CN108796048A - A kind of detection method of fine-resolution tRNA derived segments end single nucleotide acid difference - Google Patents
A kind of detection method of fine-resolution tRNA derived segments end single nucleotide acid difference Download PDFInfo
- Publication number
- CN108796048A CN108796048A CN201810663764.7A CN201810663764A CN108796048A CN 108796048 A CN108796048 A CN 108796048A CN 201810663764 A CN201810663764 A CN 201810663764A CN 108796048 A CN108796048 A CN 108796048A
- Authority
- CN
- China
- Prior art keywords
- trf
- resolution
- specific
- fine
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention discloses a kind of detection methods of fine-resolution tRNA derived segments end single nucleotide acid difference, include the following steps：(1) design of specific linkers sequence, specific reverse transcriptase primer and detection probe and primer sequence；(2) connector connects：The specific linkers sequence designed in step (1) is added in RNA, specific ends ring-type hairpin structure is formed by denaturation, annealing, three steps of connection；(3) step (2) the connector RNA is mixed with step (1) the specific reverse transcriptase primer carries out reverse transcription；(4) TaqMan qPCR are detected.The present invention is based on TaqMan qPCR methods, for tRF in organism research provide it is a kind of effectively and easily can fine-resolution difference tRF variants method, resolution ratio can be accurate to single nucleotide acid difference, this has the biological function and mechanism of action of furtheing investigate tRF comprehensively significant.
Description
Technical field
The present invention relates to Measurement for Biotechnique, Celluar and Molecular Biology fields, and in particular to one kind can essence
Really differentiate the detection method of tRNA derived segments end single nucleotide acid difference.
Background technology
TRNA derived segments are a kind of small fragment non-coding RNAs being largely present in living organism, these tiny RNAs were both
Can be generated, can also be generated under stress situation by the cleavages such as Dicer or RNase Z tRNA, such as hungry, hypoxia or
It is the influence of angiogenin.Research shows that in body certain stress-induceds tRF mediating stress responses, so as to cause stress be micro-
The assembling of grain, inhibits the synthesis of protein；In addition, some tRF can influence a series of cell function, such as influence cancer cell
Proliferation and transfer, mediate signal of interest access in RNA molecule inactivation etc..
Can be following by tRF points according to the producing method of tRF and its with ripe tRNA or the matched positions precursor tRNA
Several classes：1) it is generated under stress situation, the 31-40 bases longs generated by cutting at the anticodon loop of ripe tRNA
TRF is known as tiRNA, including 5 ' tiRNA, i.e., since the ripe ends tRNA5 ' until anticodon loop；3 ' tiRNA, i.e., from
3 ' the ends ripe tRNA start until anticodon loop；2) similar to miRNA, possess 5 ' terminal phosphate groups and 3 ' ends
Hydroxyl group, length include resulting from the ripe ends tRNA5 ' according to the matching position of itself and tRNA sequences in 14-30 base
TRF5, result from and the tRF3 of the ripe ends tRNA3 ' and result from the tRF1 of the ends precursor tRNA3 '.
With going deep into for research, researchers have found works of the tRF in the life processes such as the differentiation, development, proliferation of cell
With more and more important, the research of biological function and molecular mechanism is increasingly valued by people, therefore accurate detection is special
It is the important first step for furtheing investigate its function to determine tRF.At present for the research of tRFs, the most common detection mode of use
There are mainly two types of：1)Northern Blot：The advantage of the method is that its specificity is high, can detect the size of target fragment with
And whether there is variable sheer to occur, but since this method allows the unpaired property in part of probe, also cause it to deriving from
The resolution ratio of the tRF of the different length of same tRNA, the tRF of especially 1-2 base difference reduce, while the method and qPCR
It is relatively low compared to sensitivity, cumbersome, to RNA without enzyme operation require higher so that it is unsuitable for the mass detection of tRF；2)
Anneal with one section of catenation sequence with oligo (dT) after the 3 ' ends target tRF add poly (A) tail to be formed one section it is longer
RNA, to being detected with qPCR, the method is easy, quickly, but specificity is relatively low, can not fine-resolution derive from same tRNA
Different length tRF, the tRF of especially 1-2 base difference.Thus there is still a need for one kind for this field can be with fine-resolution tRNA
The detection method of derived segment end single nucleotide acid difference and high sensitivity easy to operate.
Invention content
The present invention is intended to provide a kind of high-resolution detection method identifies that different type or same type difference are grown
The tRF of degree.In view of the defect of existing Northern Blot and qPCR methods, the method provided can not only reduce the present invention
Cumbersome, the raising sensitivity of operation, and specificity can be improved so that difference of the high resolution up to a base.
Technical solution provided by the present invention：A kind of inspection of fine-resolution tRNA derived segments end single nucleotide acid difference
Survey method, this approach includes the following steps：
(1) pass through 3 '-Db- connectors when tRF sequences are tRF5 according to different tRF sequence designs specific linkers sequences
It is connected with the 3 ' ends of tRF5；When tRF sequences are tRF3, it is connected with the 5 ' ends of tRF3 by 5 '-Db- connectors；Together
When design specific reverse transcriptase primer and in the TaqMan probe and up and down across joint designed for TaqMan qPCR detection
Swim amplimer；The specific linkers sequence is：
3 '-Db- connectors：
/ 5Phos/XTCAGTGCAGGGTCCGAGGTATTCGCACTGAYNNNNNN, wherein X, Y match base each other, and N is
With the base of last 6 base pair complementarities of purpose tRF5 sequences connecting pin；
5 '-Db- connectors：
MMMMMMCTCAGTGCATGGGAGGGTGTGTGGTCTTGCTTGGTGTGCACTGrArG, wherein M are and purpose
The base of last 6 base pair complementarities of tRF3 sequences connecting pin；
The specific reverse transcriptase primer sequence is：
Sequence suitable for 3 '-Db- connector systems is XTCAGTGCGAATACCTCGGACCCT；
Sequence suitable for 5 '-Db- connector systems is the downstream primer of TaqMan qPCR amplification systems；
(2) jointing：
RNA sample 100-1000ng is taken to be mixed with 20pmol steps (1) the specific linkers sequence, with annealing buffer
10 μ l systems are formed, are denaturalized 3 minutes in 95 DEG C, it is small in 37 DEG C of incubations 1 using T4RNA ligases after Temperature fall annealing in 2 hours
When, 4 DEG C of connections are overnight to form stable end hairpin structure, to obtain connector RNA；
(3) reverse transcription reaction of specific reverse transcriptase primer：
It is using Reverse Transcriptase kit, step (2) the connector RNA and step (1) the specific reverse transcriptase primer is mixed
Reverse transcription system of preparing is closed, reaction forms reverse transcription product；
(4) TaqMan qPCR are detected
Using TaqMan qPCR kits, step (1) described TaqMan is added in step (3) described reverse transcription product
Probe and upstream and downstream amplimer, mixed preparing qPCR amplification systems calculate target tRF using relative quantification method according to CT values
Expression quantity.
The beneficial effects of the invention are as follows：TRF detection methods provided by the invention are using specific loop-stem structure joint sequence
The mode combined with TaqMan qPRC, it is contemplated that the influence of the tRF of the different length and type in complexity source in vivo has height
Specificity, high-resolution is highly sensitive, is widely used in all types of tRF.The present invention is for accurately detecting cell, body fluid or group
Specific tRF in tissue samples simultaneously furthers investigate its biological function and is of great significance.
Description of the drawings
Fig. 1 is the sequence design schematic diagram of the method for the present invention；
Fig. 2 is the design sketch of the method for the present invention：A is electrophoretogram, and B is selected tRF sequence charts, and C is generation sequencer map；
Fig. 3 is the accuracy experiment in vitro proof diagram of the method for the present invention：A is the specific linkers for only using Gly-GCC_29
Sequence, B are the specific linkers sequence for only using Gly-GCC_30, and C is the specific linkers sequence for only using Gly-GCC_31；
Fig. 4 is that the present invention is suitable for a kind of specific tRF5 cleavage site proof diagrams in vivo：A is bioinformatic analysis
Figure, B are experimental verification figure of the present invention；
Fig. 5 is that the present invention is suitable for a kind of specific tRF3 cleavage site proof diagrams in vivo：A is bioinformatic analysis
Figure, B are experimental verification figure of the present invention.
Specific implementation mode
In order to make the purpose , technical scheme and advantage of the present invention be clearer, with reference to the accompanying drawings and embodiments, right
The present invention is further elaborated.It should be appreciated that described herein, specific examples are only used to explain the present invention, not
For limiting the present invention.
A kind of detection method of fine-resolution tRNA derived segments end single nucleotide acid difference provided by the invention, specifically
Implementation steps are as follows：
(1) it is connect by 3 '-Db- according to different tRFs sequence designs specific linkers sequences when tRF sequences are tRF5
Head is connected with the 3 ' ends of tRF5；When tRF sequences are tRF3, it is connected with the 5 ' ends of tRF3 by 5 '-Db- connectors,
Specific reverse transcriptase primer and the TaqMan probe and up and down across joint designed for TaqMan qPCR detection are designed simultaneously
Swim amplimer；
(2) jointing：
Prepare denaturation annealing reaction system according to the proportioning of the following table 1：
Table 1
| RNA oligonucleotide sequence anneals buffer solution (5 ×) | 2μl |
| Step (1) the specific linkers sequence | 20pmol |
| Total serum IgE | 1μg |
| Nuclease free deionized water | To 10μl |
95 DEG C of heat denatureds 3 minutes, room temperature Temperature fall is after about 2 hours, using T4RNA ligases (NEB), according to following table
2 proportioning prepares coupled reaction system：
Table 2
37 DEG C are incubated 1 hour, and 4 DEG C of connections are stayed overnight, to form stable end hairpin structure, to obtain connector RNA.
(3) reverse transcription reaction of specific reverse transcriptase primer：
Use PrimeScriptTMRT reagent Kit (Takara) prepare reverse transcription reaction system according to the following table 3：
Table 3
| 5 × PrimeScript buffer solutions | 2μl |
| PrimeScript reverse transcriptase mixed systems I | 0.5μl |
| Step (1) the specific reverse transcriptase primer (2 μM) | 0.5μl |
| The specific reverse transcriptase primer (2 μM) of reference gene*1 | 0.5μl |
| Connection RNA described in step (2) | 5μl |
| Nuclease free deionized water | To 10μl |
Remarks：" * 1 " according to experiment purpose can select that internal reference is added or be added without internal reference.
Reverse transcription reaction condition is：42 DEG C, 15 minutes → 85 DEG C, 5 seconds → 4 DEG C.
(4) TaqMan qPCR are detected
Use Premix Ex TaqTMIt is anti-to prepare TaqMan qPCR according to the following table 4 for (Probe qPCR) reagent (Takara)
Answer system：
Table 4
| Premix Ex Taq(Probe qPCR)(2×) | 10μl |
| PCR sense primers (10 μM) | 0.4μl |
| PCR downstream primers (10 μM) | 0.4μl |
| Step (1) described TaqMan probe (10 μM) | 0.4μl |
| ROX dyestuffs (50 ×) | 0.2μl |
| Step (3) described reverse transcription product | 3μl |
| Sterile purified water | To 20μl |
According to program amplified production shown in the following table 5：
Table 5
The expression quantity that purpose tRF is calculated using the method for relative quantification, i.e., calculate target gene and reference gene first
Ct average values, the practical Ct values Δ of sample target gene is calculated according to the difference of target gene and the mean value of reference gene Ct values
Ct (Δ Ct=CtPurpose-CtInternal reference), 2 then are carried out to each sample Δ Ct-ΔΔCtIt calculates, in favor of later stage statistical analysis.Wherein Δ Δ
Ct=Δs CtExperimental group-ΔCtControl group。
According to above-mentioned implementation steps, following experiment has specifically been carried out：
Experiment one
1. according to the primer (attached drawing 1) of step (1) the design tRF ArgTCG-19；
2. obtaining connector RNA according to step (2)；
3. obtaining reverse transcription product according to step (3), the specific reverse transcriptase primer of reference gene is not added in table 3；
4. obtaining final amplified production according to step (4), product is detected into row agarose gel electrophoresis, and testing result is for example attached
Shown in Fig. 2A, amplified production size is 51bp；After this band glue is recycled, purpose tRF, sequencing knot are determined that it is through generation sequencing
Fruit sees attached drawing 2B.
Experiment two
1. 3 tRF of chemical synthesis, only there are one the difference of base, such as the following table 6 for sequence：
Table 6
| GlyGCC_29 | GCATGGGTGGTTCAGTGGTAGAATTCTCG |
| GlyGCC_30 | GCATGGGTGGTTCAGTGGTAGAATTCTCGC |
| GlyGCC_31 | GCATGGGTGGTTCAGTGGTAGAATTCTCGCC |
RNA is diluted with nuclease free deionized water, the RNA working solutions of 100nM are configured to according to the following table 7 experiment packet, is protected
The concentration for demonstrate,proving each RNA in mixed liquor is unanimously 100nM；
Table 7
| ① | ② | ③ | ④ | ⑤ | ⑥ | ⑦ | ⑧ | |
| GlyGCC_29 | + | + | + | + | - | - | - | - |
| GlyGCC_30 | + | + | - | - | + | + | - | - |
| GlyGCC_31 | + | - | + | - | + | - | + | - |
2. according to step (1) the design joint sequence and primer；
3. obtaining connector RNA according to step (2)；
4. obtaining reverse transcription product according to step (3), the specific reverse transcriptase primer of reference gene is not added in table 3；
5. obtaining final amplified production and calculation expression amount according to step (4), attached drawing 3 is as a result seen.
Experiment three
1. early period by the lung cancer sample in bioinformatic analysis TCGA databases and NSCLC databases, finds in lung
There are specific cleavage sites by tRF5 and tRF3 in cancerous tissue.By taking tRF5ArgACG as an example, the master in cancerous lung tissue sample
It is 19 bases longs (Fig. 4 A) to want existing way；By taking tRF3AspATC as an example, being primarily present in cancerous lung tissue sample
Mode is 18 bases longs (Fig. 5 A)；
2. the RNA of the 10 cancerous lung tissue samples provided using Shao Yi husbands hospital of Zhejiang Province verifies bioinformatic analysis knot
Fruit, according to described design ArgACG_16, ArgACG_19, ArgACG_22, ArgACG_25 and the AspATC_18 of step (1),
The corresponding joint sequence of AspATC_22, AspATC_26, AspATC_30 and primer；
3. obtaining connector RNA according to step (2)；
4. according to step (3) acquisition reverse transcription product, using U6 as reference gene in table 3；
5. obtaining final amplified production and calculation expression amount according to step (4), attached drawing 4B, Fig. 5 B are as a result seen.
Acquired results are：TRF detection methods provided by the invention can accurately amplify purpose tRF, while specificity is high,
Can be with fine-resolution single nucleotide acid difference, and sensitivity is strong, the detection needs being equally applicable under internal complex environment.
The foregoing is merely the preferable implementation examples of the present invention, are not intended to restrict the invention, it is all in spirit of that invention and
Within principle, any modification, equivalent replacement, improvement and so on should all be included in the protection scope of the present invention.
Claims (5)
1. a kind of detection method of fine-resolution tRNA derived segments end single nucleotide acid difference, which is characterized in that including with
Lower step：
(1) according to different tRF sequence designs specific linkers sequences, when tRF sequences are tRF5, by 3 '-Db- connectors with
3 ' the ends of tRF5 are connected；When tRF sequences are tRF3, it is connected with the 5 ' ends of tRF3 by 5 '-Db- connectors；Simultaneously
Design specific reverse transcriptase primer and in the TaqMan probe and upstream and downstream across joint designed for TaqMan qPCR detections
Amplimer；
(2) jointing：It takes RNA sample 100-1000ng to be mixed with 20pmol steps (1) the specific linkers sequence, and moves back
Fiery buffer solution forms 10 μ l systems, is denaturalized 3 minutes in 95 DEG C, using T4 RNA ligases in 37 after Temperature fall annealing in 2 hours
It DEG C is incubated 1 hour, 4 DEG C of connections are overnight to form stable end hairpin structure, to obtain connector RNA；
(3) reverse transcription reaction of specific reverse transcriptase primer：Using Reverse Transcriptase kit, by step (2) the connector RNA and step
Suddenly (1) the specific reverse transcriptase primer mixed preparing reverse transcription system, reaction form reverse transcription product；
(4) TaqMan qPCR are detected：Using TaqMan qPCR kits, step is added in step (3) described reverse transcription product
Suddenly (1) described TaqMan probe and upstream and downstream amplimer, mixed preparing qPCR amplification systems, using relative quantification method according to
CT values calculate the expression quantity of target tRF.
2. a kind of detection side of fine-resolution tRNA derived segments end single nucleotide acid difference according to claim 1
Method, which is characterized in that in the step (1), the specific linkers sequence is：
3 '-Db- connectors：
/ 5Phos/XTCAGTGCAGGGTCCGAGGTATTCGCACTGAYNNNNNN, wherein X, Y match base each other, and N is and mesh
TRF5 sequences connecting pin last 6 base pair complementarities base；
5 '-Db- connectors：
MMMMMMCTCAGTGCATGGGAGGGTGTGTGGTCTTGCTTGGTGTGCACTGrArG, wherein M are and purpose tRF3 sequences
Arrange the base of last 6 base pair complementarities of connecting pin.
3. a kind of detection side of fine-resolution tRNA derived segments end single nucleotide acid difference according to claim 1
Method, which is characterized in that in the step (1), the specific reverse transcriptase primer sequence is：Suitable for 3 '-Db- connector systems
Sequence is XTCAGTGCGAATACCTCGGACCCT；Sequence suitable for 5 '-Db- connector systems is that TaqMan qPCR expand body
The downstream primer of system.
4. a kind of detection side of fine-resolution tRNA derived segments end single nucleotide acid difference according to claim 1
Method, which is characterized in that the Reverse Transcriptase kit used in the step (3) is PrimeScriptTM RT reagent Kit
(Takara)。
5. a kind of detection side of fine-resolution tRNA derived segments end single nucleotide acid difference according to claim 1
Method, which is characterized in that the TaqMan qPCR kits used in the step (4) are Premix Ex TaqTM(Probe
QPCR) kit (Takara).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663764.7A CN108796048A (en) | 2018-06-25 | 2018-06-25 | A kind of detection method of fine-resolution tRNA derived segments end single nucleotide acid difference |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663764.7A CN108796048A (en) | 2018-06-25 | 2018-06-25 | A kind of detection method of fine-resolution tRNA derived segments end single nucleotide acid difference |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108796048A true CN108796048A (en) | 2018-11-13 |
Family
ID=64071273
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810663764.7A Pending CN108796048A (en) | 2018-06-25 | 2018-06-25 | A kind of detection method of fine-resolution tRNA derived segments end single nucleotide acid difference |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108796048A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114672550A (en) * | 2022-05-05 | 2022-06-28 | 青岛大学 | Atherosclerosis biomarker and inhibitor and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2001245330A1 (en) * | 2000-02-25 | 2001-09-03 | Tao Biosciences, Llc | Genomic analysis of tRNA gene sets |
| US20090142752A1 (en) * | 2006-10-04 | 2009-06-04 | Third Wave Technologies, Inc. | Snap-Back Primers And Detectable Hairpin Structures |
| WO2015076356A1 (en) * | 2013-11-22 | 2015-05-28 | 株式会社カネカ | Short-chain rna detection method |
| CN107760678A (en) * | 2017-10-31 | 2018-03-06 | 安徽省农业科学院水产研究所 | The amplification method of 3 ' RACE adapter-primers and 3 ' end unknown gene sequences |
| CN108165613A (en) * | 2017-12-26 | 2018-06-15 | 上海英拜生物科技有限公司 | A kind of method for detecting excretion body tRFRNA |
-
2018
- 2018-06-25 CN CN201810663764.7A patent/CN108796048A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2001245330A1 (en) * | 2000-02-25 | 2001-09-03 | Tao Biosciences, Llc | Genomic analysis of tRNA gene sets |
| US20090142752A1 (en) * | 2006-10-04 | 2009-06-04 | Third Wave Technologies, Inc. | Snap-Back Primers And Detectable Hairpin Structures |
| WO2015076356A1 (en) * | 2013-11-22 | 2015-05-28 | 株式会社カネカ | Short-chain rna detection method |
| CN107760678A (en) * | 2017-10-31 | 2018-03-06 | 安徽省农业科学院水产研究所 | The amplification method of 3 ' RACE adapter-primers and 3 ' end unknown gene sequences |
| CN108165613A (en) * | 2017-12-26 | 2018-06-15 | 上海英拜生物科技有限公司 | A kind of method for detecting excretion body tRFRNA |
Non-Patent Citations (3)
| Title |
|---|
| PAUL SCHAUGHENCY等: "Genome-Wide Mapping of Yeast RNA Polymerase II Termination", 《PLOS GENETICS》 * |
| ROCKVILLE，ARRAYSTAR INC.: "nrStarTM Human tRF&tiRNA PCR Array Cat#:AS-NR-002", 《NRSTARTM HUMAN TRF&TIRNA PCR ARRAY CAT#:AS-NR-002》 * |
| SHOZO HONDA ET AL: "Dumbbell-PCR: a method to quantify specific small RNA variants with a single nucleotide resolution at terminal sequences", 《NUCLEIC ACIDS RESEARCH》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114672550A (en) * | 2022-05-05 | 2022-06-28 | 青岛大学 | Atherosclerosis biomarker and inhibitor and application thereof |
| CN114672550B (en) * | 2022-05-05 | 2023-11-17 | 青岛大学 | Atherosclerosis biomarker and inhibitor and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107760762B (en) | Fluorescent chemical sensor for detecting DNA adenine methyltransferase and detection method thereof | |
| CN110184329A (en) | A kind of one-step method nucleic acid detection method and kit based on CRISPR/Cas and constant-temperature amplification | |
| WO2021155728A1 (en) | Nucleic acid detection kit for novel coronavirus 2019-ncov | |
| EP4023767A1 (en) | Method, composition and kit for fluorescent quantitative pcr, and use thereof | |
| US10266880B2 (en) | Method for quantitative measuring short RNA using amplified DNA fragment length polymorphism | |
| CN105821138A (en) | Method for constructing double-stem-loop structure DNA template to detect nucleic acid based on ligation reaction | |
| CN109750088B (en) | TdT-RCA-based sensor and application thereof in DNA methyltransferase detection | |
| CN109825616A (en) | For detecting streptococcic primer sets of B race and application thereof | |
| CN108165613A (en) | A kind of method for detecting excretion body tRFRNA | |
| JP2022547023A (en) | Systems, methods, and compositions for rapid early detection of host RNA biomarkers of infection and early identification of COVID-19 coronavirus infection in humans. | |
| CN110791578A (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for bordetella pertussis and application of CRISPR detection primer group | |
| CN105463110B (en) | A method of MicroRNA is detected using two-step amplification method | |
| CN107254553A (en) | Fluorescence real-time detection method and application for detecting multiple pathogens | |
| CN114134219A (en) | Multiple nucleic acid detection system and preparation method and application thereof | |
| CN109207568A (en) | For detecting the fluorescence real-time detection reagent and method of mutant | |
| CN109251964B (en) | Circulating microRNAs detection kit, method for specifically detecting circulating microRNAs and application | |
| CN108796048A (en) | A kind of detection method of fine-resolution tRNA derived segments end single nucleotide acid difference | |
| CN107988318B (en) | Method for rapidly detecting nucleic acid based on electrochemical potential pretreatment technology and application | |
| CN105525038B (en) | Newcastle disease virus is strong, weak malicious one-step method real-time fluorescent RT-PCR detection kit | |
| Lai et al. | A specific and low background nucleic acids sensing strategy based on rolling circle amplification coupled with a magnetic DNA machine | |
| EP3521450A1 (en) | Method for detecting small rnas or proteins associated with small rnas | |
| CN107873058B (en) | Detection of nucleic acid molecules | |
| KR102435116B1 (en) | Method for detecting influenza virus using CRISPR-Cas system and multiplex LAMP primer set | |
| CN112410401B (en) | Method for obtaining fragmented DNA single-strand pool and application thereof | |
| CN113322306A (en) | Biosensor combining exponential amplification reaction and CRISPR-Cas12a as well as detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |