CN108835122B

CN108835122B - Application of ABC transporter as target point in pest control

Info

Publication number: CN108835122B
Application number: CN201810903918.5A
Authority: CN
Inventors: 萧玉涛; 靳明辉; 程英; 廖重宇
Original assignee: Agricultural Genomics Institute at Shenzhen of CAAS
Current assignee: Agricultural Genomics Institute at Shenzhen of CAAS
Priority date: 2018-08-09
Filing date: 2018-08-09
Publication date: 2020-11-03
Anticipated expiration: 2038-08-09
Also published as: CN108835122A

Abstract

The invention uses CRISPR/Cas9 gene editing technology to knock out cotton bollworm ABCB6 gene, firstly determines the sequence of ABCB6 gene through RACE technology and existing transcriptome data, designs sgRNA target site according to the sequence, mixes sgRNA after in vitro transcription with Cas9 protein in proportion and injects into cotton bollworm egg, successfully knocks out ABCB6 gene, and screens and purifies a 7bp deletion homozygous knockout strain through two generations of hybridization. The results of the tests showed that the weight gain of the knockout line was severely inhibited in the treatment with 0.4% gossypol concentration, and the sensitivity to indoxacarb was increased, with a 3.3-fold decrease in LC 50. The results show that the ABCB6 gene plays an important role in the metabolism of indoxacarb and gossypol by cotton bollworms, and the results provide a new target gene for the prevention and control of the cotton bollworms.

Description

Application of ABC transporter as target point in pest control

Technical Field

The invention relates to the field of disease and pest control, in particular to application of ABC transporter as a target point in pest control.

Background

ABC transporters are an ancient and bulky family of transmembrane proteins that are widely found in natural organisms. Most ABC transporters have transport activity, and transport substrates including amino acids, lipids, saccharides, metal ions, metabolites, drugs, and the like, are transported across membranes using an energy-reversed concentration gradient generated by ATP hydrolysis.

P-glycoprotein is the first ABC transporter found in eukaryotes, also known as multidrug resistance transporter (MDR) because it is involved in the efflux of intracellular drugs. ABC transporters function in transmembrane transport in phase iii of the insect detoxification metabolic pathway, and their function is gradually being revealed. For example, tobacco hornworm (Manduca sexta) can effectively remove nicotine from tobacco using multidrug transporter in Marchanel, thereby allowing for safe tobacco consumption. RNA-seq experiments show that the ABC transporter gene expression patterns of cotton bollworms are diversified and show tissue specificity after eating plant secondary substances including atropine, nicotine and tomatidine, wherein the expression levels of up to 17 ABC genes in midgut of the cotton bollworms after eating the nicotine are obviously changed.

ABCB6 belongs to a hemitransporter of the B subfamily of ABC transporters. In mammals, the ABCB6 gene is first localized on the inner mitochondrial membrane, and is involved in the transport of heme-ferrous related compounds from mitochondria to cytoplasm and in regulating the iron ion balance. With the progress of the research, Masashi et al demonstrated that human ABCB6 is distributed mainly on the membrane of endoplasmic reticulum-derived organelles and more on the Golgi apparatus. In addition, it has been reported that ABCB6 is present on the outer membrane of mitochondria and transports porphyrin molecules into mitochondria, regarding the function of ABCB 6; ABCB6 is involved in killing tumor cells; participate in regulating the balance of porphyrins in cells.

Heliothis armigera Hubner, belonging to Lepidoptera, Lepidotera, Noctuidae, is a omnivorous insect, and causes serious damage to various crops worldwide, bringing about huge economic loss. The cotton bollworm has strong environmental adaptability, is easy to generate drug resistance, has the characteristic of migration and is difficult to control.

In view of the above, the present invention is particularly proposed.

Disclosure of Invention

The invention aims to provide application of ABC transporter as a target point in controlling pests, in particular ABC6 transporter.

In order to achieve the above purpose of the present invention, the following technical solutions are adopted:

application of ABC transporter as a target point in pest control.

The inventor starts with the insect detoxification and metabolism approach, researches the effect of ABC transporter in metabolism of pesticide and plant secondary substances by cotton bollworms, and provides a new target for prevention and control of the cotton bollworms.

Further, the ABC transporter is ABC6 transporter.

Further, the pest is cotton bollworm.

Further, the nucleic acid sequence of the ABC6 transporter is shown as SEQ ID NO. 1.

The invention also provides a drug for preventing and treating cotton bollworm, which contains a substance with the effect of inhibiting the activity or expression of the ABC6 transporter.

The gene editing technology is a technology capable of carrying out genetic operation on a specific target sequence at the genome level, and can realize gene knockout, site-specific knock-in, fragment deletion and the like. This technique has been widely used in various fields and is an important means for gene function studies. At present, reported gene editing tools mainly comprise Zinc Finger Nucleases (ZFNs), transcription activator like nucleases (TALENs) and clustered regularly interspaced short palindromic repeat system sequences (CRISPR/Cas 35 9), wherein the CRISPR/Cas9 system has the characteristics of simple design and construction, fast cycle, high efficiency and the like, and has been successfully applied to the function research of various biological genes.

Further, the medicament includes a sgRNA designed to correspond to the nucleic acid sequence of the ABC6 transporter.

Further, the nucleic acid sequence of the sgRNA is shown as SEQ ID NO.2 and SEQ ID NO. 3.

Further, the sgRNA also includes a promoter sequence.

Further, the promoter is a T7 promoter.

Furthermore, the promoter sequence is shown as SEQ ID NO.4 and SEQ ID NO. 5.

Further, the medicament also includes a Cas9 protein.

Further, the sgRNA and the Cas9 protein are used in a ratio of 2-5:1, such as 2:1, 2.5:1, 3:1, 4:1, 5:1, and so on.

Compared with the prior art, the invention has the beneficial effects that:

(1) the sequence of ABCB6 gene is determined by RACE technology and existing transcriptome data.

(2) The sgRNA target site is designed according to the sequence, and the sgRNA is mixed with the Cas9 protein in proportion and injected into bollworm eggs after being transcribed in vitro, so that the ABCB6 gene is successfully knocked out.

(3) The invention discovers that the deletion of the ABCB6 gene in the cotton bollworm can obviously increase the sensitivity of the cotton bollworm to the indoxacarb pesticide, the LC50 is obviously reduced, the sensitivity to plant secondary substance gossypol is also increased, and the ABCB6 gene can be used as a new target for preventing and controlling the cotton bollworm.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 is a graph showing the result of PCR electrophoresis of G0 moth seeds in example 3 of the present invention;

FIG. 2 shows the CRISPR/Cas9 mediated mutation pattern of cotton bollworm ABCB6 gene in example 3 of the present invention;

FIG. 3 is a graph showing the change of body weight of 96S and 96S-B6-/-gossypol-fed diets after 2 days in Experimental example 3 of the present invention.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only illustrative of the present invention and should not be construed as limiting the scope of the present invention. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

Example 1

Cloning of the bollworm ABCB6 Gene

Amino acid sequences coded by ABCB6 genes of silkworm (XP _012550859.1), prodenia litura (XP _022837972.1) and human (NP _005680.1) are used for carrying out homology detection, and areas with higher homology are selected to design amplification primers for carrying out amplification of conserved areas. The primers are shown in Table 1.

TABLE 1 primers

5 'and 3' RACE experiments were performed using conserved regions as templates, according to

The RACE cDNAamplification Kit instructions were used for the manipulations.

Comparing the RACE amplification result with the existing transcriptome data, confirming the reliability of the sequence, and obtaining the cotton bollworm ABCB6 gene, the sequence of which is shown as SEQ ID NO. 1.

Example 2

Knock-out of cotton bollworm ABCB6 gene

sgRNA design and Synthesis

sgRNA site design is carried out on ABCB6 gene by adopting sgRNA 9 design software, off-target risk assessment is carried out by taking the whole genome as a reference sequence, and an N18NGG sequence with highest score and no off-target risk is selected as sgRNA (sgRNA 1-F: GGTGAGATATGGGTGGACCA; sgRNA 1-R: TGGTCCACCCATATCTCACCC).

The forward/reverse sgRNA sequences were preceded by TAATACGACTCACTATAG and TTCTAGCTCTAAAAC linker sequences (T7 promoter), respectively, using GeneArt^TMPrecision gRNA Synthesis Kit sgR according to its instruction setNA was synthesized in vitro.

The configuration system is shown in table 2.

TABLE 2 configuration system

Reagent	Use amount (volume)
		High-Fidelity PCR Master Mix(2X)	12.5μL
Tracr Fragment+T7Primer Mix	1μL
		0.3μM Target F1/R1oligonucleotide mix	1μL
Nuclease-free Water	10.5μL
		Total volume	25μL

Gently mixed, centrifuged instantaneously, and then reacted in a PCR instrument according to the procedure shown in Table 3.

TABLE 3 reaction procedure

After the PCR was completed, a template (I) containing the T7 promoter and gRNA sequences was obtained. The template was used to continue the next in vitro transcription experiment, the in vitro transcription system is shown in table 4.

TABLE 4 in vitro transcription System

Reagent	Use amount (volume)
		NTP mix(100mM each of ATP,GTP,CTP,UTP)	8μL
gRNA DNA template(fromⅠ)	6μL
		5X Transcript Aid Reaction Buffer	4μL
Transcript Aid Enzyme Mix	2μL
		Total volume	20μL

The reaction solution was mixed well, centrifuged gently, and incubated at 37 ℃ for 2 hours. Add 1. mu.L DNase I to the reaction and incubate for 15 min at 37 ℃.

And (3) diluting 0.5 mu L of reaction liquid by 10 times, standing at 70 ℃ for 10 minutes, carrying out electrophoresis to detect the synthesis quality of the sgRNA, and determining the concentration of the NanoDrop.

sgRNA purification

The sgRNA obtained above was purified using the gRNA Clean Up Kit in the Kit, and the specific steps were as follows:

adding nucleic acid-free water to adjust the volume of the reaction solution to 200 mu L;

adding 100 mu L Binding Buffer, mixing, adding 300 mu L absolute ethyl alcohol, sucking and mixing;

transfer of the mixture to GeneJET^TMRNA Purification Micro Column collection tube, 14000g centrifugation for 30-60 seconds;

discarding the filtrate, and putting the centrifugal column into the collecting pipe again;

adding 700 mu L of Wash Buffer 1 and 14000g, centrifuging for 30-60 seconds, discarding the filtrate, adding 700 mu L of Washbuffer 2 and 14000g, centrifuging for 30-60 seconds, and repeating once;

the collection tubes were emptied for 2 minutes and dissolved by adding 10. mu.L of nuclease-free water and stored at-80 ℃.

Cas9 protein

Cas9 protein was purchased from Thermo Fisher Scientific, and stored in-80 ℃ freezer.

Example 3

Collection and injection of cotton bollworm eggs

20 pairs of adult cotton bollworms are placed in a 30 cm-20 cm insect breeding box, covered by gauze and fed with 10% sugar water. And (3) replacing the egg cloth in the peak egg laying period, and collecting the gauze after 2 hours. The gauze was soaked in a 1% sodium hypochlorite solution for 10 seconds and then placed in clear water and agitated to elute the eggs from the gauze. To facilitate injection, the eluted eggs are placed one by one on a glass slide stained with double-sided adhesive.

The sgRNA solution and Cas9 protein from example 2 were removed from the refrigerator and diluted to 150ng/μ L and 50ng/μ L, respectively. Mixing the two solutions in equal volume, injecting 2nL mixed solution into each egg, and placing the injected eggs in an incubator.

Mutation detection

20 larvae are hatched, and the artificial feed is fed to the larvae until pupation occurs, and 16 pupae successfully emerge into adults. After mating and oviposition, DNA of 16G 0 moth generations and 1 wild pupa are extracted for subsequent detection. The Muitisourcegenomic DNA Miniprep Kit was used for DNA extraction and the procedures were performed according to the instructions. Detection primers Primer-1-F (5'-GAGAGCCGGCAGTGTGTTTT-3'), Primer-1-R (5'-TCCAATTAAGATAGCGGAGGCT-3') spanning the sgRNA target sites were designed for detection of the editing results. The PCR reaction was carried out using 2 XEasyTaq enzyme of all-gold type, and the results of electrophoresis are shown in FIG. 1 (FIG. 1). In fig. 1, from left to right, a marker, a sample in which 16 pupae successfully feather into an adult, and a wild type control sample are provided in sequence.

Directly sequencing a PCR product, carrying out TA clone sequencing on 9 samples with overlapping peaks at the sgRNA position in a sequencing peak image, detecting specific mutation types, and obtaining a detection result as shown in figure 2, wherein a sequence with a blue band underlined in figure 2A is a sgRNA sequence, a sequence with an arrow with a red band is a PAM sequence, and WT is a wild type genotype. 7 different mutant genotypes were detected in total, numbered 1-7, where the dotted line represents the missing base and the orange color the mutated base. Fig. 2B shows a sequencing peak plot with sgRNA sequences underlined in black, distributed top-down for wild type, heterozygous mutant and homozygous mutant.

Purified knock-out strain screening

And selecting one mutation type with deletion of 7bp as a parent G0 for screening homozygous mutation lines, and crossing the individual with a wild line 96S individual to generate a progeny G1. Randomly selecting 100G 1 generation five-instar larvae, pupating, extracting DNA from the sloughed skin, and detecting, wherein 30G 1 generation five-instar larvae contain 7bp deleted allele. Individuals with 7bp deletion alleles are crossed and screened by sequencing to form homozygous ABCB6 knockout line (named 96S-B6-/-) with 7bp deletion in G2 generation.

Examples of the experiments

Biological assay

1. Gossypol treatment

Gossypol (plant secondary material) is dissolved in absolute ethanol to prepare artificial feed of 0.1%, 0.2% and 0.4% (W/W). Five instar larvae of the sensitive line (96S) and the homozygous ABCB6 knock-out line (96S-B6-/-) were weighed individually and recorded for a body weight M1, placed in 24-well plates and fed with gossypol feed for 2 days, while larvae fed with normal feed were used as controls. After 2 days, the body weight was weighed and recorded as M2. For each 30 beetles treated, 10 biological replicates were counted for three biological replicates. The results are shown in FIG. 3. In fig. 3, a significant difference P <0.01 is indicated.

As can be seen from fig. 3, at a gossypol concentration of 0.1%, the sensitive lines gained slightly more weight than the knockout lines; when the concentration of gossypol is 0.2%, the weight gain of the sensitive strain is slightly higher than that of the knockout strain, and the weight gains of the sensitive strain and the knockout strain are increased when compared with that of the gossypol concentration of 0.1%; the weight gain of the knockout line was severely inhibited in the treatment with 0.4% gossypol concentration, showing a significant difference from the weight gain of the sensitive line.

2. Indoxacarb treatment

Indoxacarb (pesticide) original drug is dissolved in acetone to prepare mother liquor with the concentration of 10,000mg/L, and the mother liquor is diluted into 6 concentrations in a gradient way. When the artificial feed is not solidified, 1mL of feed is added into each hole of a 24-hole plate, and after the feed is dried in the air, a medicament diluted to a treatment concentration by 30 mu L of acetone is dropped into the holes, and the acetone is used as a control treatment. 3 rd larvae of the sensitive and knockout lines were individually inoculated into wells, checked for mortality 72 hours later, and LC50 was calculated. The results are shown in Table 5.

TABLE 5 comparison of sensitivity to indoxacarb between knockout and sensitive lines

As can be seen from Table 5, the sensitivity of knockout line 96S-B6-/-to indoxacarb was increased, and LC50 decreased by 3.3-fold.

While particular embodiments of the present invention have been illustrated and described, it would be obvious that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.

SEQUENCE LISTING

<110> Shenzhen agricultural genome institute of Chinese agricultural science institute

Application of <120> ABC transporter as target point in pest control

<130>2010

<160>5

<170>PatentIn version 3.3

<210>1

<211>2541

<212>DNA

<213>Helicoverpa armigera

<400>1

atgatggaat attgcccccc taacgttacc ctgggtgaga tatgggtgga ccatggaata 60

tcccagtgtt tcatggagac agcctccgct atcttaattg gaggatttct gctaatattt 120

ggactgatac agattgttat gtataaaaga tatgctacgg aagtggtgga tgtgagaagt 180

tcgcggcttt tcgccgttca attgtttttc acgttgtttg tacccgtgct ggctgtgata 240

agattcctgc tacaggcttt tgtatttaaa ggaggatcta tttatggata tatgatatta 300

gctttagtga taactttagt agtatttccc ctgtcggcct acttggcggt gctggagagg 360

cggttcctgt taccctcggt tcctccgaga ggacacggat ttgttcttct cgtcttctgg 420

gctttgatat ttgtgtcgga aaacctttcc ttcctaaatc tcaataaaga aggatggtgg 480

tggcatttga aaaatctcca agaccgcctg gagatgtccc tattcgtagg acgttacgtg 540

tcgtgcatga tcatgttcgt gctcggcatg aaggcgcccg ggatcatgca ccagttcgag 600

taccttgagg acgatgataa ccgaagaaat ataccgccta ggcaagatga aaatagatca 660

acattccgca atgtgtttgg caaactacgc actttgctgc cgttcctatg gccgcggaag 720

agcgcctgcc tacaaatcta cgtccttata tgcgttttgg ccctcatcgc tggacgagct 780

gttaaccttt atgtgcctat ttatagtaag aaaatagtgg atagtatatc gattccgccg 840

tactacttcc gatgggactt ggtggtgatc tacgtgttgt tcaagttcct ccagggagga 900

ggtacgggag gtatgggctt cctcaacaat ctgcggtcgt tcttatggat caaagtgcag 960

cagtatacta ctagggaatt acagttagaa ttatttaagc atcttcacga cttgcccctg 1020

cggtggcact tatcaagaaa gacaggagag gtcttaagag tcatggaccg aggaacggac 1080

tccatagaca atctactttc atacatcttg ttctcaataa caccgactct aatagacatt 1140

attgtagctg tcatatactt tgtatcggaa ttcaacgcgt ggttcgggct tattgtgttc 1200

tcaaccatgg tactttatat aattgcgacg atagccgtga cggaatggcg cacgaagttc 1260

cagcgacgca tgaacttagc cgacaacgaa cagaaggcgc gatccgtaga ctcgctgctg 1320

aattatgaga ctgtcaagta ttatggcgct gaagcgtatg aagttgtgtc ttatagagag 1380

gctattgtta attatcagaa agaggagttc aagtccctga taacactcaa tatgctgaac 1440

acgttacaaa atgtgataat ttgcagcggt ctactggctg gatcgttgct ctgcgtgtca 1500

atggtagtgg aaacaaacca actgacagtg ggagactacg tgctcttcgc ttcatacata 1560

gtgcagctat acgtccctct caactggttc ggaacttatt atagggccat acaaaagaac 1620

ttcgtagaca tggagaacat gttcgacctg atgcgcgtgg actccgacgt gcgcgacgct 1680

atcggtgccc ccgacctgct cgtgcggcgc ggcgctatcg agttcaagca cgtgtccttc 1740

ggctacgggc ccgagcggct cgtgctcagc aacgtcagct tcaaagtgcc tccgggcagc 1800

actgtggctt tggtcggtcc cagtggtgcg ggcaagtcta caataatgcg gcttctattc 1860

cgattctacg acgtgaacga gggcgcggta ctcgtagacg gacaggacgt gaggacggtg 1920

acgcaggcgt cgctacgagc taacataggc gtcgtgcctc aagacacggt gctgtttaat 1980

aacactgtta ggtacaatat tcaatatgga aaactaaatg cgccggcggc agatatcata 2040

tcagcggcta aaaacgctga cattcacgac agaatcctca cattcccaga tgcttacgat 2100

acacaggtcg gtgagagggg cttgcgtctt agcggaggag aaaagcaaag aatagcaatc 2160

gcgcgaacta tactcaagga tccggccata gttctacttg acgaagctac gtcagcactt 2220

gataccaaca cagaaagaaa tatacaggcg gcattggcac gtgtttgtgc gaataggaca 2280

acattaataa tagctcacag actctctacg attatacacg ctgatgaaat tctcgtctta 2340

aaggagggag aaatcatcga gagaggaaac cacgaagcgc ttctcgcaca agccggcttc 2400

tacgcgtcaa tgtggcaaca gcaactagag aaccgcaaca acaacgaaag caatggcgag 2460

ggcaacaaca acaacgagcc tcggccgccg cccggacagc ccaacggcgt cagcgccttc 2520

ggacacggcc acggacattt a 2541

<210>2

<211>20

<212>DNA

<213> Artificial sequence

<400>2

ggtgagatat gggtggacca 20

<210>3

<211>21

<212>DNA

<213> Artificial sequence

<400>3

tggtccaccc atatctcacc c 21

<210>4

<211>18

<212>DNA

<213> Artificial sequence

<400>4

taatacgact cactatag 18

<210>5

<211>15

<212>DNA

<213> Artificial sequence

<400>5

ttctagctct aaaac 15

Claims

The application of ABC transporter as a target point in controlling pests, wherein the ABC transporter is ABCB6 transporter, the pests are cotton bollworms, and the nucleic acid sequence for coding the ABCB6 transporter is shown as SEQ ID No. 1.
2. The drug for preventing and treating cotton bollworm is characterized by comprising sgRNA and Cas9 protein which are designed corresponding to the nucleic acid sequence of the ABCB6 transporter; the nucleic acid sequence of the sgRNA is shown in SEQ ID NO.2 and SEQ ID NO. 3; the ratio of the sgRNA to the Cas9 protein is 2-5: 1.
3. The medicament of claim 2, wherein the sgRNA further includes a promoter sequence; the promoter is T7 promoter.
4. The medicament of claim 3, wherein the promoter sequence is shown as SEQ ID No.4 and SEQ ID No. 5.