CN108795931B - Rapid purification reagent for sputum microorganisms and application thereof - Google Patents
Rapid purification reagent for sputum microorganisms and application thereof Download PDFInfo
- Publication number
- CN108795931B CN108795931B CN201810745633.3A CN201810745633A CN108795931B CN 108795931 B CN108795931 B CN 108795931B CN 201810745633 A CN201810745633 A CN 201810745633A CN 108795931 B CN108795931 B CN 108795931B
- Authority
- CN
- China
- Prior art keywords
- sputum
- reagent
- microorganisms
- solution
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention provides a reagent for quickly purifying sputum microorganisms, which comprises liquefied liquid, cell lysate and exonuclease buffer solution; the cell lysis solution contains guanidine salt and a surfactant, and the concentration of the guanidine salt in the cell lysis solution is 1-3 mol/L. The invention also provides application of the rapid purifying reagent for the sputum microorganisms. The reagent for quickly purifying the sputum microorganisms, which is provided by the invention, adopts the combination of low-concentration guanidine hydrochloride, a surfactant and a reducing agent to completely crack human cells (nuclei), the cell disintegration causes the genomic DNA to be released into a solution, most of the genomic DNA is removed when the bacteria are obtained by centrifugation, the residual free DNA is further digested by DNase, and the bacteria are not influenced or slightly influenced due to the protection of cell walls.
Description
Technical Field
The invention belongs to the field of life science, and particularly relates to a microbial purification reagent and application thereof.
Background
The fluid in sputum is secreted mainly by mucous glands and goblet cells of the bronchial mucosal epithelium. Under normal conditions, the goblet cells and glands secrete a small amount of mucus to cover the surface of a mucous membrane layer, so that the mucous membrane can be protected, the tracheal mucosa can be kept moist, dust particles, bacteria and the like sucked into the trachea and the bronchus are adhered to prevent the dust particles and the bacteria from entering the deep part of the lung tissue, and then the dust particles, the bacteria and the like are discharged to the laryngeal part of the upper end of the trachea by means of cilium swing of cilium columnar epithelium and are discharged out through the oral cavity. Normal sputum is generally colorless and transparent, has a little viscosity and is slightly sticky, and a proper amount of sputum is helpful for moistening respiratory tracts and catching dust and microorganisms (mucus). Although any expectoration may be considered abnormal, a small amount of sputum may be expectorated or expectorated without any pathological changes in the respiratory system. However, in some cases, particularly in connection with respiratory inflammation, excessive amounts of sputum may be produced. In these pathological cases, the color, texture and even smell of sputum may change.
When the trachea, the bronchus and the lung are stimulated by harmful factors or infected by pathogenic bacteria to generate inflammation, the mucous membranes of the respiratory tract are congested and edematous, a large amount of inflammatory cells infiltrate, the blood vessels expand, the exudation is increased, goblet cells of the mucous membrane layer and glands in the submucosa are proliferated and enlarged, the mucus secretion is greatly increased, and the clearing of foreign matters is facilitated. The mucus is secreted too much, which increases the burden of ciliated columnar epithelium, is not beneficial to the discharge of mucus, and under the action of bacteria and toxins thereof, a plurality of denatured and necrotic tissue cells are generated and are retained in the bronchus, and the mucus and the denatured and necrotic tissue cells form phlegm which has two characteristics compared with normal phlegm: firstly, the viscosity is higher, secondly, the color can be changed from white or gray to yellow, green, rust or brown, and also blood filaments can be shown due to small amount of blood.
Phlegm can be simply classified into foamy (serous), mydric and purulent ones according to the increase in viscosity of the sputum. The viscosity of the sputum is divided into three degrees according to the properties of the sputum at the glass joint of the sputum suction tube and the adhesion condition of the sputum on the inner wall of the glass tube in the sputum suction process: 1 degree: the sputum is like rice water or foam, and no sputum is retained on the inner wall of the glass joint after sputum suction. 2 degree: the outward appearance of phlegm is more 1 degree thick, has a small amount of sputum to be detained at the glass joint inner wall after inhaling the phlegm, nevertheless is washed out 3 degrees by water easily: the sputum is obviously viscous and yellow in appearance, the sputum suction tube is usually collapsed due to overlarge negative pressure, and a large amount of sputum is usually retained on the inner wall of the glass joint and is not easy to be washed away by water.
The viscosity of sputum is mainly related to the content of acidic glycoprotein in the sputum, and glycoprotein molecules are cross-linked together by different bonds (such as disulfide bonds, hydrogen bonds and the like) to form a gel net. Ca in sputum2+High content of (1) canThe viscosity is increased, and long fibers observed under a microscope are composed of the mucopolysaccharide and the mucin. During respiratory tract infection, DNA generated by nuclear destruction of a large number of inflammatory cells is wrapped by histone and mucin, so that the viscosity of sputum is also obviously improved, and the sputum is often thick parallel fibers seen in purulent sputum.
At present, chemical methods and reagents for enriching sputum microorganisms and removing human cell genome DNA are few, the existing method for enriching the bacteria by cracking cells through a hypotonic method has uneven bacterium enrichment effect and low efficiency of most samples, and a large amount of high-molecular mucin in sputum is insoluble in water when the method is used for oral swab and saliva samples, so that the report that the method is used for enriching the sputum microorganisms is not available.
Disclosure of Invention
Aiming at the defects in the field, the invention aims to provide a reagent for quickly purifying the sputum microorganisms.
The second purpose of the invention is to provide the application of the reagent for rapidly purifying the sputum microorganisms.
The technical scheme for realizing the above purpose of the invention is as follows:
a reagent for quickly purifying the microbes in sputum is composed of liquefied liquid, cell (nucleus) lysate and exonuclease buffer; the cell lysis solution contains guanidine salt and a surfactant, and the concentration of the guanidine salt in the cell lysis solution is 1-3 mol/L.
The liquefied solution contains a reducing agent and a phosphate buffer solution with the pH value of 7.6-8.0, wherein the reducing agent is one of dithiothreitol, acetylcysteine and tris (2-carboxyethyl) phosphine hydrochloride, and the concentration of the reducing agent is 0.05-0.2 g/100 mL; each milliliter of exonuclease buffer solution contains 1-30 units of exonuclease, and the exonuclease is recombinant DNase I.
Further, the liquefied liquid also contains sodium chloride and potassium chloride, and the concentrations of the sodium chloride and the potassium chloride are 0.5-1.0 g/100mL and 0-0.05 g/100mL respectively.
Furthermore, the concentration of the guanidine salt in the cell lysate is 1-2 mol/L.
Preferably, the cell lysate contains guanidine hydrochloride with the concentration of 1-3 mol/L, and the surfactant is one of IGEPAL-CA630, Triton-X100 and NP 40.
Further preferably, the surfactant is IGEPAL-CA630, and the concentration by volume in the cell lysate is 0.01% to 1%.
More preferably, the cell lysate is 1.0-2.0 mol/L guanidine hydrochloride and 0.03% -0.08% of surfactant aqueous solution.
The volume parts of the liquefied solution, the cell (nuclear) lysate and the exonuclease buffer solution are 1 part, 1-3 parts and 0.1-0.5 part respectively.
The rapid purifying reagent for the sputum microorganisms disclosed by the invention is applied to sputum liquefaction, removal of cells in body fluid and bacterial enrichment.
The method for rapid purification of sputum microorganisms by using the rapid purification reagent comprises the following operations:
1) transferring the sputum with the volume 0.8-1.2 times of that of the liquefying agent into a container, and adding the liquefying liquid for liquefying for 5-20 minutes;
2) adding cell (nuclear) lysate, standing at room temperature for 5-30 min, observing that the solution is a clear water sample, centrifuging to collect bacteria, removing clear liquid, adding exonuclease buffer solution into the bacteria, and standing at 30-40 ℃ for 20-40 min.
Further extracting the bacterial genome DNA, wherein the extracting method is the existing technical means in the field.
Compared with the prior art, the invention has the following advantages:
the reagent for quickly purifying the sputum and sputum microorganisms provided by the invention adopts the combination of low-concentration guanidine hydrochloride, a surfactant and a reducing agent to completely crack human cells (nuclei), the cell disintegration causes the genomic DNA to be released into a solution, most of the genomic DNA is removed when the bacteria are obtained by centrifugation, the residual free DNA is further digested by DNase, and the bacteria are not influenced or slightly influenced due to the protection of cell walls.
The guanidine salt with lower concentration is determined by experimental comparison, and the rapid and complete disintegration of the cells is effectively completed by combining the surfactant and the reducing agent. The second-generation sequencing result (the sequencing flux of a sputum control group is 10G, and the sequencing flux of a bacterial group is 5G) shows that the rapid purification reagent of the sputum microorganism can improve the bacterial genome proportion in the sputum metagenome of a COPD patient by more than 20 times, compared with the control, no bacteria disappear, and simultaneously more than 50 bacteria are newly added (the ratio of the total reads proportion of single-bacteria DNA sequencing reads is more than 0.01%). In summary, the reagent for rapidly purifying the sputum microorganisms can rapidly and efficiently purify bacteria in the sputum.
The reagent has the advantages of simple and rapid operation, improved bacteria enrichment efficiency and better adaptability to different types of sputum.
Drawings
FIG. 1: RT-probe method relatively quantitatively detects 16s rDNA curve (representing bacteria), and sputum genome is diluted by 3 times.
FIG. 2: RT-dye method relatively quantitative determination human BTF curve (representing cells), 3 times of dilution of sputum genome.
Detailed Description
The invention will now be illustrated by the following examples, without limiting the scope of the invention.
The means used in the examples are, unless otherwise specified, those conventional in the art.
Example 1: optimization test of cell (nuclear) lysate components
Guanidine hydrochloride (6M) at high concentration is a strong denaturant of proteins, and cells were cultured by the action of guanidine hydrochloride (1M or less) at low concentration, and cell disintegration was observed.
Taking a full H460 epithelial cell culture bottle, pouring out the culture medium, adding four experimental groups of 1M guanidine hydrochloride and 0.5M guanidine hydrochloride, 1M guanidine hydrochloride + 0.03% IGEPAL-CA630 and 0.5M + 0.03% IGEPAL-CA630 guanidine hydrochloride into each bottle at room temperature respectively, and observing by timing, the cells in the single guanidine hydrochloride group are not disintegrated within 20min, and the cells in the group mixed with IGEPAL-CA630 are disintegrated quickly. This experiment shows that guanidine hydrochloride in combination with a surfactant can more effectively lyse cells.
On the basis of the test, in the subsequent test, the volume concentration of IGEPAL-CA630 in the cracking liquid is 0.06%, the final concentration is 0.03% when the volume is added with the same volume, the concentration of guanidine hydrochloride is 2M, and the final concentration is 1M when the volume is added with the same volume.
Example 2:
the reagent for quickly purifying the sputum and sputum microorganisms comprises a liquefying agent, cell lysate and exonuclease buffer solution.
The concrete components of each component are as follows:
liquefying agent: 0.1g DTT (molecular weight 154.25), 0.78g sodium chloride, 0.02g potassium dihydrogen phosphate, 0.112g sodium dihydrogen phosphate, 1M NaOH to adjust pH value to 7.6-8.0, adding double distilled water to 100mL, filtering and sterilizing;
cell lysis solution: preparing with double distilled water, wherein the solution contains 2M guanidine hydrochloride and 0.06% (volume fraction) IGEPAL-CA630, and filtering and sterilizing;
exonuclease and Buffer solution DNase I recombinant 2, 000units/mL (NEB Co.), exonuclease 2 × Buffer 20mM Tris-HCl, 5mM MgCl2，1mMCaCl2，pH 7.6；
Example 3: reagent for rapid purification of sputum microorganisms
The reagent of example 2 for rapid purification of sputum microorganisms was used.
1 volume of the sputum was transferred to a 50ml sterile centrifuge tube, and a liquefying agent was added thereto in an amount of 1 volume to the volume of the sputum, followed by shaking to liquefy the sputum for 10 minutes. An equal part was divided into two, one was used as a control (control group), an equal volume of cell lysate (equal volume to (sputum + liquefier)) was added to the other (experimental group), lysis was carried out for 5-15 minutes, the sputum was observed to be a clear water sample, bacteria were collected by centrifugation, the supernatant was removed, 200. mu.L of DNAase I enzyme buffer and enzyme (the liquid volume ratio was 1mL of sputum, 200. mu.L of DNAase I enzyme buffer, 10. mu.L of DNAase I enzyme was added per mL of enzyme buffer) were added to the collected bacteria, and the mixture was allowed to stand at 37 ℃ for 30 min. (DNAse I enzyme can be inactivated at 75 ℃ for 15 min).
Total genomic DNA of the experimental group and the control group was extracted using a Zhuang Union organism saliva genomic DNA rapid extraction kit (cat # ZP 321T-2). The control group genomic DNA was 3-fold diluted, and a 16s rDNA curve (representing the number of bacteria) was generated by the RT-probe method, and the results are shown in FIG. 1; human BTF curves (representing human cell numbers) were made using RT-dye method (SuperGreen), and the results are shown in FIG. 2; and simultaneously detecting the CT values of the 16s rDNA and the BTF of the experimental group, substituting the obtained CT values into a corresponding curve formula, calculating the dilution of the genomic DNA relative to the control group, and further calculating the purification multiple, wherein the results are listed in Table 1. 16S RT-PCR conditions Primer F1093 GYAACGAGCGCAACCC, Primer R1382 GACGGGCGGTGTGTACA, Probel FAM-SCRGGAACGYATTCACCG-BHQ1, 95 ℃ for 10min, 95 ℃ for 20S, 54 ℃ for 20S 7233S, 40 cycles; BTF RT-PCR conditions: primer F5 'ATGAGACGACCTTATGGGTAC 3', Primer R5 'TTGGACTCCTGGAACGTGAA 3', 95 ℃ 10min, 95 ℃ 20s 59 ℃ 20s 72 ℃ 33s, 40 cycles.
Table 1: RT (reverse transcription) detection of bacterial and cell genome DNA (deoxyribonucleic acid) proportion enrichment times
And further performing Hiseq-2000 double-end DNA sequencing on the genomic DNA of the experimental group and the genomic DNA of the control group, performing species identification on a sequencing sequence of the metagenome by using a k-mer-based method to obtain species and abundance information of bacteria, viruses, fungi and other species, and analyzing the proportion of microorganisms. The results showed an increase in the microbial content from 2.47% to 54.42% (tables 2 and 3).
Table 2: second generation sequencing for detecting bacteria enrichment effect
TABLE 3 analysis of bacterial composition in sputum samples
The second-generation DNA sequencing results (sputum control group sequencing flux 10G, and bacterial group 5G) of our experiments also show that the application of the reagent of the invention can improve the bacterial genome proportion in the sputum metagenome by more than 20 times, greatly reduce the sequencing cost, and compared with the direct extraction of whole genome control from sputum, the microorganism composition has no bacteria disappearance, and the two parties share bacteria without obvious difference, while the newly found low-abundance microorganisms are increased by more than 50 (the ratio of the reads of single-bacterium DNA sequencing to the reads is more than 0.01%), and the effect is obvious.
The invention enriches the microorganism by adopting a chemical treatment method, has higher microorganism enriching efficiency and better adaptability to sputum samples with different viscosities.
The above examples are only for describing the preferred embodiments of the present invention, and are not intended to limit the scope of the present invention, and various modifications and improvements made to the technical solution of the present invention by those skilled in the art without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Sequence listing
<110> Beijing institute of genomics of Chinese academy of sciences
<120> quick purification reagent for sputum microorganisms and application thereof
<130>KHP181113941.9
<141>2018-07-05
<160>4
<170>SIPOSequenceListing 1.0
<210>1
<211>16
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>1
gyaacgagcg caaccc 16
<210>2
<211>17
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>2
gacgggcggt gtgtaca 17
<210>3
<211>18
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>3
scrggaacgy attcaccg 18
<210>4
<211>21
<212>DNA
<213> Artificial sequence (artificial sequence)
<400>4
atgagacgac cttatgggta c 21
Claims (8)
1. A reagent for quickly purifying sputum microorganisms is characterized by consisting of liquefied liquid, cell lysate and exonuclease buffer solution; the cell lysis solution contains guanidine salt and a surfactant, wherein the concentration of the guanidine salt in the cell lysis solution is 1-2 mol/L;
the liquefied liquid contains a reducing agent and a phosphate buffer solution with the pH value of 7.6-8.0, wherein the reducing agent is one of dithiothreitol, acetylcysteine and tris (2-carboxyethyl) phosphine hydrochloride, and the concentration of the reducing agent is 0.05-0.2 g/100 mL; each milliliter of exonuclease buffer solution contains 1-30 units of exonuclease, and the exonuclease is recombinant DNaseI.
2. The reagent of claim 1, wherein the liquefaction solution further comprises sodium chloride and potassium chloride, and the concentrations of the sodium chloride and the potassium chloride are 0.5-1.0 g/100mL and 0-0.05 g/100mL, respectively.
3. The reagent for rapid purification of sputum microorganisms as claimed in claim 1 or 2, wherein the cell lysate contains guanidine hydrochloride with a concentration of 1-3 mol/L, and the surfactant is one of Triton-X100, NP40, IGEPAL-CA 630.
4. The reagent of claim 3, wherein the surfactant is IGEPAL-CA630, and the volume concentration of the surfactant in the cell lysate is 0.01-1%.
5. The reagent of claim 3, wherein the cell lysate is 1.0-2.0 mol/L guanidine hydrochloride and 0.03% -0.08% surfactant solution in water.
6. The reagent for rapidly purifying the sputum microorganisms as claimed in claim 1 or 2, wherein the volume parts of the liquefied solution, the cell lysate and the exonuclease buffer solution are 1 part, 1-3 parts and 0.1-0.5 part respectively.
7. The use of the reagent for rapid purification of sputum microorganisms as claimed in any one of claims 1 to 6 in sputum liquefaction, cell removal in body fluids and bacterial enrichment.
8. Method for the microbial rapid purification of sputum using the rapid purification reagent according to any one of claims 1 to 6, comprising the operations of:
1) transferring sputum with the volume 0.8-1.2 times that of the liquefied solution into a container, and adding the liquefied solution for liquefaction for 5-20 minutes;
2) adding cell lysate, standing at room temperature for 5-30 min, centrifuging to collect bacteria, removing clear liquid, adding exonuclease buffer solution into the bacteria, and standing at 30-40 ℃ for 20-40 min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810745633.3A CN108795931B (en) | 2018-07-09 | 2018-07-09 | Rapid purification reagent for sputum microorganisms and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810745633.3A CN108795931B (en) | 2018-07-09 | 2018-07-09 | Rapid purification reagent for sputum microorganisms and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108795931A CN108795931A (en) | 2018-11-13 |
| CN108795931B true CN108795931B (en) | 2020-08-28 |
Family
ID=64075893
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810745633.3A Active CN108795931B (en) | 2018-07-09 | 2018-07-09 | Rapid purification reagent for sputum microorganisms and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108795931B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109932359A (en) * | 2019-02-11 | 2019-06-25 | 张丽英 | A method of utilizing clostridium botulinum in ATP bioluminescence reaction detection food |
| CN111122879B (en) * | 2020-03-26 | 2020-07-14 | 珠海丽珠试剂股份有限公司 | Coating liquid of novel coronavirus recombinant antigen, pretreatment method, application and product |
| CN112813061A (en) * | 2021-02-24 | 2021-05-18 | 上海基灵生物科技有限公司 | Pretreatment reagent for nucleic acid extraction of cat body fluid sample and nucleic acid extraction method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106867998A (en) * | 2017-03-15 | 2017-06-20 | 郑州安图生物工程股份有限公司 | The kit of pathogen nucleic acid is extracted in the high throughput automated sample from sputum |
| CN107904232A (en) * | 2017-12-29 | 2018-04-13 | 浙江今复康生物科技有限公司 | A kind of method of the rapid extraction nucleic acid from sputum |
-
2018
- 2018-07-09 CN CN201810745633.3A patent/CN108795931B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106867998A (en) * | 2017-03-15 | 2017-06-20 | 郑州安图生物工程股份有限公司 | The kit of pathogen nucleic acid is extracted in the high throughput automated sample from sputum |
| CN107904232A (en) * | 2017-12-29 | 2018-04-13 | 浙江今复康生物科技有限公司 | A kind of method of the rapid extraction nucleic acid from sputum |
Non-Patent Citations (1)
| Title |
|---|
| 不同液化处理及核酸共提取方法对痰样本中病毒核酸的提取效果比较;何慧等;《国际流行病学传染病学杂志》;20160430;第43卷(第2期);第81-85页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108795931A (en) | 2018-11-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108795931B (en) | Rapid purification reagent for sputum microorganisms and application thereof | |
| WO2020118978A1 (en) | Method for constructing metagenomic sample library on basis of nanopore sequencing platform, identification method and kit | |
| CN108048450B (en) | Sputum microorganism metagenome de-hosting extraction and library building method | |
| US20230183673A1 (en) | Method for nucleic acid depletion | |
| CN109385418B (en) | Method and reagent for extracting virus/bacterium nucleic acid in animal sample | |
| CN105176969A (en) | Nucleic acid extraction method and nucleic acid extraction reagent for biological samples | |
| CN111088249A (en) | Use method of metagenome sample de-hosting extraction kit | |
| CN107904232B (en) | Method for rapidly extracting nucleic acid from sputum | |
| CN104560951A (en) | Extraction method of metagenome DNA and kit for extraction method | |
| CN111621496A (en) | Sputum metagenome de-hosting extraction kit | |
| CN111057705A (en) | Kit for extracting free nucleic acid and use method | |
| CN111041024A (en) | Nucleic acid extraction kit and method for extracting nucleic acid | |
| CN113322351A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) probe primer group and kit for rapidly and qualitatively typing and detecting four types of human parainfluenza viruses | |
| CN104911274A (en) | Method for detecting single-celled real-time fluorescence quantitative polymerase chain reaction | |
| Yu et al. | Comparison of metagenomic next-generation sequencing and blood culture for diagnosis of bloodstream infections | |
| CN103789300A (en) | Extraction method of metagenome DNA (deoxyribonucleic acid) in activated sludge for treating epoxypropane saponification wastewater | |
| CN114369646A (en) | Sputum liquefaction method and special liquefaction reagent thereof | |
| CN111454876A (en) | Method for infecting porcine small intestinal mucosal epithelial cell line by porcine epidemic diarrhea virus | |
| CN114134140B (en) | Sputum preservation lysate, kit and application thereof | |
| CN108414313A (en) | A kind of sputum liquefaction agent, the kit containing it and its application | |
| CN114561448B (en) | Virus nucleic acid sample treatment solution, reagent, extraction method and application thereof | |
| CN102925547B (en) | Kit and method used for detecting bordetella bronchiseptica with loop-mediated isothermal amplification method | |
| CN113736913B (en) | Method and kit for bidirectional symbiotic detection of 2019-nCoV based on virus nucleic acid and miRNA | |
| CN106319080A (en) | PCR detection kit for rapidly identifying mycoplasma hyopeumoniae, mycoplasma synoviae and mycoplasma hyorhinis, and applications of PCR detection kit | |
| CN113956979A (en) | Clinical sputum specimen liquefaction treatment method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |