CN108823322A - One group for screen and/detect breeding oxen rate of teratosperm height SNP marker - Google Patents
One group for screen and/detect breeding oxen rate of teratosperm height SNP marker Download PDFInfo
- Publication number
- CN108823322A CN108823322A CN201810752412.9A CN201810752412A CN108823322A CN 108823322 A CN108823322 A CN 108823322A CN 201810752412 A CN201810752412 A CN 201810752412A CN 108823322 A CN108823322 A CN 108823322A
- Authority
- CN
- China
- Prior art keywords
- gene
- rate
- breeding oxen
- prkcb
- teratosperm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to molecular genetic field of biotechnology, and in particular to one group for screen and/detect breeding oxen rate of teratosperm height SNP marker.PRKCB gene has the SNP site of 12 complete linkages, and haplotype analysis obtains 2 kinds of haplotypes, i.e. H1 (TCTGTTTCTAAC), H2 (CTCACCCTCTCA), a total of 3 kinds of haplotype combinations H1H1, H1H2, H2H2.Be associated with bull semen quality analysis shows, abnormal rate is substantially less than the bull (P of H1H1 and H2H2 haplotype combination after H1H2 haplotype combination public affairs frozen cattle semens are thawed<0.05).
Description
Technical field
The invention belongs to molecular genetic field of biotechnology, and in particular to one group for screening and/detection breeding oxen sperm
The SNP marker of abnormal rate height.
Background technique
The selection of outstanding breeding oxen plays conclusive effect for the genetic improvement of milk cow and breeding, to modern milk industry
It is sustainable, develop in a healthy way have great importance.The contribution that breeding oxen is in progress to milk cow population genetic according to statistics up to 75% with
On.Whether the superiority and inferiority of semen quality directly becomes pregnant concerning cow.At this stage in milk industry developed country, an outstanding breeding oxen year
80,000-10 ten thousand doses of jelly essence can be produced, 250,000 doses is reached as high as, is significantly higher than average annual 2.18 ten thousand doses of the unit yield of China bull.
Bull semen quality is by factors such as heredity, age, disease, raise competence, management method, climatic environment and semen collection technologies
It influences, and heredity is its determinant the most essential.Therefore, the molecular basis for influencing bull semen quality is understood in depth,
Prolificacy breeding oxen is cultivated for the means by molecular breeding to be of great significance.
Currently, identifying the mononucleotide polymorphism site closely related with semen quality by whole-genome association
(Single nucleotide polymorphisms, SNPs) has found that these sites SNPs can influence sperm motility, density, abnormal
The embryonic development of form quotient and after fertilization.Gene promoter area SNPs by regulate and control promoter region critical regulatory elements combination come
The expression of gene is influenced, and then influences bull semen character and reproductive capacity.For example, this seminar in early-stage study it has also been found that in
There are multiple influence bull essences for state's Holstein sire gene promoter area sperm KATNAL1, PLCz, INCENP, TNP1, HIBADH
Liquid quality SNPs (Zhang etc., 2014；Pan etc., 2013；Liu et al. 2016；Zhang etc. is 2015).Compared to probing into single base
Because of the correlation of single locus nucleotide polymorphisms and economic characters, the haplotype combination studied between multiple polymorphic sites more has
Meaning, because this can be simultaneously in view of the interaction between polymorphic site.
The protein of PRKCB gene coding is one of PKC family member, many different cell functions is taken part in, as B is thin
Born of the same parents' activation, the absorption of apoptosis induction, endothelial cell proliferation and enteron aisle sugar.Protein kinase C (PKC) is a serine and threonine
Protein kinase family can be activated by calcium ion and second messenger's diglyceride, so that a variety of target proteins of phosphorylation, participate in different
Cell-signaling pathways.Each member of PKC family has specific express spectra.It has been reported and shows PKC family in spermatic flagellum
It plays a significant role in activity and acrosome reaction.However, PRKCB gene whether there is and public affairs in Chinese Holstein bull group
The relevant site SNPs of ox semen quality and its functional authorization have not been reported.
Abnormal rate is the important indicator evaluated bull and freeze extract Iuality after public frozen cattle semens are thawed, and determines bull reproductive capacity and mother
The height of ox conception rate, it is closely bound up with the economic benefit of cattle farm.By molecular mark to bull sperm deformity
Rate carries out early detection and screening, can reduce bull breeding period and cost.Therefore, it needs to establish a kind of by detection individual
Method of the genotype to screen the lower bull of bull abnormal rate.
Summary of the invention
The main object of the present invention is to provide one group and freezes abnormal rate height after essence is thawed for screening and detecting breeding oxen
The site SNPs, and a kind of method for detecting abnormal rate height after breeding oxen jelly essence is thawed by PRKCB gene SNP s is provided, and
Research and develop the breeding that corresponding detection kit is applied to prolificacy breeding oxen.
To achieve the above object, the present invention uses following technical scheme：
One of the object of the invention, provide it is a kind of for screen and/detection breeding oxen rate of teratosperm height SNP site,
The site SNPs is the g.-1526C of breeding oxen PRKCB gene the -1526th>T, the -1409th g.-1409C>T ,-
1259 g.-1259C>T, the -1249th g.-1249A>G, the -1230th g.-1230C>T, the -1220th g.-
1220C>T, the -1091st g.-1091C>T, the -1089th g.-1089C>T, the -1088th g.-1088C>T ,-
1081 g.-1081A>T, the -869th g.-869A>C and the -806th g.-806A>C is (with transcription initiation site TSS
It is+1).
The two of the object of the invention, provide SNP site described above screening and/detection breeding oxen rate of teratosperm height with
And evaluation breeding oxen freezes the application after essence is thawed in sperm quality.
The three of the object of the invention, provide it is a kind of for screen and/detection breeding oxen rate of teratosperm height method, it is described
Method is not used in the diagnosing and treating of disease：Corresponding site is identified respectively according to 12 sites SNPs of PRKCB gene described above
Genotype；According to the genotype combination in 12 sites SNPs, breeding oxen rate of teratosperm height is predicted；The PRKCB gene
12 sites SNPs include two kinds of haplotypes TCTGTTTCTAAC and CTCACCCTCTCA；3 kinds of lists times are shared in bull group
Type combine TCTGTTTCTAACTCTGTTTCTAAC, TCTGTTTCTAACCTCACCCTCTCA and
CTCACCCTCTCACTCACCCTCTCA；When described 12 SNPs loci gene type groups of breeding oxen PRKCB gene are combined into
When TCTGTTTCTAACCTCACCCTCTCA, the rate of teratosperm of breeding oxen is minimum.
Preferably, 12 site SNPs complete linkages of the PRKCB gene, by detecting wherein any one locus gene
Type can be obtained 12 SNPs loci gene types；Preferably, PRKCB gene the -1259th g.-1259C is detected>T genotype,
As the -1259th g.-1259C>When T genotype is CT, corresponding 12 SNPs loci gene type groups of PRKCB gene are combined into
TCTGTTTCTAACCTCACCCTCTCA。
Preferably, using bull semen DNA as template, design primer amplification includes PRKCB gene the -1259th DNA
Sequence, primer are SEQ ID NO.2 and SEQ ID NO.3.
The four of the object of the invention, provide it is a kind of for screen and/detection breeding oxen rate of teratosperm height primer, it is described
Primer is SEQ ID NO.2 and SEQ ID NO.3.
The five of the object of the invention provide primer described above in preparation for screening and/detection breeding oxen rate of teratosperm
Application in the kit of height.
The six of the object of the invention, provide it is a kind of for screen and/detection breeding oxen rate of teratosperm height kit, institute
Stating kit includes primer of the amplification comprising PRKCB gene the -1259th DNA sequence dna, PCR reaction system, endonuclease reaction body
System and DNA Marker.
Preferably, primer of the amplification comprising PRKCB gene the -1259th DNA sequence dna is SEQ ID NO.2 and SEQ ID
NO.3。
Preferably, PCR reaction system includes 2 × Taq PCR MasterMix and ddH2O；Endonuclease reaction system includes
FastDigest restriction endonuclease Alu I, 10 × FastDigest buffer and ddH2O。
The application of SNP site of the present invention, provide for screen and/detect the side of breeding oxen rate of teratosperm height
Method and kit are not belonging to the diagnosis and/treatment method of disease the purpose is to instruct the early screening of prolificacy breeding oxen.
Freeze the deficiency of abnormal rate detection technique after essence is thawed for existing breeding oxen, the present invention is directly surveyed by PCR product
The method of sequence detects the SNPs of 117 gene promoter areas Chinese Holstein breeding oxen PRKCB, detects 12 and connect completely
The SNP site g.-1526C of lock>T,g.-1409C>T,g.-1259C>T,g.-1249A>G,g.-1230C>T,g.-1220C>T,
g.-1091C>T,g.-1089C>T,g.-1088C>T,g.-1081A>T,g.-869A>C and g.-806A>C, haplotype analysis obtain
2 kinds of haplotypes, i.e. H1 (TCTGTTTCTAAC), H2 (CTCACCCTCTCA), a total of 3 kinds of haplotype combinations H1H1, H1H2,
H2H2.Be associated with bull semen quality analysis shows, H1H2 haplotype combination public affairs frozen cattle semens thaw after abnormal rate it is significantly low
In the bull (P of H1H1 and H2H2 haplotype combination<0.05).
The present invention obtains following beneficial effect：
(1) present invention firstly discloses the sites SNPs of Chinese Holstein bull PRKCB 12 complete linkages of gene and kind
Teratospermia is related after public frozen cattle semens are thawed, and identifies the genotype combination H1H2 of a kind of effectively PRKCB gene, the combination
Breeding oxen individual abnormal rate it is low, assistant breeding can be carried out.
(2) present invention utilizes SNP marker technology assistant breeding, and this screening technique can be to avoid the conventional breeding period
The limitations such as length, low efficiency have the advantages such as accuracy height, efficient and sensible, at low cost.
(3) the present invention provides a kind of novel application detection kit, PRKCB gene g.-1259C is utilized>The site T
Screen the individual that breeding oxen freezes abnormal rate height after essence is thawed.The kit can be widely applied in practice, by breeding oxen
Carry out early screening, it is possible to reduce the blindness of breeding oxen raising reduces cost, increases pasture economic benefit.
Detailed description of the invention
The Figure of description for constituting a part of the invention is used to provide further understanding of the present invention, and of the invention shows
Examples and descriptions thereof are used to explain the present invention for meaning property, does not constitute improper limitations of the present invention.
Fig. 1：Chinese holstein cattle PRKCB gene g.-1526C>T,g.-1409C>T,g.-1259C>T,g.-1249A>G,
g.-1230C>T,g.-1220C>T,g.-1091C>T,g.-1089C>T,g.-1088C>T,g.-1081A>T,g.-869A>C and
g.-806A>C sequencing result.
Fig. 2：Linkage disequilibrium value shows the 12 SNPs complete linkages of Chinese holstein cattle PRKCB gene.
Fig. 3：Chinese holstein cattle PRKCB gene SNP site (g.-1259C>T) agarose gel electrophoresis parting figure.
Specific embodiment
It is noted that described further below be all exemplary, it is intended to provide further instruction to the present invention.Unless another
It indicates, all technical and scientific terms used herein has usual with general technical staff of the technical field of the invention
The identical meanings of understanding.
It should be noted that term used herein above is merely to describe specific embodiment, and be not intended to restricted root
According to exemplary embodiments of the present invention.As used herein, unless the context clearly indicates otherwise, otherwise singular
Also it is intended to include plural form, additionally, it should be understood that, when in the present specification using term "comprising" and/or " packet
Include " when, indicate existing characteristics, step, operation and/or their combination.
In order to enable those skilled in the art can clearly understand technical solution of the present invention, below with reference to tool
The embodiment of the body technical solution that the present invention will be described in detail.
The SNP site of one N of PRKCB gene of embodiment and the identification of genotype combination
The present invention carries out SNP identification to Chinese Holstein sire PRKCB gene using PCR product direct sequencing and divides
Type.
1.1 experimental material
The bull of the present invention is selected from Shandong oaks Breeding bull station, 117 Chinese Holstein breeding oxens.Public frozen cattle semens storage
It is stored in spare in liquid nitrogen.
1.2 freeze the extraction of smart genomic DNA
Smart genomic DNA is frozen using high salt method, utilizes the purity of nucleic acid-protein analyzer detection DNA sample and dense
Degree, is finally diluted to 50ng/ μ l, 4 DEG C save backup.
The design of 1.3 primers
The ox PRKCB gene order (accession number provided according to NCBI：AC_000182), Primer Premier5.0 is utilized
The sequence of software Design primers, designed primer PRKCB-pro2-F/R is as follows：
PRKCB-pro2-F：CCGTTCGCTTCTTGGATGGG, such as SEQ ID NO.2.
PRKCB-pro2-R：TTGCTCGCCTGATCGTTTAGA, such as SEQ ID NO.3.
1.4 pcr amplification reaction
PCR reaction system (25 μ L)：2×Power Taq PCR MasterMix 12.5μl；Each 0.5 μ of upstream and downstream primer
L, 10 μm of ol/l；1 μ l, 50ng/ μ l of template；ddH2O is supplied to 25 μ l.
PCR response procedures：95 DEG C of initial denaturation, 5min；95 DEG C, 30sec of denaturation is annealed 59 DEG C, 30sec, extends 72 DEG C,
1min is recycled by 35 denaturation-annealing-extension；72 DEG C extend 10min eventually；4 DEG C of preservations.
The detection of 1.5 SNP
PCR product, which is detected, after determination is purpose band with 1% agarose gel electrophoresis send pcr amplification product to Beijing six
Close Hua Da Gene science limited liability company bidirectional sequencing.The reference of sequencing result PRKCB gene on DNAMAN and GenBank
Sequence carries out sequence alignment, in conjunction with sequencing peak figure, determines that the SNP site in target fragment is respectively：g.-1526C>T,g.-
1409C>T、g.-1259C>T、g.-1249A>G、g.-1230C>T、g.-1220C>T、g.-1091C>T、g.-1089C>T、g.-
1088C>T,g.-1081A>T,g.-869A>C and g.-806A>C, as shown in Fig. 1.
1.6 linkage disequilibrium value
117 Chinese Holstein bulls, statistics discovery are had detected, linkage disequilibrium value finds that this 12 SNPs are complete
Chain (D '=1, r2=1), as shown in Fig. 2.
The building of 1.7 haplotypes
According to Chinese Holstein breeding oxen PRKCB 12 SNP sites of gene detected, determined first in bull group
Two kinds of haplotypes out are H1 (TCTGTTTCTAAC), H2 (CTCACCCTCTCA) respectively.After two kinds of genotype combinations in group
Detect 3 kinds of haplotype combinations：H1H1, H1H2, H2H2.
The association analysis of embodiment two Ns of PRKCB gene haplotype combinations and breeding oxen sperm motility
Using SAS 9.0, compare the phase of Chinese Holstein bull PRKCB gene different genotype combination and rate of teratosperm
Guan Xing.Its model is：
Yijk=μ+Gi+Hk+eijk
YijkFor the observed value of bull sperm abnormal rate character；μ is community average；Gi:The fixed effect of haplotype combination
It answers；Hk：The fixed effect of play；eijk：Random residual effect.
Haplotype combination is associated as the result is shown：In 6 kinds of genotype combinations, the bull sperm deformity of H1H2 haplotype combination
Rate is substantially less than the bull (P of H1H1 and H2H2 haplotype combination<0.05) (table 1).
The correlation analysis of table 1 N of PRKCB gene difference haplotype combination and semen quality
Note：H1(TCTGTTTCTAAC),H2(CTCACCCTCTCA)；There is different lowercases (a, b, c, d) in same column
Significant difference (P between upper target average value<0.05).
It is related to Chinese Holstein bull semen quality trait with SAS software analysis PRKCB difference haplotype combination
Property.The result shows that (table 1), H1H2 genotype bull sperm abnormal rate is substantially less than H1H1 and H2H2 genotype individuals bull (P<
0.05)；Therefore, can using H1H2 haplotype combination as judge breeding oxen freeze essence thaw after abnormal rate height molecular labeling,
Screening for low abnormal rate breeding oxen.
During breeder's practical progress breeding to breeding oxen, if it find that some bull carries mono- times of H1H2
Type combination, then this individual expects to have lower abnormal rate character compared with other individuals.Therefore, this technology can instruct
The early screening of breeding oxen reduces the blindness of raising dairy cattle, reduces aquaculture cost, increases the economic benefit of cattle farm.This point
The application prospect of the technology of sub- marker-assisted breeding afterwards is extremely extensive.
Three detection kit of embodiment
As described in Example 1, ox PRKCB gene g.-1526C>T,g.-1409C>T,g.-1259C>T,g.-1249A>G,
g.-1230C>T,g.-1220C>T,g.-1091C>T,g.-1089C>T,g.-1088C>T,g.-1081A>T,g.-869A>C and
g.-806A>C, it is closely related with breeding oxen rate of teratosperm.Therefore, it can invent a kind of suitable for screening breeding oxen sperm
The PRKCB gene SNP s Markers for Detection kit of abnormal rate height.
1.1 PCR-RFLP Genotypings
Due to the 12 SNPs complete linkages of PRKCB promoter region, the genotype of wherein any one SNP is detected, i.e.,
The genotype of whole SNPs can be obtained.Herein, we are with g.-1259C>The site T is test point, as long as detecting g.-1259C
>The genotype in the site T, so that it may know the genotype in remaining 11 site SNPs.In order to find easier method, we are adopted
With the method for PCR-RFLP, to identify the genotype of one of SNP, it can be learnt that the genotype of entire SNPs combination.
Bioinformatics Prediction discovery, FastDigest restriction endonuclease Alu I can be with specific recognition PRKCB
The g.-1259C of gene>The site T.It include PRKCB gene g.-1259C using PRKCB-pro2-F/R primer amplification>The site T
Segment (972bp) can be cut by AluI restriction endonuclease when the site is CC genotype, obtain two pieces of 333bp and 639bp
Section；It when sporting TT genotype, can not be cut open, only a 972bp segment；When if CT heterozygous, then it can detecte
Tri- band of 333bp, 639bp and 972bp.
Endonuclease reaction system (30 μ l)：10 μ l of PCR product；1 μ l, 10U/ μ l of restriction enzyme；10×buffer 2μl；
DdH2O is supplied to 30 μ l.PCR product is detected as PCR product is digested one with corresponding restriction enzyme after purpose segment
Hour (37 DEG C).Digestion products use 1.5% agarose gel electrophoresis to detect respectively.Statistics is distinguished according to the band that electrophoresis obtains
Different genotype, the results are shown in attached figure 3.
The Kit components of 2 breeding oxen rate of teratosperm height detection of table
We acquire the sperm of breeding oxen first, spare in liquid nitrogen storage, freeze smart total DNA using high salt method.Benefit
With the ingredient in mentioned reagent box, PCR amplification is carried out by template of the jelly essence DNA of extraction.Then according to described in embodiment 1
PCR system and condition are reacted.
The PCR reaction system of 25 μ L：2×Power Taq PCR Master Mix 12.5μl；Each 0.5 μ of upstream and downstream primer
L, 10 μm of ol/l；1 μ l, 50ng/ μ l of template；ddH2O is supplied to 25 μ l.PCR response procedures：95 DEG C of initial denaturation, 5min；Denaturation 95
DEG C, 30sec anneals 59 DEG C, 30sec, extends 72 DEG C, 1min, recycles by 35 denaturation-annealing-extension；72 DEG C extend eventually
10min.Genotyping is carried out using SNPs of the PCR product direct sequencing to PRKCB gene.The condition and system of specific digestion
With described in embodiment 1.
Endonuclease reaction system (30 μ l)：10 μ l of PCR product；1 μ l, 10U/ μ l of restriction enzyme；10×buffer 2μl；
ddH2O is supplied to 30 μ l, 37 DEG C of digestion digestion system 1h.Digestion products use 3% and 2.5% agarose gel electrophoresis to examine respectively
It surveys.
Digestion interpretation of result：Selection amplification includes PRKCB gene g.-1259C>The site T is known by AluI restriction enzyme
After not, clip size is 333bp and 639bp, is CC genotype；An only 972bp segment is TT genotype；If detecting
Tri- band of 333bp, 639bp and 972bp is then CT heterozygous.
Deformity after thawing again by the public frozen cattle semens that method described in embodiment one and embodiment two analyzes each genotype combination
The height of rate.Herein, the bull of CT heterozygous genotypes is carried, i.e. carrying H1H2 haplotype combination, there is lower jelly essence solution
Abnormal rate after jelly.Whether determining to reserve seed for planting with this.
Here, although direct Sequencing can detecte out the genotype of 12 SNPs of ox PRKCB gene combination.But direct Sequencing
Method higher cost, and the period is long, is not suitable for the detection of batch samples.The kit then can be very good to make up directly
The defect of sequencing provides technology and theoretical direction for the early stage cultivation of breeding oxen.
The present invention has the illustration of practicability：
1) the present invention provides one kind by the identification site Chinese Holstein breeding oxen PRKCB gene SNP s, detects indirectly
The method that breeding oxen freezes abnormal rate after essence is thawed.This method is suitable for analyzing 12 SNP sites and kind public affairs on ox PRKCB gene
The correlation of abnormal rate after frozen cattle semens are thawed may further freeze the early diagnosis of abnormal rate height after essence is thawed as breeding oxen
Foundation provides technology and theoretical direction for the breeding oxen breeding of high semen quality.
2) efficient detection ox PRKCB gene SNP s and breeding oxen freeze abnormal rate method after essence is thawed, this method in the present invention
It can be used for the research and development that breeding oxen freezes the relevant gene diagnosis kit of abnormal rate after essence is thawed.
In conclusion the site SNPs of 12 complete linkages of Chinese Holstein breeding oxen PRKCB gene：g.-1526C>
T、g.-1409C>T、g.-1259C>T、g.-1249A>G、g.-1230C>T、g.-1220C>T、g.-1091C>T、g.-1089C>
T,g.-1088C>T,g.-1081A>T,g.-869A>C and g.-806A>Abnormal rate height is aobvious after C thaws with public frozen cattle semens
Work is related, and according to this correlation, research and development are abnormal after breeding oxen jelly essence is thawed to detect by detection PRKCB gene SNP genotype
The kit of form quotient height.
The present invention provides one kind to freeze essence solution by identifying that ox PRKCB gene mononucleotide polymorphism detects breeding oxen indirectly
The method of abnormal rate after jelly, we only need extremely a small amount of breeding oxen genomic DNA that can efficiently identify ox PRKCB base
The SNP site of cause analyzes the shadow that these genotype combinations freeze abnormal rate after essence is thawed to breeding oxen by constructing genotype combination
It rings, invention further provides a kind of kits for freezing abnormal rate height after essence is thawed suitable for detecting breeding oxen.Finally, of the invention
Provide a kind of method and reagent for freezing abnormal rate height after essence is thawed using PRKCB gene SNP Markers for Detection breeding oxen
Box.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
SEQUENCE LISTING
<110>Cow Research Center, Shandong Academy of Agricultural Sciences
<120>One group for screen and/detect breeding oxen rate of teratosperm height SNP marker
<130>
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 972
<212> DNA
<213>Ox（Bos Taurus, bovine）
<400> 1
ccgttcgctt cttggatggg gcactaaatc acactgcatt actcatgtag ataagtatta 60
ctcttcggtt gcctttctag ctttcagatt ccatccaggg gagagtccca gttgaatgct 120
agtgtgtctt tagcatctct ctaacatttg gtaatctccc ataaacaaaa gaaggcctca 180
ggtgcagatg ttttgggcaa gtggcagcat ctggagagat tttcaaagta tgtgtacctc 240
ttgctattca aactcagaaa ctagataaat atttttccct agatggtgca caaatgtgac 300
cagcatttgt gaagatgggt caggagtgaa agctggggaa acgctggcct cttaaatttc 360
tcccaacccc cctccccacc tataaacatt tttttattgg cgtatagttc atttacaatg 420
ttgtattagt ttcaggtata cagtaaagtg aatcaggtag acatatatac atatatccac 480
tctttttttc ttcttttttt aaagattatt ttcccttaaa ggacattata ggctttcttg 540
gtggctcagt ggtaaagaat ccacctgcaa tgcagaaggc gtgggttcga tccctgggtt 600
gagaagatcc cctggagaag gaaatggcag cccactccag cattcttgtc tgggaaatcc 660
catggacaga ggagcctggt gcgctacagt ccatggggtt gtaaagagta ggacacaact 720
gagcgactaa acaacaatag gccattacag agtactgagt agagttccct gtgctacact 780
gtgtgtactt attagttatc tattttatat acagtagtgt atatatgtca agcccaatct 840
cccaatttat tcctccctcc acctccccac tccctttaat ggccccattt tacagttgac 900
agaaactgag tctctttgtg gaggggatgg acagaaagta gggagttttc ttctaaacga 960
tcaggcgagc aa 972
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
ccgttcgctt cttggatggg 20
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence
<400> 3
ttgctcgcct gatcgtttag a 21
Claims (10)
1. it is a kind of for screen and/detection breeding oxen rate of teratosperm height SNP site, which is characterized in that it is SNPs described
Point is the g.-1526C of breeding oxen PRKCB gene the -1526th>T, the -1409th g.-1409C>T, the -1259th g.-
1259C>T, the -1249th g.-1249A>G, the -1230th g.-1230C>T, the -1220th g.-1220C>T ,-
1091 g.-1091C>T, the -1089th g.-1089C>T, the -1088th g.-1088C>T, the -1081st g.-
1081A>T, the -869th g.-869A>C and the -806th g.-806A>C.
2. SNP site described in claim 1 freezes essence in screening and/detection breeding oxen rate of teratosperm height and evaluation breeding oxen
Application after defrosting in sperm quality.
3. a kind of for screening and the method for/detection breeding oxen rate of teratosperm height, the method is not used in the diagnosis of disease
And treatment, which is characterized in that the gene of corresponding site is identified in 12 sites SNPs of PRKCB gene respectively according to claim 1
Type；According to the genotype combination in 12 sites SNPs, breeding oxen rate of teratosperm height is predicted；The PRKCB gene 12
The site SNPs includes two kinds of haplotypes TCTGTTTCTAAC and CTCACCCTCTCA；3 kinds of haplotype groups are shared in bull group
Close TCTGTTTCTAACTCTGTTTCTAAC, TCTGTTTCTAACCTCACCCTCTCA and
CTCACCCTCTCACTCACCCTCTCA；When described 12 SNPs loci gene type groups of breeding oxen PRKCB gene are combined into
When TCTGTTTCTAACCTCACCCTCTCA, the rate of teratosperm of breeding oxen is minimum.
4. method according to claim 3, which is characterized in that 12 site SNPs complete linkages of the PRKCB gene pass through
Wherein any one loci gene type can be obtained 12 SNPs loci gene types for detection；Preferably, detection PRKCB gene the-
1259 g.-1259C>T genotype, works as g.-1259C>When T genotype is CT, corresponding 12 site SNPs bases of PRKCB gene
Because type group is combined into TCTGTTTCTAACCTCACCCTCTCA.
5. according to the method described in claim 4, it is characterized in that, design primer amplification is wrapped using bull semen DNA as template
The DNA sequence dna that gene containing PRKCB is the -1259th, primer are SEQ ID NO.2 and SEQ ID NO.3.
6. it is a kind of for screen and/detection breeding oxen rate of teratosperm height primer, which is characterized in that the primer be SEQ
ID NO.2 and SEQ ID NO.3.
7. primer described in claim 6 preparation for screen and/detect breeding oxen rate of teratosperm height kit in
Using.
8. it is a kind of for screen and/detection breeding oxen rate of teratosperm height kit, which is characterized in that the kit packet
Include primer of the amplification comprising PRKCB gene the -1259th DNA sequence dna, PCR reaction system, endonuclease reaction system and DNA
Marker。
9. kit according to claim 8, which is characterized in that amplification includes PRKCB gene the -1259th DNA sequence dna
Primer be SEQ ID NO.2 and SEQ ID NO.3.
10. kit according to claim 8, which is characterized in that PCR reaction system includes 2 × Taq PCR MasterMix
And ddH2O；Endonuclease reaction system includes FastDigest restriction endonuclease Alu I, 10 × FastDigest buffer
And ddH2O。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810752412.9A CN108823322B (en) | 2018-07-10 | 2018-07-10 | SNP molecular markers for screening and/or detecting high and low sperm teratogenesis rate of breeding bulls |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810752412.9A CN108823322B (en) | 2018-07-10 | 2018-07-10 | SNP molecular markers for screening and/or detecting high and low sperm teratogenesis rate of breeding bulls |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108823322A true CN108823322A (en) | 2018-11-16 |
| CN108823322B CN108823322B (en) | 2021-08-03 |
Family
ID=64135508
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810752412.9A Active CN108823322B (en) | 2018-07-10 | 2018-07-10 | SNP molecular markers for screening and/or detecting high and low sperm teratogenesis rate of breeding bulls |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108823322B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014012144A1 (en) * | 2012-07-20 | 2014-01-23 | The University Of Melbourne | Method of diagnosing or prognosing a neurological disorder |
| CN105039567A (en) * | 2015-08-25 | 2015-11-11 | 山东省农业科学院奶牛研究中心 | Group of SNP (single nucleotide polymorphism) molecular markers for screening and detecting ejaculatory amount and fresh sperm activity level of stud bulls |
| CN105886639A (en) * | 2016-05-13 | 2016-08-24 | 山东省农业科学院奶牛研究中心 | SNP (single-nucleotide polymorphism) sites related to thawed stud bull frozen semen activity and deformity rate and application thereof |
| CN106544412A (en) * | 2016-08-30 | 2017-03-29 | 华中农业大学 | A kind of molecular marker related to sperm motility of boars character and application |
| WO2017210600A1 (en) * | 2016-06-03 | 2017-12-07 | The Scripps Research Institute | Compositions and methods of modulating immune response |
-
2018
- 2018-07-10 CN CN201810752412.9A patent/CN108823322B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014012144A1 (en) * | 2012-07-20 | 2014-01-23 | The University Of Melbourne | Method of diagnosing or prognosing a neurological disorder |
| CN105039567A (en) * | 2015-08-25 | 2015-11-11 | 山东省农业科学院奶牛研究中心 | Group of SNP (single nucleotide polymorphism) molecular markers for screening and detecting ejaculatory amount and fresh sperm activity level of stud bulls |
| CN105886639A (en) * | 2016-05-13 | 2016-08-24 | 山东省农业科学院奶牛研究中心 | SNP (single-nucleotide polymorphism) sites related to thawed stud bull frozen semen activity and deformity rate and application thereof |
| WO2017210600A1 (en) * | 2016-06-03 | 2017-12-07 | The Scripps Research Institute | Compositions and methods of modulating immune response |
| CN106544412A (en) * | 2016-08-30 | 2017-03-29 | 华中农业大学 | A kind of molecular marker related to sperm motility of boars character and application |
Non-Patent Citations (3)
| Title |
|---|
| D.M.HERING 等: ""Genome-wide association study for poor sperm motility in Holstein-Friesian bulls"", 《ANIMAL REPRODUCTION SCIENCE》 * |
| SW CHANG 等: ""Melatonin Pathway and Atenolol-Related Glucose Dysregulation: Is There a Correlation?"", 《CLIN TRANSL SCI》 * |
| 王赛赛: ""公绵羊精液品质相关基因群体遗传效应研究"", 《中国学位论文全文数据库》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108823322B (en) | 2021-08-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20120012065A1 (en) | Systems and Methods for Improving Protein and Milk Production of Dairy Herds | |
| US7947444B2 (en) | Leptin promoter polymorphisms and uses thereof | |
| CN112251518B (en) | Molecular marker associated with lambing number and growth traits in goat RSAD2 gene and application thereof | |
| KR101751932B1 (en) | A new dna marker and a detecting method of using the same | |
| KR20120011728A (en) | SNP Markers Associated with Meat Quantity and Beef Quality in Hanwoo | |
| CN112481392A (en) | SNP molecular marker related to multiple lambs of sheep and application thereof | |
| Naderi et al. | Assessing selection signatures within and between selected lines of dual‐purpose black and white and German Holstein cattle | |
| CN108913787B (en) | SNP molecular marker related to multiple lambs of sheep and application thereof | |
| CN104862388B (en) | The SNP marker related to the effective nipple logarithm character of pig and application | |
| CN105039567B (en) | One group for screen and the SNP marker of/detection breeding oxen ejaculation amount and fresh essence vigor height | |
| CA2600677A1 (en) | Association between markers in the leptin gene and carcass traits in commercial feedlot steer and heifers | |
| US9976182B2 (en) | Methods and compositions for improved fertilization and embryonic survival | |
| Rushdi et al. | Association between microsatellite markers and milk production traits in Egyptian buffaloes. | |
| CN114921568B (en) | SNP molecular marker related to Qinchuan cattle body ruler and meat quality traits and application thereof | |
| CN108823322A (en) | One group for screen and/detect breeding oxen rate of teratosperm height SNP marker | |
| Balteanu et al. | Characterization of the αS1-casein IRV allele provides evidence for phylogeny of the ancient Romanian Grey Steppe cattle, Moldavian strain | |
| CN108315435B (en) | SNP molecular marker related to sheep lambing number trait and application thereof | |
| CN108950014B (en) | SNP marker related to high altitude adaptability of Chinese domestic horses and application | |
| CN107574234B (en) | Method for detecting single nucleotide polymorphism of cattle ACVR1 gene and application thereof | |
| CN107130037B (en) | Method and special kit for auxiliary detection of cattle growth and carcass traits through TNNI1 gene | |
| CN105886639A (en) | SNP (single-nucleotide polymorphism) sites related to thawed stud bull frozen semen activity and deformity rate and application thereof | |
| CN106755370A (en) | Method and its application using the gene mononucleotide polymorphisms of PCR RFLP detection sheep FTH 1 | |
| KR20190107938A (en) | Single nucleotide polymorphism marker for diagnosing of osteoporosis and uses thereof | |
| CN114717336B (en) | Molecular marker related to sheep viscera weight and application thereof | |
| Rajkumar et al. | Genetic variation and genetic diversity in chicken populations using microsatellite assay |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |