the data calculation module:

The first discriminant function F _HNC =8.338X ₁ -5.839X ₂ +9.039X ₃ +82.475X ₄ +1.717X ₅ +3.121X ₆ +0.525X ₇ +4.394X ₈ +1.202X ₉ -5.911X ₁₀ +2.864X ₁₁ +7.707X ₁₂ -2.238X ₁₃ -1262.984＝1147.316

The second discriminant function F _HNN =8.432X ₁ -5.903X ₂ +8.883X ₃ +83.361X ₄ +1.452X ₅ +3.054X ₆ +0.502X ₇ +4.228X ₈ +1.046X ₉ -5.766X ₁₀ +2.850X ₁₁ +7.293X ₁₂ -4.865X ₁₃ -1265.756＝1144.247

After the analysis, discrimination and result output module compares the F _HNC value and the F _HNN value, if F _HNC >F _HNN , the prediction result of "the probability of the subject suffering from oral cavity and head and neck cancer ≥ 75.0%" is output.

The subject was diagnosed as squamous cell carcinoma of the tongue by pathological examination, and the clinical diagnosis result was consistent with the prediction result of the kit of the present invention.

Example 6 Using the system of Example 1 and the kit of Example 2 to predict the risk of the subject suffering from oral cavity and head and neck cancer

Subject: Female, 48 years old, visited the Department of Otorhinolaryngology, China-Japan Friendship Hospital of Jilin University, and underwent biopsy of laryngeal tumor tissue. After being fully informed of the purpose and use of the examination, and on the premise of her voluntary consent, she signed an informed consent form and passed 1 mL of anticoagulated blood was collected from peripheral vein.

Referring to the prediction method in Example 3, the blood samples were processed and tested in the same way, and the results showed: L ₁ =260.10, L ₂ =260.10, L ₃ =404.22, L ₄ =404.22, L ₅ =228.59, L ₆ =228.59, L ₇ =385.03, L ₈ =388.90, L ₉ =311.78, L ₁₀ =324.52, L ₁₁ =259.24, L ₁₂ =263.80.

Calculated according to the fragment length and the following formula, recorded as X ₁ -X ₁₂ , where round represents rounding to an integer:

X ₁ =round[(L ₁ -191)/3]=23; X ₂ =round[(L ₂ -191)/3]=23;

X ₃ =round(L ₃ -379)=25; X ₄ =round(L ₄ -379)=25;

X ₅ =round[(L ₅ -202)/2]=13; X ₆ =round[(L ₆ -202)/2]=13;

X ₇ =round[(L ₇ -359)/2]=13; X ₈ =round[(L ₈ -359)/2]=15;

X ₉ =round[(L ₉ -278)/2]=17; X ₁₀ =round[(L ₁₀ -278)/2]=23;

X ₁₁ =round[(L ₁₁ -200)/4]=15; X ₁₂ =round[(L ₁₂ -200)/4]=16;

The patient is female, X ₁₃ =0.

Using the computer running the oral cavity and head and neck malignancy susceptibility prediction system described in Example 1, the susceptibility prediction of the subject suffering from oral cavity and head and neck malignancies:

Input the age, gender, and repeat times of the short tandem sequence of the STR site into the system through the data input module, and calculate the result of the discriminant function through the data calculation module:

The first discriminant function F _HNC =8.338X ₁ -5.839X ₂ +9.039X ₃ +82.475X ₄ +1.717X ₅ +3.121X ₆ +0.525X ₇ +4.394X ₈ +1.202X ₉ -5.911X ₁₀ +2.864X ₁₁ +7.707X ₁₂ -2.238X ₁₃ -1262.984＝1268.725

The second discriminant function F _HNN =8.432X ₁ -5.903X ₂ +8.883X ₃ +83.361X ₄ +1.452X ₅ +3.054X ₆ +0.502X ₇ +4.228X ₈ +1.046X ₉ -5.766X ₁₀ +2.850X ₁₁ +7.293X ₁₂ -4.865X ₁₃ -1265.756＝1271.637

After the analysis, discrimination and result output module compares the F _HNC value and the F _HNN value, F _HNC ≤ F _HNN , and outputs the prediction result of "the probability that the subject will not suffer from oral cavity and head and neck cancer ≥ 75.0%".

The subject was diagnosed as laryngeal fibroma by pathological examination, which is a benign tumor, and its clinical diagnosis result is consistent with the prediction result of the kit of the present invention.

The above is a preferred embodiment of the present invention, not to limit the present invention, it should be pointed out that any change, modification, replacement and modification (such as: increase, decrease, change) made without departing from the principle and purpose of the present invention STR sites, using cells or tissues from other sources of the subject, using other similar statistical methods, etc.) should all be included in the scope of protection of the present invention.

SEQUENCE LISTING

<110> Jilin University

<120> A kit and system for predicting susceptibility to oral cavity and head and neck malignancies

<130>DI18-8161-XC47

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 18

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(18)

<223> STR-1 primer upstream primer

<400> 1

aggggctggga aggggtcta 18

<210> 2

<211> 19

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(19)

<223> STR-1 primer downstream primer

<400> 2

ggagaaccat cctcaccct 19

<210> 3

<211> 20

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(20)

<223> STR-2 Primer Upstream Primer

<400> 3

cgcctccaag aatgtaagtg 20

<210> 4

<211> 22

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(22)

<223> STR-2 primer downstream primer

<400> 4

aactcaagtc tatgcttcac cc 22

<210> 5

<211> 21

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(21)

<223> STR-3 primer upstream primer

<400> 5

ggtttccatt gtagcatctt g 21

<210> 6

<211> 20

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(20)

<223> STR-3 primer downstream primer

<400> 6

gcctggttgtttccgtagta 20

<210> 7

<211> 20

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(20)

<223> STR-4 primer upstream primer

<400> 7

tctgttgggt gtttgggata 20

<210> 8

<211> 20

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(20)

<223> STR-4 primer downstream primer

<400> 8

ttacattgtcggtctggtcc 20

<210> 9

<211> 20

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(20)

<223> STR-5 primer upstream primer

<400> 9

atctcagtct ccccaagtgc 20

<210> 10

<211> 20

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(20)

<223> STR-5 primer downstream primer

<400> 10

tccttcaaga taaccaccga 20

<210> 11

<211> 22

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(22)

<223> STR-6 primer upstream primer

<400> 11

tcggttgtag gtattatcac gg 22

<210> 12

<211> 20

<212>DNA

<213> Artificial

<220>

<221> primer_bind

<222> (1)..(20)

<223> STR-6 primer downstream primer

<400> 12

tgccccatag gttttgaact 20

Claims (10)

1. A susceptibility prediction kit for oral cavity and head and neck malignancies, which comprises the following components: STR-1 primers, STR-2 primers, STR-3 primers, STR-4 primers, STR-5 primers, STR- 6 primers, the STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, and STR-6 primer are used to amplify the target fragment comprising the following short tandem sequences respectively, to determine The number of repetitions of the following short tandem sequences: 2. A kit for predicting susceptibility to oral cavity and head and neck malignancies, comprising the following components: STR-1 primers, STR-2 primers, STR-3 primers, STR-4 primers, and STR-5 primers , STR-6 primer; The sequences of the STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, and STR-6 primer are as follows: Preferably, the concentration of the STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, and STR-6 primer is 10 μM. 3. The oral cavity and head and neck cancer susceptibility prediction kit according to claim 2, further comprising: PCR amplification reaction solution, LIZ-500 molecular weight internal standard, and deionized formamide. 4. The oral cavity and head and neck malignancy susceptibility prediction kit as claimed in claim 3, characterized in that: the PCR amplification reaction solution is a mixture of the following reagents: TaqDNA polymerase 5U/μL, Tris-HCl 100mM, KCl 500mM, ethylphenyl polyethylene glycol 0.8% (v/v), MgCl ₂ 25mM, dNTP 10mM, deionized water; wherein, the pH of Tris-HCl at 25°C is 8.8. 5. The oral cavity and head and neck malignancy susceptibility prediction kit according to claim 4, further comprising an instruction manual; The instruction manual records the method of using the oral cavity and head and neck cancer susceptibility prediction kit, which includes the following steps: (1) extract sample DNA; (2) PCR reaction (2-1) Take out STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, STR-6 primer, PCR amplification reaction solution from the refrigerator, equilibrate to room temperature, each After the components are fully dissolved, quickly centrifuge for 10 seconds; (2-2) Take 30-300ng sample DNA, add 60μL of PCR amplification reaction solution, add deionized water to make up to 115.2μL, mix well, and centrifuge quickly for 10 seconds, and then divide the mixture into 19.6μL/well 6 PCR reaction tubes; (2-3) Add STR-1 primer, STR-2 primer, STR-3 primer, STR-4 primer, STR-5 primer, and STR-6 primer to step (2-2) at 0.8 μL/well In 6 PCR reaction tubes; cover the PCR reaction tube cap, record the sample loading situation, centrifuge quickly for 10 seconds, then transfer the PCR reaction tube to the corresponding position of the sample slot of the PCR amplification instrument, and record the order of placement, and start PCR amplification Reaction; amplification reaction conditions are: 95°C for 3 minutes; 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds, 10 cycles; 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds, 20 cycles ; 6 minutes at 72°C to obtain 6 sets of PCR amplification products; (3) STR fragment analysis (3-1) Take 990 μL of deionized formamide, add 10 μL of LIZ-500 molecular weight internal standard, mix well, and centrifuge quickly for 10 seconds, add 10 μL/well to the sequencing reaction tube respectively, and centrifuge quickly for 10 seconds; (3-2) Add the above 6 groups of PCR amplification products to 6 sequencing reaction tubes respectively at 1 μL/well, and centrifuge quickly for 10 seconds; Heating for 5 minutes, immediately place the sequencing reaction tube on the ice-water mixture to rapidly cool to 0°C, and centrifuge for 10 seconds; then transfer the sequencing reaction tube to the corresponding position of the sample tank of the STR site fragment analyzer, and record the placement Sequence for fragment analysis and detection; (4) Result analysis and judgment (4-1) According to the fragment analysis results, record the fragment lengths of the two alleles at each site of STR-1, STR-2, STR-3, STR-4, STR-5, and STR-6 respectively: The smaller fragment length value among the two alleles of STR-1 is recorded as L ₁ , and the larger fragment length value among the two alleles of STR-1 is recorded as L ₂ ; The smaller fragment length value among the two alleles of STR-2 is recorded as L ₃ , and the larger fragment length value among the two alleles of STR-2 is recorded as L ₄ ; The smaller fragment length value among the two alleles of STR-3 is recorded as L ₅ , and the larger fragment length value among the two alleles of STR-3 is recorded as L ₆ ; The smaller fragment length value among the two alleles of STR-4 is recorded as L ₇ , and the larger fragment length value among the two alleles of STR-4 is recorded as L ₈ ; The smaller fragment length value among the two alleles of STR-5 is recorded as L ₉ , and the larger fragment length value among the two alleles of STR-5 is recorded as L ₁₀ ; The smaller fragment length value among the two alleles of STR-6 is recorded as L ₁₁ , and the larger fragment length value among the two alleles of STR-6 is recorded as L ₁₂ ; (4-2) The number of repetitions of the short tandem sequence is calculated according to the length of the fragment and the following formula, denoted as X ₁ -X ₁₂ , where round represents rounding to an integer: X ₁ =round[(L ₁ -191)/3]; X ₂ =round[(L ₂ -191)/3]; X ₃ =round(L ₃ -379); X ₄ =round(L ₄ -379); X ₅ = round[(L ₅ -202)/2]; X ₆ = round[(L ₆ -202)/2]; X ₇ = round[(L ₇ -359)/2]; X ₈ = round[(L ₈ -359)/2]; X ₉ =round[(L ₉ -278)/2]; X ₁₀ =round[(L ₁₀ -278)/2]; X ₁₁ =round[(L ₁₁ -200)/4]; X ₁₂ =round[(L ₁₂ -200)/4]; (4-3) Substituting the number of repetitions of the above-mentioned short tandem sequence into the pre-set discriminant function: F _HNC ＝8.338X ₁ -5.839X ₂ +9.039X ₃ +82.475X ₄ +1.717X ₅ +3.121X ₆ +0.525X ₇ +4.394X ₈ +1.202X ₉ -5.911X ₁₀ +2.864X ₁₁ +7.707X ₁₂ -2.238X ₁₃ -1262.984 F _HNN ＝8.432X ₁ -5.903X ₂ +8.883X ₃ +83.361X ₄ +1.452X ₅ +3.054X ₆ +0.502X ₇ +4.228X ₈ +1.046X ₉ -5.766X ₁₀ +2.850X ₁₁ +7.293X ₁₂ -4.865X ₁₃ -1265.756 Wherein, if the subject is female, then X ₁₃ =0, if the subject is male, then X ₁₃ =1; (4-4) Prediction of susceptibility to oral and head and neck malignancies: Comparing the F _HNC value and F _HNN value, if F _HNC > F _HNN , it is predicted that the probability of the subject suffering from oral cavity and head and neck cancer is ≥ 75.0%; if F _HNC ≤ F _HNN , it is predicted that the subject will not suffer from oral cancer and head and neck cancer probability ≥ 75.0%. The kit for predicting susceptibility to oral cavity and head and neck malignancies according to claim 5, wherein the sample is whole blood, oral swab or oral tissue of the subject. 7. The application of the oral cavity and head and neck malignancy susceptibility prediction kit according to any one of claims 1 to 6 in the preparation of oral cavity, head and neck malignancy diagnostic products. 8. A susceptibility prediction system for oral cavity and head and neck cancer, characterized in that it comprises: A device for obtaining the number of repetitions of the following STR site short tandem sequences of sample DNA: A data processing and judging device, which includes the following modules: The data input module is used to input the age, gender, and repeat times of the short tandem sequence of the subject; The database management module is used for the operation management of data storage, modification, deletion, query and printing; The data calculation module is used to calculate the result of the discriminant function according to the number of repetitions of the STR site short tandem sequence in the data input module; The analysis, discrimination and result output module is used to compare the results of the discriminant function, so as to predict the susceptibility of oral cavity and head and neck malignant tumors, and output the results. 9. The oral cavity and head and neck cancer susceptibility prediction system according to claim 8, characterized in that the number of repetitions X ₁ - _X12 ; and in: The discriminant functions include: The first discriminant function F _HNC =8.338X ₁ -5.839X ₂ +9.039X ₃ +82.475X ₄ +1.717X ₅ +3.121X ₆ +0.525X ₇ +4.394X ₈ +1.202X ₉ -5.911X ₁₀ +2.864X ₁₁ +7.707X ₁₂ -2.238X ₁₃ -1262.984 The second discriminant function F _HNN =8.432X ₁ -5.903X ₂ +8.883X ₃ +83.361X ₄ +1.452X ₅ +3.054X ₆ +0.502X ₇ +4.228X ₈ +1.046X ₉ -5.766X ₁₀ +2.850X ₁₁ +7.293X ₁₂ -4.865X ₁₃ -1265.756 In the discriminant function, X1 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR- ₁ ; X2 is the number of repetitions of the short tandem sequence of the larger fragment in the _two alleles of STR-1; X ₃ is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR-2; _X4 is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-2; X5 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR- ₃ ; X6 is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR- ₃ ; X7 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR- ₄ ; _X8 is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-4; _X9 is the number of repetitions of the short tandem sequence of the smaller fragment in the two alleles of STR-5; X ₁₀ is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-5; X ₁₁ is the repetition number of the short tandem sequence of the smaller fragment in the two alleles of STR-6; X ₁₂ is the number of repetitions of the short tandem sequence of the larger fragment in the two alleles of STR-6; If the subject is female, then X ₁₃ =0, if the subject is male, then X ₁₃ =1; Among them, X ₁ ^- X ₁₂ is calculated according to the length of the fragment and as follows, where round means rounding to an integer: X ₁ =round[(L ₁ -191)/3]; X ₂ =round[(L ₂ -191)/3]; X ₃ =round(L ₃ -379); X ₄ =round(L ₄ -379); X ₅ = round[(L ₅ -202)/2]; X ₆ = round[(L ₆ -202)/2]; X ₇ = round[(L ₇ -359)/2]; X ₈ = round[(L ₈ -359)/2]; X ₉ =round[(L ₉ -278)/2]; X ₁₀ =round[(L ₁₀ -278)/2]; X ₁₁ =round[(L ₁₁ -200)/4]; X ₁₂ =round[(L ₁₂ -200)/4]; In X ₁ ^- X ₁₂ , L ₁ is the smaller fragment length value among the two alleles of STR-1, and L ₂ is the larger fragment length value among the two alleles of STR-1; L ₃ is the smaller fragment length value among the two alleles of STR-2, and L ₄ is the larger fragment length value among the two alleles of STR-2; L ₅ is the smaller fragment length value among the two alleles of STR-3, and L ₆ is the larger fragment length value among the two alleles of STR-3; L ₇ is the smaller fragment length value among the two alleles of STR-4, and L ₈ is the larger fragment length value among the two alleles of STR-4; L ₉ is the smaller fragment length value among the two alleles of STR-5, and L ₁₀ is the larger fragment length value among the two alleles of STR-5; L ₁₁ is the smaller fragment length value among the two alleles of STR-6, and L ₁₂ is the larger fragment length value among the two alleles of STR-6; The analysis, discrimination and result output module compares the calculation result of the first discriminant function F _HNC with the calculation result of the second discriminant function F _HNN , and if F _HNC >F _HNN , then output "the subject suffers from oral cavity and head and neck disease". If F _HNC ≤ F _HNN , then output the prediction result of “the probability of the subject not suffering from oral cavity and head and neck cancer ≥ 75.0%”. 10. The oral cavity and head and neck cancer susceptibility prediction system described in claim 8 in the preparation of oral cavity and head and neck cancer prediction products, oral cavity and head and neck cancer diagnosis products, oral cavity and head and neck health supplementary products application.