CN108796059A - The system of ox and its Early-stage judgment, method and kit - Google Patents
The system of ox and its Early-stage judgment, method and kit Download PDFInfo
- Publication number
- CN108796059A CN108796059A CN201810604092.2A CN201810604092A CN108796059A CN 108796059 A CN108796059 A CN 108796059A CN 201810604092 A CN201810604092 A CN 201810604092A CN 108796059 A CN108796059 A CN 108796059A
- Authority
- CN
- China
- Prior art keywords
- probe
- primer
- pcr
- bov97m
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the system of ox and its Early-stage judgment, method and kits, belong to field of biological technology detection.The feature being present in using ox folded protein gene on ox X chromosome, design one group of primer NB2-F NB2-R and probe NB2-P, this group of probe is exclusively used in the embryo that discriminating is ox, the discriminating of other species does not come out, then the specific gene SRY of bull is recycled, choose the specific designs that its sequence carries out primer and probe, primer BOV97M-F, BOV97M-R and probe BOV97M-P for designing can only expand the sample of bull, two groups of probe combinations are built into a compound detection system, the gender of successful identification cattle early embryo.High sensitivity of the present invention (can detect 3-5 cell), and sample process is fast, and detection speed is fast, it is at low cost the advantages that, in addition also efficiently avoid polluting caused by multiplex PCR and nest-type PRC, recall rate and accuracy rate 100%.
Description
Technical field
The present invention relates to molecular biology fields more particularly to a kind of ox and its Early-stage judgment method is
The optimization and upgrading of the prior art and perfect supplement.
Background technology
Certain production traits of animal are limited by gender or are only had cow just to show milk production property by Effect of gender, such as milk cow
Shape, and male animal has higher economic value because the speed of growth is fast in beef cattle production, to give full play to the breeding energy of milk cow
The growth vigor of power and bull, the gender for artificially controlling ox is always the target that people pursue, therefore is rapidly and accurately differentiated
Domestic animal early embryo sex simultaneously implements Sex Control, is the important measures for improving animal husbandry economy benefit
Previous PCR sex identifications are all made of housekeeping gene as interior label primer, are designed using the special sry gene of gender
Primer carries out double PCR Amplification Analysis, and mostly uses the method pair that nest-type PRC (nested-PCR) or genome expand in advance
DNA profiling is enriched with, cumbersome, time-consuming and laborious, easy to pollute, and technical difficulty is larger, is not easy to execute-in-place.
And substance PCR methods avoid autosome primer pair Y in multiplex PCR and contaminate due to only expanding Y chromosome special primer
The influence of colour solid special primer amplification, method is easy, but due to not having interior label primer as inner marker in reaction, it is possible to will
The sample not reacted is mistaken for female, and to increase the probability of identification result false negative, traditional PCR methods are to embryo
The demand of sample is high, and in the case of embryonic cell is small numbers of, the template obtained after sample process is difficult all to reach PCR amplification
Requirement to template, nested PCR amplification expanding effect in the case of template is relatively low is also bad, is primarily due to common
PCR method there are certain requirements template concentrations, and detection sensitivity is low, and electrophoresis detection is susceptible to pollution, therefore develops a kind of inspection
High sensitivity is surveyed, recall rate and the high ox Identification of embryo compound system of accuracy rate become current main task.
Invention content
Present invention aims at a kind of detectable ox of offer and its combined probe system of early embryo sex, this method knots
It closes and is carried out with 6 Flex fluorescent quantitative detector devices of Thermofisher companies QuantStudioTM, detection cycle is short, inspection
High sensitivity is surveyed, recall rate and accuracy rate are high.
Above-mentioned primer and probe in detecting ox and its body early embryo are utilized it is another object of the present invention to provide a kind of
The combined probe system of other fluorescence quantitative PCR detection eliminates caused by conventional PCR method and nested PCR method electrophoresis
Pollution.
The present invention is the gene shared on X chromosome for ox folded protein gene, therefore can be as in ox
Join gene, whether deposit is ox for detecting；And sry gene is distinctive gene on Y chromosome, can be used for identifying public affairs
The presence or absence of ox, the two combination can realize the sex identification of ox and body early embryo.
The PCR system of ox and its Early-stage judgment, it is characterised in that：Include in PCR system following primer and
Probe,
Interior label primer NB2-F：CGGGACTGGACTGGGAT,
Interior label primer NB2-R：CTGACTCTACGACTGTCT,
Internal standard probe NB2-P：CCTCGCATGCAGCT；
Gender site sry gene primer BOV97M-F：AACCAGTGGCTAGCAGCATCAA,
Gender site sry gene primer BOV97M-R：TTAGGAATCT ATATTGCAGCTT,
Gender site sry gene probe BOV97M-P：CTGCTCGATAGCAACC.
The PCR system is quantitative fluorescent PCR system, and fluorescent marker is connected on probe：
Internal standard probe NB2-P：HEX-CCTCGCATGCAGCT-MGB；
Gender site sry gene probe BOV97M-P：FAM-CTGCTCGATAGCAACC-MGB.
The quantitative fluorescent PCR system total volume is 15 μ L, the primer and probe of the wherein Mix+ROX of 5.2ul, 1.2ul
Mixture, 5.6ul DNA and 3ul to be measured water.
Wherein primer NB2-F：Primer NB2-R：Probe NB2-P：Primer BOV97M-F：Primer BOV97M-R：Probe
The dosage of BOV97M-P is 1:1:1.25:1:1:25.
The PCR method of ox and its Early-stage judgment, including detecting step and determination step, wherein detecting step packet
It includes and above-mentioned system is subjected to PCR amplification.
The response procedures of PCR amplification are：95℃3min；Then 95 DEG C of 30S, 58 DEG C of 40S are recycled 45 times.
The PCR amplification is fluorescent quantitative PCR.
The determination step is：Only two groups of primers and probe there is amplification and CT values to comply with standard in the case of be male
Embryo, interior label primer and probe amplification and CT values comply with standard, and gender site without amplification in the case of be female embryo.
The kit of a kind of ox and its Early-stage judgment, includes above-mentioned PCR system.
The application of above-mentioned PCR system and kit in ox and its Early-stage judgment.
The present invention is present in the feature on ox X chromosome using ox folded protein gene, designs one group of primer and probe, institute
Primer NB2-F, NB2-R and probe sequence NB2-P are stated, this group of probe is exclusively used in the embryo that discriminating is ox, the discriminating of other species
It does not come out, then recycles the specific gene SRY of bull, choose the specific designs that its sequence carries out primer and probe, draw
Object BOV97M-F, BOV97M-R and probe BOV97M-P, the primer and probe designed can only expand the sample of bull, by two groups
Probe combinations build a compound detection system, the gender of successful identification cattle early embryo.The system is one tubular type of dual probe
System, the verified species specificity of internal standard probe and gender site are strong.
Not only there is amplification curve to male embryo testing result in internal standard and gender site, but also Ct values also can be in critical field
Interior, female embryo gender site does not have amplified signal and Ct values, but interior target Ct values can also be fallen in critical field, otherwise
When unqualified sample process, thus be not present misjudgment the case where, recall rate and accuracy rate are higher.Detection process is simpler
Just, testing result is also sensitiveer, reliable.
The present invention further provides a kind of optimization PCR response procedures for above-mentioned PCR amplification, which is：PCR
Reaction condition is：95℃3min；Then 95 DEG C of 30S, 58 DEG C of 40S are recycled 45 times；The present invention is anti-by changing normal PCR simultaneously
The amplification condition answered, and realize that sample process is completed within 3 hours adds detection and analysis process, it takes short.
Method of the present invention has carried out the verification of Fit Models and types of agents respectively, at present Q6, Roche 480,
7900HT is applicable in, the KAPA universal probe mix of company in terms of reagent, ABI instrument matched reagent, and it is right in application to reduce
The dependence of proprietary production firm, greatly reduces appraisal cost, in addition, this detection architecture and method are easy to operate, it is convenient, one
As used fluorescent quantitation instrument and did PCR amplification experiment personnel it is operable.The method of the present invention is of low cost, operation is simple
It is single, quick, accurate, reliable, practical.
Certainly, those skilled in the art are easy to the primer of the present invention and probe being prepared into reagent with relevant reagent
Box, with easy to use.
The advantage of the present invention
1. detection cycle is short, result just can be obtained within 3 hours after obtaining sample.We use that embryonic cell is hands-free to be taken
Step, direct physical method processing can be carried out expanding, and amplification plus detection time are 1.5 hours total, can be provided in 1 day
Report, greatly accelerates speed.
2. high sensitivity, detection every time only needs the other DNA of pieck stage, 3-5 embryonic cell that can meet testing requirements,
Sample requirement amount is few.
3. accuracy is high, using internal standard probe and the dual guarantee of gender site probe, gropes by long-term, obtained one
The stable compound system of kind, identifies the gender of embryo while determining embryo's sample containing ox.With Standard PCR and nido
PCR method is compared, and this technology requires relatively low, to pollute probability smaller to personnel's operation, moreover we have fluorescent quantitation flat
The experimental implementation experience of platform for many years ensures that operation is accurate and reliable.
4. species specificity is good：It is verified by species specificity, many species sample standard deviations are without amplification, only in the sample of ox
In have amplification, it can be seen that, the probe specificity of this system is strong.
Description of the drawings
The mono- expansion verifications of Fig. 1 NB2,
Fig. 2 bulls blood and embryo's sample, cow blood and embryo's sample gender site amplification curve diagram,
Fig. 3 bull embryo's sample composite system amplifications,
Fig. 4 cow embryos sample composite system amplifications,
The unqualified sample composite system amplifications of Fig. 5 (NB2 Ct > 30)
The unqualified sample composite system amplifications of Fig. 6 (NB2&Bov97M Ct values do not go out)
Specific implementation mode
With reference to embodiment, the present invention is described in further detail.
(embodiment 3-5 is 3-5 cell, and minimum is 3-5 cell.)
Embodiment 1
The primer and probe sequence such as table 1 designed according to ox folded protein gene and sry gene.
1 internal standard of table and gender site primer and probe sequence
Standard PCR amplification reaction system：
384 orifice plates are placed on amplification instrument, design and run following procedure：1st step：95 DEG C are denaturalized 5 minutes, the 2nd step：94
DEG C denaturation 10 seconds, the 3rd 58 DEG C of step anneal 20 seconds, repeat 2 to 3 step 44 times.
Fig. 1 is list NB2 amplifications, and blood DNA and embryo's sample results CT value differences be not little, CT values occurs；
Fig. 2 is bull blood and embryo's sample, cow blood and embryo's sample gender site BOV97M amplification curve diagrams；
Fig. 3 expands for bull embryo's sample composite；
Fig. 4 be cow embryos sample composite amplification system, other than above-mentioned blood expanding effect is good, cow no matter blood also
It is embryo's sample, gender site does not have amplification；
Fig. 5, Fig. 6 are the amplification of unqualified sample.
Not only there is amplification curve to male embryo testing result in internal standard and gender site, but also Ct values also can be in critical field
Interior, female embryo gender site does not have amplified signal and Ct values, but interior target Ct values can also be fallen in critical field, otherwise
When unqualified sample process, thus be not present misjudgment the case where, recall rate and accuracy rate are higher.
2 specificity of embodiment
2 interior label primer of table and probe and gender site primer and probe species specificity verification result
| Sample Name | Donkey | Wolf | Ox | Recoon dog | Chicken | Sheep | Mouse | Roe deer |
| NB2 CT | Undetermined | 38.22353172 | 28.26314068 | 36.72767639 | Undetermined | 34.90315628 | Undetermined | Undetermined |
| BOV97M CT | Undetermined | Undetermined | 34.5287456 | Undetermined | Undetermined | Undetermined | Undetermined | Undetermined |
| Sample Name | Mink | Silver fox | Blue fox | 54- people source | 57- people source | NTC | NTC | NTC |
| NB2 CT | Undetermined | 34.27249908 | Undetermined | 36.56408691 | 36.3407402 | 38.96435928 | 39.47301865 | 37.88671875 |
| BOV97M CT | Undetermined | Undetermined | Undetermined | Undetermined | Undetermined | Undetermined | Undetermined | Undetermined |
It is verified by species specificity, many species sample standard deviations only have amplification in the sample of ox, thus may be used without amplification
See, the primer and probe specificity of this system are strong.
Embodiment 3 (known gender pattern detection verification)
It is to provide 78 ox embryo's samples to client using the present invention to be detected and the verification of sex identification below
1.DNA processing
Embryonic cell is handled using physics high temperature process, treated sample centrifugal treating, as template, is operated
When by template mixing.
2. fluorescence quantitative PCR detection
2.1 reaction system：
Sample presentation, first time sample presentation 32 are bull entirely to the sample that client provides in three times, wherein there is the sample deliberately not sampled
This, second of bull and cow have total 26, and third time bull has totally 20 with cow and emptying aperture, and this client uses
The method of oneself is detected, and each gender has known that the applicant is just detected according to operation standard, and system is such as
Under：
It will be made into PCR reaction mixtures (except DNA) by 2 volume ratio of table after the oscillation mixing of each reaction reagent, is dispensed into
It is last that 7ul templates are added toward each reaction tube in 384 hole reaction tubes of 20ul, then upper machine testing is centrifuged after sealer.
3 standard amplification reaction system of table
2.2 PCR response procedures：
384 orifice plates are placed on amplification instrument, design and run following procedure：1st step：95 DEG C are denaturalized 5 minutes, the 2nd step：94
DEG C denaturation 10 seconds, the 3rd 58 DEG C of step anneal 20 seconds, repeat 2 to 3 step 44 times.
2.3 data analysis：
Detection terminates data and is analyzed with software, checks positive control and negative control amplification curve and CT values, determines
Expanding effect, positive control amplification is preferable, then negative control leads the amplification CT values in internal standard and gender site without amplification
Go out.
2.4 sex determination's standards
2.5 results count
Total 78, sample of detection, wherein bull, cow, unqualified sample, the gender result complete one provided with client
It causes.
Embodiment 4 (great amount of samples batch detection)
It is the specific implementation situation that applicant largely detects 6547 ox embryo's samples using the present invention below.
1.DNA processing
Embryonic cell is handled using physics high temperature process, treated sample centrifugal treating, as template, is operated
When by template mixing.
2. fluorescence quantitative PCR detection
2.1 reaction system：
According to total number of samples, design batch scheme, plate mark is write, point multiple 384 orifice plates carry out batch detection, and system is prepared
It is as follows, a plate body system is prepared every time, and several times, 192 samples of primary probably detection are loaded, Yi Miantai according to odd-numbered line for detection
Intensive plus string hole.
It will be made into PCR reaction mixtures (except DNA) by 3 volume ratio of table after the oscillation mixing of each reaction reagent, dispenses 20ul
It is last that 7ul templates are added toward each reaction tube in 384 hole reaction tubes, then upper machine testing is centrifuged after sealer.
3 standard amplification reaction system of table
2.2 PCR response procedures：
384 orifice plates are placed on amplification instrument, design and run following procedure：1st step：95 DEG C are denaturalized 5 minutes, the 2nd step：94
DEG C denaturation 10 seconds, the 3rd 58 DEG C of step anneal 20 seconds, repeat 2 to 3 step 44 times.
2.3 data analysis：
Detection terminates data and is analyzed with software, checks positive control and negative control amplification curve and CT values, determines
Expanding effect, positive control amplification is preferable, then negative control leads the amplification CT values in internal standard and gender site without amplification
Go out.
2.4 sex determination's standards
2.5 results count
This total 6547, sample of detection, wherein bull 3118, cow 3106,323, unqualified sample, according to visitor
Family is fed back, and meets previous bull and Cow ratio, while having detected 1044 samples again, as a result compound customer requirement.
So by the detection close to 8000 samples, as a result compound customer requirement, illustrates that this system has been stablized, Ke Yijin
Row marketing simultaneously largely receives sample etc..
Sequence table
<110>Beijing Microread Gene Technology Co., Ltd.
Shijiazhuang Tianquan Good Dairy Cow Co., Ltd.
<120>The system of ox and its Early-stage judgment, method and kit
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
cgggactgga ctgggat 17
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ctgactctac gactgtct 18
<210> 3
<211> 14
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cctcgcatgc agct 14
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
aaccagtggc tagcagcatc aa 22
<210> 5
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
aaccagtggc tagcagcatc aa 22
<210> 6
<211> 16
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
ctgctcgata gcaacc 16
Claims (10)
1. N and its Early-stage judgment PCR system, it is characterised in that：Include following primer and spy in PCR system
Needle,
Interior label primer NB2-F：CGGGACTGGACTGGGAT,
Interior label primer NB2-R：CTGACTCTACGACTGTCT,
Internal standard probe NB2-P：CCTCGCATGCAGCT；
Gender site sry gene primer BOV97M-F：AACCAGTGGCTAGCAGCATCAA,
Gender site sry gene primer BOV97M-R：TTAGGAATCT ATATTGCAGCTT,
Gender site sry gene probe BOV97M-P：CTGCTCGATAGCAACC.
2. PCR system according to claim 1 is quantitative fluorescent PCR system, fluorescent marker is connected on probe：
Internal standard probe NB2-P：FAM-CCTCGCATGCAGCT-MGB；
Gender site sry gene probe BOV97M-P：FAM-CTGCTCGATAGCAACC-MGB.
3. PCR system according to claim 2, the quantitative fluorescent PCR system total volume is 15 μ L, wherein 5.2ul's
The water of the primer and probe mixture of mix+ROX, 1.2ul, the DNA and 3ul to be measured of 5.6ul.
4. PCR system according to claim 3, wherein wherein primer NB2-F：Primer NB2-R：Probe NB2-P：Primer
BOV97M-F：Primer BOV97M-R：The dosage of probe BOV97M-P is 1:1:1.25:1:1:25.
5. N and its Early-stage judgment PCR method, including detecting step and determination step, wherein detecting step include
PCR system described in claim 1-4 is subjected to PCR amplification.
6. the response procedures of PCR method according to claim 5, the PCR amplification are：95℃3min；Then 95 DEG C
30S, 58 DEG C of 40S are recycled 45 times.
7. PCR method according to claim 6, the PCR amplification is fluorescent quantitative PCR.
8. PCR method according to claim 7, the determination step are：Only two groups of primers and probe have amplification and
CT values are male embryo in the case of complying with standard；Interior label primer and probe amplification and CT values comply with standard, and gender site without
It is female embryo in the case of amplification.
9. the kit of a kind of ox and its Early-stage judgment includes the PCR system described in claim 1-4.
10. the PCR system and kit according to any one of claims 8 described in claim 1-4 are reflected in ox and its early embryo sex
Application in fixed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810604092.2A CN108796059A (en) | 2018-06-13 | 2018-06-13 | The system of ox and its Early-stage judgment, method and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810604092.2A CN108796059A (en) | 2018-06-13 | 2018-06-13 | The system of ox and its Early-stage judgment, method and kit |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108796059A true CN108796059A (en) | 2018-11-13 |
Family
ID=64085310
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810604092.2A Pending CN108796059A (en) | 2018-06-13 | 2018-06-13 | The system of ox and its Early-stage judgment, method and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108796059A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113584142A (en) * | 2021-08-04 | 2021-11-02 | 塔里木大学 | Sex identification method for mammalian embryo |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101451161A (en) * | 2007-11-29 | 2009-06-10 | 上海复星医药（集团）股份有限公司 | Method and kit for identifying milk cattle embryo gender |
-
2018
- 2018-06-13 CN CN201810604092.2A patent/CN108796059A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101451161A (en) * | 2007-11-29 | 2009-06-10 | 上海复星医药（集团）股份有限公司 | Method and kit for identifying milk cattle embryo gender |
Non-Patent Citations (3)
| Title |
|---|
| SHENDE, AM等: "Molecular cloning and expression of buffalo SRY gene: A mammalian sex determination protein", 《INDIAN JOURNAL OF BIOTECHNOLOGY》 * |
| 张伟等: "利用性别决定基因（SRY）进行牛早期胚胎性别鉴定的研究", 《黑龙江动物繁殖》 * |
| 郑小亮等: "利用多重PCR技术快速鉴定牛性别的研究", 《黑龙江畜牧兽医》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113584142A (en) * | 2021-08-04 | 2021-11-02 | 塔里木大学 | Sex identification method for mammalian embryo |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108103240A (en) | Prawn infectivity muscle necrosis virus（IMNV）RAA constant temperature fluorescence detection method and reagent | |
| CN101659996A (en) | Fluorescence PCR detection reagent capable of discriminating source components of ruminant animal, preparation method and application thereof | |
| CN107988325A (en) | Shrimp liver sausage born of the same parents worm（EHP）RAA constant temperature fluorescence detection method and reagent | |
| CN110656187B (en) | Kit for detecting pathological tissues or echinococcus in canine feces by multiple RAA and multiple PCR and detection method | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| CN105861641A (en) | Primer, kit and method for detecting CHO cell DNA residues | |
| CN105506111A (en) | Method for detecting CNV (copy number variation) mark of MAPK10 gene of Nanyang cattle and application thereof | |
| CN104561327B (en) | It is a kind of while detecting the double fluorescent PCR method of horse and donkey derived component | |
| CN107400720A (en) | A kind of method and its dedicated kit of KLF3 gene Cs NV marks auxiliary detection ox growth traits | |
| CN106434921B (en) | A kind of microbial sources tracking molecular marked compound and its high-flux detection method detected for a variety of fecal pollution sources | |
| CN107988427A (en) | Prawn hepatopancreatic parvovirus（HPV）RAA constant temperature fluorescence detection method and reagent | |
| CN107988426A (en) | Prawn Taura syndrome（TSV）RAA constant temperature fluorescence detection method and reagent | |
| CN108342495A (en) | Sheep and goat source property synchronizes the primer and probe and kit of detection in meat products | |
| CN114774563B (en) | Detection reagent for brucellosis in dog and application | |
| CN106148484B (en) | A kind of kit that diagnosis Y chromosome is micro-deleted | |
| CN108085397A (en) | Primer and probe and its kit and method based on fluorescence quantitative PCR detection Mandarin fish | |
| CN108796059A (en) | The system of ox and its Early-stage judgment, method and kit | |
| CN111485023A (en) | Composition and kit for multiple detection of breast cancer typing based on RNA molecular marker | |
| CN106119390A (en) | A kind of based on MGB probe identification donkey skin, Corium Equi and the test kit of mule skin and detection method thereof | |
| CN110564882A (en) | Dual TaqMAN probe fluorescent quantitative PCR detection method for equine piroplasmosis | |
| CN104694534B (en) | Non-small cell lung cancer marker, detection method and application thereof | |
| CN107746884B (en) | AFLP primer combination product, kit and method for identifying individual and variety of beef cattle | |
| CN113481303B (en) | Method for auxiliary detection of growth traits by cattle ACTR3 gene CNV markers and application thereof | |
| CN109680101A (en) | A kind of rapid detection method for distinguishing the strong and weak poison of H7N9 subtype avian influenza virus | |
| CN113151501B (en) | Method for assisted detection of growth traits by cattle WBP1L gene CNV markers and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: 100044 601, 6th floor, building 10, No.39 courtyard, Sanlihe Road, Haidian District, Beijing Applicant after: Beijing Yuewei Gene Technology Co.,Ltd. Applicant after: SHIJIAZHUANG TIANQUAN LIANGZHONG COW Co.,Ltd. Address before: 100044 601, 6th floor, building 10, No.39 courtyard, Sanlihe Road, Haidian District, Beijing Applicant before: BEIJING MICROREAD GENE TECHNOLOGY Co.,Ltd. Applicant before: SHIJIAZHUANG TIANQUAN LIANGZHONG COW Co.,Ltd. |
|
| CB02 | Change of applicant information | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20181113 |
|
| RJ01 | Rejection of invention patent application after publication |