CN108796125B - Kit for detecting HIV-1 - Google Patents
Kit for detecting HIV-1 Download PDFInfo
- Publication number
- CN108796125B CN108796125B CN201810599620.XA CN201810599620A CN108796125B CN 108796125 B CN108796125 B CN 108796125B CN 201810599620 A CN201810599620 A CN 201810599620A CN 108796125 B CN108796125 B CN 108796125B
- Authority
- CN
- China
- Prior art keywords
- groove
- amplification
- elution
- cracking
- tank
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
- C12Q1/703—Viruses associated with AIDS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention provides a kit for detecting HIV-1, which comprises an amplification reagent; the raw materials of the amplification reagent comprise: HIV-1 primer probe sequence; protectants including trehalose, sucrose and raffinose; a sensitivity enhancer comprising threonine, bovine serum albumin, and TrisX-100; an amplification enzyme system comprising a recombinase, a helper enzyme, a single bond binding protein, a polymerase, and an endonuclease; dNTPS. The invention can integrate the extraction and amplification detection of nucleic acid in a totally enclosed environment, and has high efficiency, simplicity and accuracy.
Description
Technical Field
The invention relates to a kit for detecting HIV-1.
Background
The RPA constant temperature amplification technology is taken as a core, and the automatic nucleic acid extraction process and the RPA constant temperature amplification detection process are constructed into an integrated nucleic acid extraction and amplification detection system, which has important practical significance for further improving the nucleic acid diagnosis and analysis efficiency and realizing the automation of the whole nucleic acid diagnosis and analysis process.
Chinese patent No. 200880122734.X discloses a reagent for detecting HIV antigens comprising a first antibody, a solid phase and a second antibody, wherein the first antibody is a first human monoclonal antibody recognizing HIV-1p24 antigen labeled with a label, and the second antibody is a second human monoclonal antibody recognizing HIV-1p24 antigen bound to a substance capable of binding to the solid phase.
Chinese patent 201510494301.9 discloses a quantitative detection kit for HIV-1, comprising: sample processing agents including guanidinium isothiocyanate, sodium citrate, sodium lauryl sarcosinate, beta-mercaptoethanol, and proteinase K; an upstream primer HIV-F for amplification of a target nucleotide; a downstream primer HIV-R for amplification of a target nucleotide; a Taqman probe HIV-P for detecting a target nucleotide, wherein two ends of the Taqman probe HIV-P are respectively combined with a fluorescent group and a fluorescence quencher; and RNA one-step reaction buffer.
Chinese patent application 201510292408.5 discloses a detection kit for HIV-1 genotype and drug-resistant mutation sites and application thereof. The kit comprises a set of primers for detecting the genotype and the drug-resistant mutation site of the genome of the HIV-1 to be detected; the set of primers comprises an amplification primer pair and a sequencing primer set.
The defects of the technical scheme are as follows:
the detection process is complicated, and manual operation is required to be added in multiple links; the detection time is long; the amplification reagent has low efficiency, low sensitivity and harsh storage conditions; the detection process is open, and cross contamination between the external environment and the detection reagent is easily caused.
Therefore, how to provide a detection process is simple and convenient, and the detection time is short; the amplification reagent is efficient, sensitive and convenient to store; the kit which is closed in the detection process and can effectively avoid cross contamination between the external environment and the detection reagent becomes a problem to be solved in the industry.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a kit for detecting HIV-1, which has simple detection process and short detection time; the amplification reagent is efficient, sensitive and convenient to store; the detection process is closed, and the cross contamination between the external environment and the detection reagent can be effectively avoided.
In order to achieve the above object, the present invention provides a kit for detecting HIV-1, the kit comprising amplification reagents; the raw materials of the amplification reagent comprise:
HIV-1 primer probe sequence;
the protective agent comprises trehalose, sucrose and raffinose;
the sensitivity enhancer comprises threonine, bovine serum albumin and TrisX-100;
the amplification enzyme system comprises recombinase, auxiliary enzyme, single bond binding protein, polymerase and endonuclease;
dNTPS。
in the invention, the components of the raw materials of the amplification reagent are mixed together and are in a liquid state; and (3) obtaining a dry powder-shaped amplification reagent after the freeze-drying process treatment.
In the invention, the HIV-1 primer probe sequence comprises:
upstream primer HIV-1F
5’-TGG CAG TAT TCA TTC ACA ATT TTA AAA GAA AAG G-3’；
Downstream primer HIV-1R
5’-CCCGAA AAT TTT GAA TTT TTG TAA TTT GTT TTT G-3’；
Probe HIV-1P
5’-TGC TATTAT GTC TAC TAT TCT TTC CCC[SIMA/FAM]GC[THF]C[dT-BHQ1]GTA CCC CCC AAT CCC C-3’；
Internal standard upstream primer NBF
5’-CGGCGGTCACCAGGCTGCGATGCAGAT-3’；
Internal standard downstream primer NBR
5’-GCTTGTTGTA CCAGCAATAT CGCTAC G-3’；
Internal standard probe NBP
TCAAGCAGCCATGCAAATGTTAA(dT-HEX)A(dSpacer)A(dT-BHQ)GAGACTATTAACGAAGA。
In the invention, the mass fractions of the components in the protective agent in the raw materials of the amplification reagent are respectively 10% of trehalose, 5% of sucrose and 2% of raffinose.
In the invention, the concentrations of all components in the sensitivity enhancer in the raw materials of the amplification reagent are threonine 1M, bovine serum albumin 0.1M and TrisX-1000.5M respectively.
In the invention, the concentrations of all components in the amplification enzyme system in the amplification reagent raw materials are 50 ng/mul of recombinase, 30 ng/mul of auxiliary enzyme, 200 ng/mul of single-bond binding protein, 10 ng/mul of polymerase and 10 ng/mul of endonuclease respectively.
In the invention, the concentration of the dNTPS in the raw material of the amplification reagent is 15 mM; the dNTPS is deoxyribonucleotide and can provide raw materials for amplification reaction.
In the present invention, the amplification reagent raw material further comprises reverse transcriptase in an amount of 3U.
The invention solves the technical problems that the nucleic acid extraction and the nucleic acid amplification detection can not be integrated and the operation of the nucleic acid extraction and the nucleic acid amplification detection process is complicated, and has high efficiency, simplicity and accuracy in result.
According to another embodiment of the present invention, the amplification reagent raw material further comprises a reaction platform, the reaction platform comprises a buffer system and an energy supply system; the buffer system comprises Tris-SO4(pH8.0), KCl and MgCl2(ii) a The energy supply system includes ATP, phosphocreatine, and creatine kinase.
In this scheme, Tris-SO4The pH value can be stabilized at 8.0 by using a sulfate buffer, which is the optimal reaction condition of the amplification enzyme system.
The concentration of each component in the buffer system in the raw material of the amplification reagent is respectively Tris-SO4100mM, KCl100mM and MgCl250mM。
The energy supply system can supply energy for the amplification reaction, and the concentration of each component in the raw materials of the amplification reagents is ATP10mM, creatine phosphate 100mM and creatine kinase 8mM respectively; ATP is adenosine triphosphate.
According to another embodiment of the present invention, the amplification reagent raw material further comprises polyethylene glycol; the concentration of polyethylene glycol in the amplification reagent raw material is 10%, preferably PEG-8000.
In the scheme, the polyethylene glycol has higher viscosity, and can limit substances participating in reaction in a smaller area during amplification reaction, shorten reaction distance and strengthen reaction effect.
According to another embodiment of the present invention, the amplification reagent raw material is processed by a lyophilization process to obtain an amplification reagent: the freeze-drying process comprises the following steps:
step S1: placing the amplification reagent raw material at-55 ℃ for 6 h;
step S2: placing the amplification reagent raw material at-35 ℃ for 12 h;
step S3: placing the amplification reagent raw material at-25 ℃ for 4 h;
step S4: the amplification reagent raw material is placed for 6 hours at the temperature of 20 ℃.
In this embodiment, the amplification reagent is stored at 4 ℃.
The protective agent can prevent other components in the amplification reagent raw material from being damaged in the freeze-drying process, and ensure that the amplification reaction is smoothly carried out.
The sensitivity enhancer may enhance the sensitivity of the amplification reagents so that lower concentrations of sample may be detected.
The amplification reagent prepared by the freeze-drying process is dry powder, easy to store and convenient to use.
The liquid reagent is freeze-dried into dry powder by adopting a freeze-drying process, and the problems of low amplification efficiency, low sensitivity and the like caused by long-term storage of the liquid reagent at-20 ℃ are mainly solved; the liquid reagent is generally preserved at the temperature of minus 20 ℃, the enzyme system of the liquid reagent higher than minus 20 ℃ is easy to lose activity, and the preservation condition is higher; the dry powder reagent can be stored for a long time at 4 ℃, and is very convenient.
According to another embodiment of the invention, the kit comprises:
the extraction bin comprises a cracking mechanism, a washing mechanism and an elution mechanism which are sequentially distributed according to the flow direction of the sample; a cracking reagent and a magnetic substance are arranged in the cracking mechanism; the washing mechanism comprises a first oil groove and a washing groove, and washing liquid is arranged in the washing groove; the first oil groove is positioned between the cracking mechanism and the washing tank; the elution mechanism comprises a second oil groove and an elution groove, and an eluent is arranged in the elution groove; the second oil groove is positioned between the washing groove and the elution groove; oil phases are arranged in the first oil groove and the second oil groove; a movable partition is arranged between every two adjacent grooves; a movable partition is arranged between the cracking mechanism and the first oil groove;
the driving mechanism comprises a sliding block which can slide according to the flow direction of the sample; a magnet is arranged on the sliding block;
an amplification tube located downstream of the elution mechanism; the amplification tube is communicated with the elution groove. In this scheme, draw the storehouse and can make by elastic material.
The number of tanks in the extraction chamber depends on the reagent or solid substance to be carried, and the capacity may vary.
The magnet is positioned in the center of the sliding block and is a permanent magnet or an electromagnet; the magnetic substance may be a magnetic bead.
The driving mechanism further comprises a power component for driving the sliding block to operate, and the power component can be a motor or a cylinder.
Nucleic acid generated after sample lysis is attached to a magnetic substance; when the slide block moves, the magnetic substance is driven by the magnet to move, so that the nucleic acid is driven to move.
Each groove is distributed along a straight line; in use, the extraction bin may be placed horizontally, vertically or inclined.
When the sliding block passes through the partition, the driving mechanism can cause the partition to lose efficacy, and the grooves on the two sides of the partition are communicated; and partial partition is permanently failed and is recovered again after the sliding block passes through.
According to another embodiment of the present invention, the lysis mechanism comprises a magnetic groove, a lysis groove and a binding groove which are sequentially distributed according to the sample flow direction; a movable partition is arranged between two adjacent grooves in the cracking mechanism; a movable partition is arranged between the combination groove and the first oil groove.
According to another embodiment of the present invention, the lysis mechanism further comprises a sample tank located upstream of the magnetic tank, the sample being located in the sample tank; the cracking reagent comprises a cracking reinforcing agent and a cracking binding solution which are respectively arranged in the cracking groove and the binding groove; the magnetic substance is arranged in the magnetic groove.
In this scheme, be equipped with the feed inlet that is used for adding the sample on the sample groove, be equipped with the sample lid on the feed inlet for the sample seals the sample groove after adding.
According to another embodiment of the present invention, the extraction chamber further comprises a buffer tank located downstream of the elution tank, and a movable partition is provided between the buffer tank and the elution tank; the buffer solution groove is positioned at the upstream of the amplification tube and is communicated with the amplification tube.
In the scheme, the buffer liquid tank is connected with the amplification tube through a connector, and a discharge hole is formed in the connector; the sample flows into the amplification tube from the buffer liquid groove through the discharge hole.
In addition, the amplification reaction may be performed in a buffer solution tank without providing an amplification tube; at this time, a connector is not required to be arranged, and a discharge port is directly arranged on the buffer liquid tank and used for flowing out of the sample after the amplification reaction.
According to another embodiment of the present invention, a sealing sheet is disposed between the first oil tank and the washing tank to be movable up and down; a sealing sheet which can move up and down is arranged between the second oil groove and the elution groove.
According to another embodiment of the invention, in the cracking mechanism, a detachable fixing card is arranged between two adjacent grooves; a detachable fixing clamp is arranged between the combination groove and the first oil groove; a detachable fixing clamp is arranged between the washing tank and the second oil tank; a detachable fixed card is arranged between the elution groove and the buffer liquid groove.
According to another embodiment of the invention, the extraction chamber further comprises an elastic sealing film, which is located below the sealing sheet and the fixing clip and is pressed by the sealing sheet and the fixing clip.
According to another embodiment of the invention, the slider is provided with a wedge-shaped block for jacking up the sealing sheet or enabling the fixing card to fall off.
In the scheme, the kit further comprises an upper cover, a bracket and a bottom cover; the bracket is fixed on the extraction bin, and the bracket and the extraction bin are combined in a bonding mode, a cementing mode, a thermal bonding mode and the like; the upper cover and the bottom cover are detachably connected and enclose a cavity, and the extraction bin and the bracket are positioned in the cavity; the bracket is provided with an upper cover mounting hole for connecting with an upper cover.
The bottom of the extraction bin is sealed by a sealing film, and the sealing film can seal liquid or solid in each groove in the extraction bin; the sealing film and the extraction bin can be combined in a bonding mode, a gluing mode, a thermal bonding mode and the like; the elastic sealing film is positioned above the sealing film and is attached to the sealing film under the pressing action of the fixing clamping sheet and the sealing sheet to isolate liquid or solid among the grooves.
The fixed cards are used for blocking reagents, so that the reagents in two adjacent grooves are prevented from being mixed, and the quantity of the fixed cards is determined according to the reaction requirement; two sides of the fixed card are respectively connected with the bottom of the upper cover through weak supports; the weak support is used to connect the fixing card and the upper cover, which are easily cut off.
The bracket is provided with a limiting groove for limiting the freedom degree of the sealing sheet, and the limiting groove and the sealing sheet are correspondingly arranged; the sealing sheet is used for preventing the reagents in the two adjacent grooves from being mixed; the top of the inner side of the upper cover is provided with a spring mounting hole which is arranged corresponding to the sealing sheet; the sealing piece comprises a bulge for pressing the elastic sealing film and a pin shaft for being matched with the spring, the bulge is positioned at the bottom of the sealing piece, and the pin shaft is positioned at the top of the sealing piece; one side of the spring is arranged in the spring mounting hole, and the other side of the spring is sleeved on the pin shaft.
The number of the wedge-shaped blocks is two, and the two wedge-shaped blocks are respectively positioned at two sides of the magnet; the sliding block is positioned outside the bottom cover.
The middle part of the bottom cover is provided with a driving groove for the movement of the magnet, and the two sides of the bottom cover are provided with slideways for the movement of the wedge-shaped blocks; when the sliding block moves, the extraction bin is positioned between the two wedge-shaped blocks; the wedge-shaped block can cut off the weak support to enable the fixed card to fall off; or the sealing sheet is jacked up through the inclined plane at the top of the sealing sheet.
The upper cover is provided with an extrusion hole which is positioned above the buffer liquid tank; the extrusion hole is connected with a press plate which can be opened and closed, and the press plate can extrude the elution groove and the buffer liquid groove when moving downwards.
According to another embodiment of the invention, a rotatable sealing shaft is arranged between two adjacent grooves, and a channel is arranged on the sealing shaft.
According to another specific embodiment of the present invention, a sealing groove matched with the sealing shaft is disposed between two adjacent grooves, and the sealing groove is disposed corresponding to the sealing shaft.
In the scheme, the kit further comprises a top cover, wherein the top cover is detachably connected with the top end of the extraction bin and seals each groove of the extraction bin; the size and shape of each groove of the extraction bin can be customized according to needs, and the quantity is determined according to reaction requirements.
The sealing shaft is provided with a knob which is positioned above the channel; the top cover is provided with a plurality of rotating holes which are arranged corresponding to the sealing shaft; the knob passes through the corresponding rotating hole.
The top cover further comprises two piston holes which are respectively positioned above the elution tank and the buffer liquid tank; one piston passes through each piston hole.
According to another embodiment of the invention, an amplification reagent for realizing the nucleic acid incremental amplification is arranged in the amplification tube, and the amplification reagent is a PCR platform reagent or a constant temperature amplification reagent.
The operating principle of the invention is as follows (the magnet is an electromagnet):
1. adding a sample into the sample groove, and sealing the feed inlet; meanwhile, the slide block is arranged below the sample groove; at this time, the magnet is not electrified and has no magnetism; 2. the slide block moves towards the direction of the amplification tube, the partition fails, and the liquid flows into the magnetic groove; 3. the slide block continues to move, the partition fails, and the liquid flows into the cracking tank; 4. the slide block continues to move, the partition fails, and liquid flows into the combination groove; 5. the magnetic substance is uniformly diffused into the lysis binding solution; the sample is lysed, releasing the nucleic acids; the nucleic acid is combined with the magnetic substance; 6. the magnet is electrified and starts to have magnetism; the sliding block continues to move, the partition fails, and the magnetic substance flows into the first oil groove; 7. the slide block continues to move, the partition wall is temporarily failed, and the magnetic substance flows into the washing tank; when the sliding block is positioned below the washing tank, the partition between the first oil tank and the washing tank is recovered, and the first oil tank and the washing tank are continuously partitioned; 8. the magnet is powered off, and the magnetic substance is uniformly diffused into the washing liquid; impurities on the magnetic substance are washed away and transferred to the washing liquid; 9. the magnet is electrified, the slide block continues to move, the partition fails, and the magnetic substance flows into the second oil groove; 10. the slide block continues to move, the partition wall is temporarily failed, and the magnetic substance flows into the elution groove; when the slide block is positioned below the elution groove, the partition between the second oil groove and the elution groove is recovered, and the second oil groove and the elution groove are continuously partitioned; 11. the magnet is powered off, and the magnetic substance is uniformly diffused into the eluent; the nucleic acid on the magnetic substance is washed away and transferred to the eluent; 12. the magnet is electrified, the slide block continues to move, the partition is invalid, and the liquid flows into the buffer liquid groove; the slide block moves back and stops below the elution tank, so that the magnetic substance is kept in the elution tank; the nucleic acid is left in the buffer solution tank; 13. under external pressure, the liquid in the buffer liquid tank flows into the amplification tube, and nucleic acid amplification is performed in the amplification tube.
Compared with the prior art, the invention has the following beneficial effects:
the invention can combine nucleic acid extraction and nucleic acid amplification detection seamlessly, only need to add samples, can get the result within 1 hour; the whole process does not need to add operation steps, and is carried out in a totally-enclosed environment, so that the cross contamination between the external environment and the detection reagent can be effectively avoided; the lysate, the washing solution and the eluent are respectively fixed in separate liquid storage cavities, and the liquids are separated by two by an oil phase, so that the liquids cannot be in direct contact with each other, and cross contamination is avoided; the amplification tube is also arranged independently, which is more beneficial to the amplification reaction.
The present invention will be described in further detail with reference to the accompanying drawings.
Drawings
FIG. 1 is an exploded view of the kit of example 1;
FIG. 2 is a sectional view of the kit of example 1;
FIG. 3 is a schematic structural view of the stent of example 1;
FIG. 4 is a schematic structural view of an upper cover of embodiment 1;
FIG. 5 is a schematic structural view of a slider in embodiment 1;
FIG. 6 is a schematic structural view of a sealing sheet of example 1;
FIG. 7 is a schematic view of the overall structure of the kit of example 1;
FIG. 8 is an exploded view of the kit of example 2;
FIG. 9 is a sectional view of the kit of example 2;
FIG. 10 is a schematic view of the structure of an extraction cartridge of example 2;
FIG. 11 is a schematic structural view of a top cover of embodiment 2;
FIG. 12 is a schematic structural view of a slider in embodiment 2;
FIG. 13 is a schematic structural view of a seal shaft of embodiment 2;
FIG. 14 is a schematic view of the overall structure of the kit of example 2;
FIG. 15 is a graph showing the results of sensitivity detection in example 1;
FIG. 16 is a graph showing the results of repetitive tests in example 1.
Detailed Description
Example 1
This example provides a kit for detecting HIV-1, which comprises an extraction chamber 1, a lysis mechanism 2, a washing mechanism 3, an elution mechanism 4, a driving mechanism 5, an amplification tube 6, an upper cover 7, a support 8 and a bottom cover 9, as shown in FIGS. 1 to 7.
Wherein, the extraction bin 1 is made of elastic material and comprises a cracking mechanism 2, a washing mechanism 3, an elution mechanism 4, a buffer liquid groove 101 and an elastic sealing film 104 which are sequentially distributed according to the flow direction of a sample; the bracket 8 is fixed on the extraction bin 1, and the bracket and the extraction bin are bonded through an adhesive; the upper cover 7 and the bottom cover 9 are detachably connected and enclose a cavity, and the extraction bin 1 and the bracket 8 are positioned in the cavity; the bracket 8 is provided with an upper cover mounting hole 801 for connecting with the upper cover 7.
A cracking reagent and a magnetic substance are arranged in the cracking mechanism 2; the magnetic substance is magnetic beads.
The washing mechanism 3 comprises a first oil groove 301 and a washing tank 302, and washing liquid is arranged in the washing tank 302; the first oil tank 301 is located between the cracking mechanism 2 and the washing tank 302.
The elution mechanism 4 comprises a second oil groove 401 and an elution groove 402, wherein an elution solution is arranged in the elution groove 402; the second oil tank 401 is located between the wash tank 302 and the elution tank 402; oil phases are arranged in the first oil groove 301 and the second oil groove 401; a movable partition is arranged between every two adjacent grooves; a movable partition is arranged between the cracking mechanism 2 and the first oil groove 301.
The cracking mechanism 2 comprises a sample groove 201, a magnetic groove 202, a cracking groove 203 and a combination groove 204 which are distributed in sequence according to the sample flow direction; a movable partition is arranged between two adjacent grooves in the cracking mechanism 2; a movable partition is arranged between the combination groove 204 and the first oil groove 301; the sample tank 201 is provided with a feed port 205 for adding a sample, and the feed port 205 is provided with a sample cover 206 for sealing the sample tank 201 after the sample is added.
The cracking reagent comprises a cracking reinforcing agent and a cracking binding solution which are respectively arranged in the cracking groove 203 and the binding groove 204; the magnetic substance is disposed in the magnetic groove 202.
The driving mechanism 5 comprises a slide block 501 capable of sliding according to the sample flow direction and a power component (not shown) for driving the slide block 501 to run, wherein the power component is a motor; a magnet 502 is arranged on the sliding block 501; a magnet 502, which is an electromagnet, is located in the center of the slider 501.
The amplification tube 6 is positioned at the downstream of the elution mechanism 4; the amplification tube 6 is communicated with the elution tank 402; the amplification tube is internally provided with an amplification reagent for realizing the increment amplification of nucleic acid, and the amplification reagent is a constant temperature amplification reagent.
Mixing the components of the amplification reagent raw material together to form a liquid state; and (3) obtaining a dry powder-shaped amplification reagent after the freeze-drying process treatment.
The raw materials of the amplification reagent comprise: HIV-1 primer probe sequence, protective agent, sensitivity enhancer, amplification enzyme system, dNTPS, reaction platform, reverse transcriptase, polyethylene glycol,
The HIV-1 primer probe sequence comprises:
upstream primer HIV-1F
5’-TGG CAG TAT TCA TTC ACA ATT TTA AAA GAA AAG G-3’；
Downstream primer HIV-1R
5’-CCCGAA AAT TTT GAA TTT TTG TAA TTT GTT TTT G-3’；
Probe HIV-1P
5’-TGC TATTAT GTC TAC TAT TCT TTC CCC[SIMA/FAM]GC[THF]C[dT-BHQ1]GTA CCC CCC AAT CCC C-3’；
Internal standard upstream primer NBF
5’-CGGCGGTCACCAGGCTGCGATGCAGAT-3’；
Internal standard downstream primer NBR
5’-GCTTGTTGTA CCAGCAATAT CGCTAC G-3’；
Internal standard probe NBP
TCAAGCAGCCATGCAAATGTTAA(dT-HEX)A(dSpacer)A(dT-BHQ)GAGACTATTAACGAAGA。
The protective agent comprises trehalose, sucrose and raffinose; the mass fractions of the components in the protective agent in the amplification reagent raw material are respectively 10% of trehalose, 5% of sucrose and 2% of raffinose.
The sensitivity enhancer comprises threonine, bovine serum albumin and TrisX-100; the concentrations of the components in the sensitivity enhancer in the amplification reagent raw material are threonine 1M, bovine serum albumin 0.1M and TrisX-1000.5M respectively.
The amplification enzyme system comprises recombinase, auxiliary enzyme, single-bond binding protein, polymerase and endonuclease; the concentrations of each component in the amplification enzyme system in the amplification reagent raw materials are 50 ng/mul of recombinase, 30 ng/mul of helper enzyme, 200 ng/mul of single-bond binding protein, 10 ng/mul of polymerase and 10 ng/mul of endonuclease respectively.
The concentration of dNTPS in the raw material of the amplification reagent is 15 mM; the dNTPS is deoxyribonucleotide and can provide raw materials for amplification reaction.
The reverse transcriptase amount was 3U.
The reaction platform comprises a buffer system and an energy supply system; the buffer system comprises Tris-SO4(pH8.0), KCl and MgCl2；Tris-SO4The pH value can be stabilized at 8.0 by using sulfate buffer solution; the concentration of each component in the buffer system in the raw material of the amplification reagent is respectively Tris-SO4100mM, KCl100mM and MgCl250mM。
Energy supply systems including ATP, phosphocreatine, and creatine kinase; the energy supply system can supply energy for the amplification reaction, and the concentration of each component in the raw materials of the amplification reagents is ATP10mM, creatine phosphate 100mM and creatine kinase 8mM respectively; ATP is adenosine triphosphate.
The polyethylene glycol is PEG-8000, and the concentration of the polyethylene glycol in the raw material of the amplification reagent is 10%; the polyethylene glycol has higher viscosity, and can limit substances participating in the reaction in a smaller area during the amplification reaction, shorten the reaction distance and strengthen the reaction effect.
The amplification reagent raw material is processed by a freeze-drying process to obtain an amplification reagent: the freeze-drying process comprises the following steps:
step S1: placing the amplification reagent raw material at-55 ℃ for 6 h; step S2: placing the amplification reagent raw material at-35 ℃ for 12 h; step S3: placing the amplification reagent raw material at-25 ℃ for 4 h; step S4: the amplification reagent raw material is placed for 6 hours at the temperature of 20 ℃.
The amplification reagents need to be stored in an environment at 4 ℃.
The protective agent can prevent other components in the amplification reagent raw material from being damaged in the freeze-drying process, and ensure that the amplification reaction is smoothly carried out.
The sensitivity enhancer may enhance the sensitivity of the amplification reagents so that lower concentrations of sample may be detected.
The amplification reagent prepared by the freeze-drying process is dry powder, is easy to store and convenient to use, and can reduce the amplification reaction time.
Carrying out sensitivity detection and repeatability detection for detecting the effect of the amplification reagent; the results of the experiment are shown in FIGS. 15 and 16, and FIG. 15 shows the sensitivity detection results of 100000IU/ml, 10000IU/ml, 1000IU/ml, 100IU/ml and 10IU/ml, and the detection limit of the concentration is 100 IU/ml. FIG. 16 shows the results of repeated detection at 100IU/ml, and it can be seen that the reagents were well repeated.
The buffer liquid tank 101 is positioned at the downstream of the elution tank 402, and a movable partition is arranged between the buffer liquid tank and the elution tank 402; the buffer liquid tank 101 is positioned at the upstream of the amplification tube 6 and is communicated with the amplification tube 6; the buffer liquid tank 101 is connected with the amplification tube 6 through a connector 102, and a discharge hole 103 is arranged on the connector 102; the sample flows into the amplification tube 6 from the buffer solution tank 101 through the discharge port 103; the upper cover 7 is provided with an extrusion hole 701, and the extrusion hole 701 is positioned above the buffer liquid tank 101; the squeezing hole 701 is connected with a pressure plate 702 which can be opened and closed, and the pressure plate 702 can squeeze the elution tank 402 and the buffer tank 101 when moving downwards.
A sealing sheet 11 which can move up and down is arranged between the first oil groove 301 and the washing groove 302; a sealing sheet 11 which can move up and down is arranged between the second oil groove 401 and the elution groove 402; the bracket 8 is provided with a limiting groove 802 for limiting the freedom degree of the sealing sheet 11, and the limiting groove 802 is arranged corresponding to the sealing sheet 11; the sealing sheet 11 is used for preventing the reagents in two adjacent grooves from being mixed; the top of the inner side of the upper cover 7 is provided with a spring mounting hole 703 which is arranged corresponding to the sealing sheet 11; the sealing plate 11 comprises a protrusion 1101 for pressing the elastic sealing film 104 and a pin 1102 for cooperating with the spring 13, the protrusion 1101 is positioned at the bottom of the sealing plate 11, and the pin 1102 is positioned at the top of the sealing plate 11; one side of the spring 13 is installed in the spring installation hole 703, and the other side is sleeved on the pin 1102.
In the cracking mechanism 2, a detachable fixed card 12 is arranged between two adjacent grooves; a detachable fixed card 12 is arranged between the combination groove 204 and the first oil groove 301; a detachable fixing card 12 is arranged between the washing tank 302 and the second oil tank 401; a detachable fixed card 12 is arranged between the elution tank 402 and the buffer tank 101; the fixing card 12 is used for blocking reagent and preventing the reagent in two adjacent grooves from mixing; the two sides of the fixed card 12 are respectively connected with the bottom of the upper cover 7 through weak supports 1201.
The elastic sealing film 104 is located below the sealing plate 11 and the fixing clip 12, and is pressed by the sealing plate 11 and the fixing clip 12.
The sliding block 501 is provided with a wedge-shaped block 503 for jacking up the sealing sheet 11 or enabling the fixed card 12 to fall off; the number of the wedge blocks 503 is two, and the two wedge blocks are respectively positioned at two sides of the magnet 502; the sliding block 501 is positioned outside the bottom cover 9; a driving groove 901 for moving the magnet 502 is arranged in the middle of the bottom cover 9, and a slide 902 for moving the wedge-shaped block 503 is arranged on two sides of the bottom cover; when the sliding block 501 moves, the extraction bin 1 is positioned between the two wedge-shaped blocks 503; the wedge-shaped block 503 can cut off the weak support 1201 to make the fixed card 12 fall off; or by a bevel at its top to lift the sealing disc 11.
In this embodiment, the bottom of the extraction bin 1 is sealed by a sealing film 105, and the sealing film 105 can seal liquid or solid in each groove in the extraction bin 1; the sealing film 105 is bonded with the extraction bin 1 through an adhesive; the elastic sealing film 104 is located above the sealing film 105, and is attached to the sealing film 105 by the pressing action of the fixing card 12 and the sealing sheet 11, thereby isolating the liquid or solid between the grooves.
The method of use of this example is as follows:
1. taking down the sample cover 206, adding the sample into the sample groove 201, and covering the sample cover 206; 2. under the drive of the power part, the slide block 501 moves towards the direction of the amplification tube 6; when the slider 501 passes the fixing card 12, the wedge block 503 cuts off the weak supports 1201 on both sides of the fixing card 12; the fixed card 12 falls off and the sealing function fails; the elastic sealing film 104 tightly pressed and sealed by the fixing card 12 bounces under the self elasticity, and never restores the sealing state; at the moment, a passage is formed, and the liquid in the grooves at the two sides of the passage is communicated; 3. the sample flows into the magnetic tank 202, and the magnetic substance carries sample information; under the action of the magnet 502, the magnetic substance carrying the sample information continuously moves along with the slide block 501; repeating step 2 when the fixed card 12 is passed; 4. when the slider 501 passes through the sealing sheet 11, the sealing sheet 11 bounces when the wedge-shaped block 503 passes through, and the elastic sealing film 104 tightly sealed by the sealing sheet 11 bounces under the action of the elasticity of the elastic sealing film; the magnetic substance passes along the slider 501; after the wedge-shaped block 503 passes, the sealing sheet 11 presses the elastic sealing film 104 again under the action of the spring 13 to block liquid on two sides of the elastic sealing film again; 5. when the magnetic substance remains in the elution tank 402 while the nucleic acid remains in the buffer tank 101, the pressing plate 702 moves downward, pressing the elution tank 402 and the buffer tank 101; the liquid in the buffer tank 101 flows into the amplification tube 6, and PCR amplification is performed in the amplification tube 6.
Example 2
This example provides a kit for detecting HIV-1, which comprises an extraction chamber 21, a lysis mechanism 22, a washing mechanism 23, an elution mechanism 24, a driving mechanism 25, an amplification tube 26, and a cap 27, as shown in FIGS. 8 to 14.
Wherein, the extraction bin 21 comprises a cracking mechanism 22, a washing mechanism 23, an elution mechanism 24 and a buffer solution groove 2101 which are distributed in sequence according to the flow direction of the sample.
A cracking reagent and a magnetic substance are arranged in the cracking mechanism 22; the magnetic substance is magnetic beads.
The washing mechanism 23 includes a first oil tank 2301 and a washing tank 2302 in which a washing liquid is filled; the first oil tank 2301 is located between the cracking mechanism 22 and the washing tank 2302.
The elution mechanism 24 comprises a second oil groove 2401 and an elution groove 2402, wherein an elution liquid is arranged in the elution groove 2402; the second oil groove 2401 is positioned between the washing groove 2302 and the elution groove 2402; oil phases are arranged in the first oil groove 2301 and the second oil groove 2401; a movable partition is arranged between every two adjacent grooves; a movable partition is arranged between the cracking mechanism 22 and the first oil tank 2301.
The cracking mechanism 22 comprises a sample slot 2201, a magnetic slot 2202, a cracking slot 2203 and a combination slot 2204 which are distributed in sequence according to the flow direction of the sample; a movable partition is arranged between two adjacent grooves in the cracking mechanism 22; a movable partition is arranged between the combination groove 2204 and the first oil groove 2301; the sample groove 2201 is provided with a feed port 2205 for adding a sample, and the feed port 2205 is provided with a sample cover 2206 for closing the sample groove 2201 after the sample is added.
The cracking reagent comprises a cracking reinforcing agent and a cracking binding solution which are respectively arranged in the cracking groove 2203 and the binding groove 2204; the magnetic substance is provided in the magnetic groove 2202.
The driving mechanism 25 includes a sliding block 2501 capable of sliding in the direction of the sample flow and a power unit (not shown) for driving the sliding block 2501 to operate, the power unit is a motor; a magnet 2502 is arranged on the sliding block 2501; the magnet 2502 is located at the center of the slider 2501, and is an electromagnet.
An amplification tube 26 is located downstream of the elution mechanism 24; the amplification tube 26 is communicated with the elution tank 2402; the amplification tube is internally provided with an amplification reagent for realizing the increment amplification of nucleic acid, and the amplification reagent is a constant temperature amplification reagent.
The buffer liquid groove 2101 is positioned at the downstream of the elution groove 2402, and a movable partition is arranged between the buffer liquid groove 2101 and the elution groove 2402; buffer reservoir 2101 is located upstream of amplification tube 26 and is in communication with amplification tube 26; the buffer liquid groove 2101 is connected with the amplification tube 26 through a connecting head 2102, and a discharge port 2103 is arranged on the connecting head 2102; the sample flows from the buffer tank 2101 into the amplification tube 26 through the discharge port 2103.
In this embodiment, a rotatable sealing shaft 28 is disposed between two adjacent grooves, a channel 2801 and a knob 2802 are disposed on the sealing shaft 28, and the knob 2802 is located above the channel 2801; the top cover 27 is detachably connected with the top end of the extraction bin 21 and seals each groove of the extraction bin 21; a sealing groove 29 matched with the sealing shaft 28 is arranged between every two adjacent grooves, and the sealing groove 29 is arranged corresponding to the sealing shaft 28.
The top cover 27 is provided with a plurality of rotating holes 2701 and two piston holes 2702, which are arranged corresponding to the seal shaft 28; the knobs 2802 pass through the corresponding rotation holes 2701; two piston bores 2702 are located above the elution tank 2402 and the buffer tank 2101, respectively; each piston bore 2702 is penetrated by a piston 2703.
The method of use of this example is as follows:
1. removing the sample cover 2206, adding the sample, and covering the sample cover 2206; at this time, the channel 2801 is perpendicular to the connecting line between the two side grooves, so as to prevent the circulation of the substances in the two grooves and play a role in isolation; 2. under the driving of the power unit, the slide block 2501 moves toward the amplification tube 26; when the slider 2501 passes the seal shaft 28, the seal shaft 28 rotates 90 °, and the channel 2801 connects two adjacent slots; 3. the sample flows into the magnetic slot 2202 through the channel 2801, and the magnetic substance carries the sample information; under the action of the magnet 2502, the magnetic substance carrying sample information continues to move along with the slide block 2501; repeating step 2 while passing the seal shaft 28; the sealing shaft 28 between the first oil groove 2301 and the washing groove 2302 and the sealing shaft 28 between the second oil groove 2401 and the elution groove 2402 rotate 90 degrees after the slider 2501 passes through, and then the grooves on both sides are closed again; the remaining seal shafts 28 are no longer rotating; 4. when the magnetic substance remains in the elution tank 2402 and the nucleic acid remains in the buffer reservoir 2101, the piston 2703 is pushed down to press the buffer reservoir 2101; the liquid in the buffer solution reservoir 2101 flows into the amplification tube 26, and PCR amplification is performed in the amplification tube 26.
Example 3
This example differs from example 1 in that: performing amplification reaction in a buffer solution tank without an amplification tube; at this time, a connector is not required to be arranged, and a discharge port is directly arranged on the buffer liquid tank and used for flowing out of the sample after the amplification reaction.
Example 4
This example differs from example 2 in that: the extraction bin is vertically arranged.
Example 5
This example differs from example 1 in that: a third oil groove is arranged between the buffer liquid groove and the amplification tube, and an oil phase is arranged in the third oil groove; a detachable fixing clamp is arranged between the buffer liquid groove and the third oil groove, and a detachable fixing clamp is arranged between the amplification tube and the third oil groove.
Although the present invention has been described with reference to the preferred embodiments, it is not intended to limit the scope of the invention. It will be appreciated by those skilled in the art that changes may be made without departing from the scope of the invention, and it is intended that all matter contained in the above description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense.
Claims (5)
1. A kit for detecting HIV-1, wherein the kit comprises amplification reagents; the raw materials of the amplification reagent comprise:
HIV-1 primer probe sequence;
protectants including trehalose, sucrose and raffinose;
a sensitivity enhancer comprising threonine, bovine serum albumin, and TrisX-100;
an amplification enzyme system comprising a recombinase, a helper enzyme, a single bond binding protein, a polymerase, and an endonuclease;
dNTPS；
the kit comprises:
the extraction bin comprises a cracking mechanism, a washing mechanism and an elution mechanism which are sequentially distributed according to the flow direction of the sample; the cracking mechanism comprises a magnetic groove, a cracking groove and a combination groove which are distributed in sequence according to the flow direction of the sample; a movable partition is arranged between every two adjacent grooves in the cracking mechanism; a cracking reagent and a magnetic substance are arranged in the cracking mechanism; the washing mechanism comprises a first oil groove and a washing groove, and washing liquid is arranged in the washing groove; a movable partition is arranged between the combination groove and the first oil groove; the first oil groove is positioned between the cracking mechanism and the washing tank; the elution mechanism comprises a second oil groove and an elution groove, and an eluent is arranged in the elution groove; the second oil groove is positioned between the washing tank and the elution tank; oil phases are arranged in the first oil groove and the second oil groove; a movable partition is arranged between every two adjacent grooves; a movable partition is arranged between the cracking mechanism and the first oil groove; the extraction bin further comprises a buffer liquid groove, the buffer liquid groove is positioned at the downstream of the elution groove, and a movable partition is arranged between the buffer liquid groove and the elution groove; a sealing sheet capable of moving up and down is arranged between the first oil groove and the washing tank; a sealing sheet capable of moving up and down is arranged between the second oil groove and the elution groove; in the cracking mechanism, a detachable fixing card is arranged between two adjacent grooves; a detachable fixing clamping piece is arranged between the combination groove and the first oil groove; a detachable fixing clamp is arranged between the washing tank and the second oil tank; a detachable fixed card is arranged between the elution tank and the buffer liquid tank; the extraction bin further comprises an elastic sealing film, and the elastic sealing film is positioned below the sealing sheet and the fixed clamping sheet and is pressed by the sealing sheet and the fixed clamping sheet;
a driving mechanism which comprises a slide block capable of sliding according to the sample flow direction; the slider is provided with a magnet; the sliding block is provided with a wedge-shaped block for jacking the sealing sheet or enabling the fixing card to fall off;
an amplification tube located downstream of the elution mechanism; the amplification tube is communicated with the elution groove; the buffer solution groove is positioned at the upstream of the amplification tube and is communicated with the amplification tube.
2. The kit of claim 1, wherein the amplification reagent feedstock further comprises a reaction platform comprising a buffer system and an energizing system; the buffer system comprises Tris-SO4(pH8.0), KCl and MgCl2(ii) a The energy supply system includes ATP, phosphocreatine, and creatine kinase.
3. The kit of claim 2, wherein the amplification reagent feedstock further comprises polyethylene glycol.
4. The kit of claim 3, wherein the amplification reagent raw material is processed by a lyophilization process to obtain the amplification reagent: the freeze-drying process comprises the following steps:
step S1: placing the amplification reagent raw material at-55 ℃ for 6 h;
step S2: placing the amplification reagent raw material at-35 ℃ for 12 h;
step S3: placing the amplification reagent raw material for 4 hours at-25 ℃;
step S4: and (3) placing the amplification reagent raw material for 6h at the environment of 20 ℃.
5. The kit of claim 1, wherein the lysis mechanism further comprises a sample well upstream of the magnetic well, the sample being located in the sample well; the cracking reagent comprises a cracking reinforcing agent and a cracking binding solution which are respectively arranged in the cracking groove and the binding groove; the magnetic substance is arranged in the magnetic groove.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810599620.XA CN108796125B (en) | 2018-06-12 | 2018-06-12 | Kit for detecting HIV-1 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810599620.XA CN108796125B (en) | 2018-06-12 | 2018-06-12 | Kit for detecting HIV-1 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108796125A CN108796125A (en) | 2018-11-13 |
| CN108796125B true CN108796125B (en) | 2021-09-10 |
Family
ID=64085396
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810599620.XA Active CN108796125B (en) | 2018-06-12 | 2018-06-12 | Kit for detecting HIV-1 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108796125B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113046486A (en) * | 2021-04-26 | 2021-06-29 | 济南国益生物科技有限公司 | Primer probe group for detecting human immunodeficiency virus based on LFD-RMA method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103966323A (en) * | 2014-04-25 | 2014-08-06 | 广州迪澳生物科技有限公司 | Dry-powder isothermal amplification detection reagent capable of being transported at normal temperature, and preparation method of detection reagent |
| CN104673621A (en) * | 2013-11-29 | 2015-06-03 | 精工爱普生株式会社 | Container For Nucleic Acid Amplification Reaction, Cartridge For Nucleic Acid Amplification Reaction, And Cartridge Kit For Nucleic Acid Amplification Reaction |
| CN106755414A (en) * | 2016-12-23 | 2017-05-31 | 宁波海尔施基因科技有限公司 | A kind of method of detection DNA genetic markers |
| CN107151700A (en) * | 2017-06-08 | 2017-09-12 | 杭州遂真生物技术有限公司 | A kind of gene tester and gene detecting kit and gene detection equipment |
| WO2017198863A1 (en) * | 2016-05-20 | 2017-11-23 | Roche Diagnostics Gmbh | Cell surface marker-depletion in a sample processing device |
| CN107916296A (en) * | 2017-12-29 | 2018-04-17 | 苏州点晶生物科技有限公司 | Gondii nucleic acid quick detection primer group, kit and detection method |
-
2018
- 2018-06-12 CN CN201810599620.XA patent/CN108796125B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104673621A (en) * | 2013-11-29 | 2015-06-03 | 精工爱普生株式会社 | Container For Nucleic Acid Amplification Reaction, Cartridge For Nucleic Acid Amplification Reaction, And Cartridge Kit For Nucleic Acid Amplification Reaction |
| CN103966323A (en) * | 2014-04-25 | 2014-08-06 | 广州迪澳生物科技有限公司 | Dry-powder isothermal amplification detection reagent capable of being transported at normal temperature, and preparation method of detection reagent |
| WO2017198863A1 (en) * | 2016-05-20 | 2017-11-23 | Roche Diagnostics Gmbh | Cell surface marker-depletion in a sample processing device |
| CN106755414A (en) * | 2016-12-23 | 2017-05-31 | 宁波海尔施基因科技有限公司 | A kind of method of detection DNA genetic markers |
| CN107151700A (en) * | 2017-06-08 | 2017-09-12 | 杭州遂真生物技术有限公司 | A kind of gene tester and gene detecting kit and gene detection equipment |
| CN107916296A (en) * | 2017-12-29 | 2018-04-17 | 苏州点晶生物科技有限公司 | Gondii nucleic acid quick detection primer group, kit and detection method |
Non-Patent Citations (1)
| Title |
|---|
| Rapid detection of HIV-1 proviral DNA for early infant diagnosis using recombinase polymerase amplification;David S. Boyle等;《mBio.》;20130430;第4卷(第2期);第2页左栏最后1段至右栏第2段、摘要、补充材料 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108796125A (en) | 2018-11-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210180114A1 (en) | Fluid Cartridge with Valve Mechanism | |
| US9752185B2 (en) | Microfluidic devices | |
| Jebrail et al. | Let's get digital: digitizing chemical biology with microfluidics | |
| US6375817B1 (en) | Apparatus and methods for sample analysis | |
| US8431390B2 (en) | Systems of sample processing having a macro-micro interface | |
| AU2003228395B2 (en) | Methods and apparatus for separation and isolation of components from a biological sample | |
| Le Roux et al. | An integrated sample-in-answer-out microfluidic chip for rapid human identification by STR analysis | |
| KR102027441B1 (en) | Unitary biochip providing sample-in to results-out processing and methods of manufacture | |
| JP5086250B2 (en) | Cartridge, system and method for automatic medical diagnosis | |
| US20050196779A1 (en) | Self-contained microfluidic biochip and apparatus | |
| CN108753968B (en) | Kit for detecting methylation of cervical cancer PAX1 gene | |
| WO2016105508A2 (en) | Devices and methods for autonomous measurements | |
| US20060144707A1 (en) | Isolation of sperm cells from other biological materials using microfabricated devices and related methods thereof | |
| US20050176135A1 (en) | Cassette for isolation, amplification and identification of DNA or protein and method of use | |
| EP3683297B1 (en) | Biological reaction device provided with microfluidic or nanofluidic structure | |
| He et al. | Capillary-based fully integrated and automated system for nanoliter polymerase chain reaction analysis directly from cheek cells | |
| CN219792985U (en) | Chip device and instrument for detecting nucleic acid | |
| CN108796125B (en) | Kit for detecting HIV-1 | |
| KR20240013129A (en) | Analyte detection cartridge and method of using the same | |
| CN108754022B (en) | Kit for detecting HBV-pgRNA | |
| CN108796126B (en) | Kit for detecting HPV | |
| AU2018200456A1 (en) | Unitary biochip providing sample-in to results-out processing and methods of manufacture | |
| Jung et al. | Recent improvement in miniaturization and integration of a DNA analysis system for rapid forensic analysis (MiDAS) | |
| CN117580645A (en) | Analyte detection cartridge and method of using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |