CN108752436A - Helicobacter pylori immunodominant epitope peptide L79-96And its application - Google Patents

Helicobacter pylori immunodominant epitope peptide L79-96And its application Download PDF

Info

Publication number
CN108752436A
CN108752436A CN201810386324.1A CN201810386324A CN108752436A CN 108752436 A CN108752436 A CN 108752436A CN 201810386324 A CN201810386324 A CN 201810386324A CN 108752436 A CN108752436 A CN 108752436A
Authority
CN
China
Prior art keywords
cell
artificial sequence
hla
pylori
ala
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810386324.1A
Other languages
Chinese (zh)
Inventor
李妍
宁云山
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Southern Medical University
Original Assignee
Southern Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Southern Medical University filed Critical Southern Medical University
Priority to CN201810386324.1A priority Critical patent/CN108752436A/en
Publication of CN108752436A publication Critical patent/CN108752436A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/205—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Campylobacter (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/105—Delta proteobacteriales, e.g. Lawsonia; Epsilon proteobacteriales, e.g. campylobacter, helicobacter
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Mycology (AREA)
  • Genetics & Genomics (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to a kind of restricted CD4+T cell epitopes immunodominance peptides of HLA of helicobacter pylori Lpp20 and core peptides, form as shown in SEQ ID NO.10 and SEQ ID NO.30.Suitable CD4 according to the present invention+T cell epitope (SEQ ID NO.10 and SEQ ID NO.30) is reliable, accurate.It is immunodominance or subdominant that can also more importantly enable us to assess identified epitope, is more conducive to the design of epiposition vaccine.

Description

Helicobacter pylori immunodominant epitope peptide L79-96And its application
Technical field
The invention belongs to biotechnologies, specifically relate to the restricted CD4 of HLA of helicobacter pylori Lpp20+T cell Immunodominant epitope peptide L79-96And its application.
Background technology
Helicobacter pylori (H.pylori) infect 50% or more the world population, easily lead to chronic gastritis, peptic ulcer, Sdenocarcinoma of stomach and gastric mucosa associated lymphoid tissue lymthoma.More and more evidences show CD4+T cell responses are in anti-H.pylori Play the part of a crucial role in infection.There is research to confirm, H.pylori infection increases infiltration of the T cell in people's stomach and with allusion quotation The Th1 phenotypes of type exist, and acute H.pylori infection mainly causes rhesus macaque Th1 to react, and mouse vaccine induces or host is anti- The innate immunity of H.pylori relies on Th1 type cell effects.These are studies have shown that Th1 reactions take part in the anti-H.pylori of host The protective immunity of infection.
Immunodominance refers to the cellular immunity in individual that is immune or infecting and is often directed to very limited epitope.Generally For, immunodominant T cell not only generally existing, but also can provide better protective effect than subdominant cell.Therefore, it is immunized Advantage T cell is considered as being played in the antiviral adaptive immunity of host more effectively with crucial effect, this exists It is proved in many bacteriums, virus and tumour system.The scientist in many vaccine research fields thinks immunodominance CD4+T cell Epitope is most important in H.pylori vaccine developments.Currently, although the immunodominance of some H.pylori protective antigens CD4+T cell epitope has been accredited, but many H.pylori antigens immunodominance specific C D4+T cell responses and immune excellent Gesture CD4+T cell epitopes not yet illustrate.
Lpp20 is H.pylori outer membrane lipoproteins, it is considered to be a potential vaccine candidate antigen.We are previous to grind Study carefully the B cell epitope (L for identifying a Lpp2010-119), it can induce mouse and generate anti-Lpp20 serum, also identify two H- 2dRestricted CD4+T cell epitope (L58-72And L83-97), BALB/C mice secretion Th1 cytokines can be induced.More than in addition, The high-caliber Lpp20 antibody of specificity and Th1 cytokines can be caused by stating the epiposition vaccine of three kinds of epitopes structure, significantly The field planting that H.pylori attacks the H.pylori of malicious mouse is reduced, this shows that Lpp20 epiposition vaccines may be one promising anti- Control the vaccine of H.pylori infection.Since the MHC molecule of mouse and the mankind have differences, H-2dRestrictive CD4+T cell antigen Epitope cannot generate strong immune response in the mankind sometimes.Therefore, the restricted CD4 of the HLA of Lpp20 are identified+T cell epitopes It is extremely important to the design of mankind's H.pylori vaccines.
Invention content
Based on this, an object of the present invention is to provide a kind of restricted CD4 of helicobacter pylori HLA+T cell epitope Polypeptide.
Realize that the technical solution of above-mentioned purpose is as follows：
A kind of restricted CD4 of HLA of helicobacter pylori Lpp20+T cell epitope immunodominance peptide, composition such as SEQ Shown in ID NO.14.
A kind of restricted CD4 of HLA of helicobacter pylori Lpp20+T cell epitope immunocore peptide, composition such as SEQ Shown in ID NO.36.
It is a further object of the present invention to provide above-mentioned immunodominance peptides or immunocore peptide to prepare helicobacter pylori table Application in the vaccine of position.
It is a further object of the present invention to provide helicobacter pylori epiposition vaccines.
Realize that above-mentioned purpose technical solution is as follows：
Helicobacter pylori epiposition vaccine, active ingredient include or come from above-mentioned immunodominance peptide or immunocore Peptide.
Currently, although having identified the immunodominant epitope of some H.pylori protective antigens, it is related to be permitted The CD4 of more H.pylori antigens+T cell responses are also unclear.Our previous researchs identify the H-2 of two Lpp20dLimit CD4 processed+T cell epitopes, the epiposition vaccine built with this resist the sense of H.pylori in mouse prevention and treatment property inoculation Dye, this protection and Th1 type Lpp20 specific Cs D4+T cell responses are closely related.But mhc gene seat is in mammal The height polymorphism characteristic in the maximum encoding gene site of hereditary variation, MHC molecule causes the immune system of variety classes/object to be produced The immune response of raw not synantigen/epitope for same pathogenic/antigenic.This is why many candidate vaccines are in mouse reality It is successful in testing, but fail in clinical test.Therefore, this invention address that finding the HLA restricted epitopes of Lpp20, and It is not that H-2 is tested in clinical testdRestricted epitope.During this investigation it turned out, we utilize the PBMC of H.pylori the infected Identify the CD4 of Lpp20+T cell epitope.In order to which system effectively identifies immunodominant epitope, using short-term ex vivo T cell The method of amplification improves the ratio of Lpp20 specific T-cells.This identification method also needs to a large amount of over lapping synt hetic peptides, compares It is costly and time consuming, but finally we find suitable CD4+T cell epitope (SEQ ID NO.14 and SEQ ID NO.36), can It leans on, accurately.It is immunodominance or subdominant that can also more importantly enable us to assess identified epitope.
The present invention not only contributes to further understand the protective immunity mechanism of anti-H.pylori infection, is more conducive to epitope The design of vaccine.However, H.pylori has lots of genes group, many protective antigens are encoded.Therefore, it is necessary to more fully understand CD4+Immunodominance of the T cell effects in the characteristic and identification other HLA allele limitation of other H.pylori coding for antigens CD4+T cell epitopes.
Description of the drawings
Fig. 1 Lpp20 specific Cs D4+Reaction of the T cell in H.pylori the infected.Subject PBMC is detached, is first used 0.2 μm of ol/L rLpp20 stimulation, is stimulated after 13 days with Lpp20 over lapping synt hetic peptides library (5 μm of ol/L), ICS methods detection secretion IFN- The CD4 of γ+The ratio of T cells, DMSO are stimulated as a contrast.(A) the H.pylori persons of being uninfected by N1；(B) H.pylori the infected H1.(C) 30 H.pylori persons of being uninfected by (-) and 30 H.pylori the infected (+) PBMC are detached, approach described above is used Detect the CD4 of secretion of gamma-IFN+The ratio of T cell.
The immunodominance CD4 of Fig. 2 Lpp20+The screening and identification of t cell epitope.H.pylori the infected PBMC is detached, First with 0.2 μm of ol/L rLpp20 stimulation, stimulated respectively with 27 18mer overlapping peptides (5 μm of ol/L) again after 13 days, the inspection of ICS methods Survey the CD4 of secretion of gamma-IFN+The ratio of T cell, A-F respectively represent H.pylori the infected H1, H6, H11, H16, H21 and H26。
Fig. 3 immunodominant epitopes L55-72And L79-96Core sequence screening and identification.Detach H.pylor sense persons H1 and The PBMC of H6 is stimulated after 13 days with 5 μm of ol/L 13mer overlapping peptides, the detection of ICS methods first with 0.2 μm of ol/L rLpp20 stimulation The CD4 of secretion of gamma-IFN+The ratio of T cell.(A) overlapping 13mer peptides are moved to L using step55-72Core sequence screened. (B) overlapping 13mer peptides are moved to L using step79-96Core sequence screened.(C) L is titrated55-72, L57-69And L59-71(5× 10-9Mol/L~5 × 10-5Mol/L) and more active.(D) L is titrated79-96, L83-95And L85-97(5×10-9Mol/L~5 × 10-5Mol/L) and more active.
Fig. 4 immunodominant epitopes L55-72And L79-96The restrictive identifications of HLA.Detach H.pylori the infected H6 and H1 PBMC, amplification in vitro establish the specificity T cell line/lineage of Lpp20, and anti-HLA-DR, the processing of HLA-DP or HLA-DQ antibody is added 30min uses L57-69Or L83-95Stimulation, ICS methods detect the CD4 of secretion of gamma-IFN+The ratio of T cell.(A)L55-72HLA limit Property analysis processed.(B)L83-95HLA restriction analysis.(C) one group of BLCLs for containing different HLA partings, is used as APC, submission 13mer peptides.(D)L55-72HLA-DR Subtypes.(E)L83-95HLA-DR Subtypes.Fig. 5 L57-69And L83-95It is self DC is processed naturally and submission.(A)L57-69, rLpp20, HP-WCL or BSA stimulation DC for 24 hours, be added Monensin, then with infection The L of person H657-69Specific T-cells co-incubation 5h measures the CD4 of secretion of gamma-IFN with ICS+The ratio of T cell.(B) with same The method of sample measures the L of the infected H183-95The reaction of specific T-cells.Fig. 6 mouse immunes L57-69And L83-95Specific C D4+T cell responses.(A) mouse immune L57-69And L83-95, monocyte is detached, then use L respectively57-69、L83-95, rLpp20 pierces in vitro Swash, carry out lymphocyte proliferation assays, PBS is immunized in control group mice, and each experiment is repeated 3 times, and all data all use average ± standard deviation indicates.Think, with statistical significance, to be indicated with * as SI >=2.(B) flow cytometry CD3+CD4+T is thin Born of the same parents' relative percentage.Mouse immune L57-69And L83-95, detach monocyte and dyed, PBS is immunized in control group.Each experiment It is repeated 3 times, all data are all indicated with average ± standard deviation, work as p<0.05 expression experimental group has statistics relative to control group Meaning is indicated with *.
Fig. 7 immunodominant epitope peptides stimulate CD4+T cell secrete cytokines.(A) separating immune epitope peptide mouse CD4+T Cell, with epitope peptide L57-69And L83-95It is incubated 72h, collects supernatant, ELISA detects IFN mono- γ and IL 1, and control group is not added with Peptide.Each experiment is repeated 3 times, and is as a result indicated with average ± standard deviation.When experimental group has conspicuousness poor compared with the control group Different (p<0.05) it, is marked with *.(B) separating immune epitope peptide mouse CD4+T cell, fluorescence quantitative PCR detection CD4+T cell IFN The mRNA of one γ and IL 1 are expressed, and it is immune PBS that β-actin, which are used as internal reference, control group,.Each experiment is repeated 3 times, and is as a result used Average ± standard deviation indicates.When experimental group has significant difference (p compared with the control group<0.05) it, is marked with *.
Specific implementation mode
Below in conjunction with specific embodiment to the recombinant antigen and synthetic peptide of the present invention, it is described in further detail.
Unless otherwise defined, all technical and scientific terms used in the present invention and the technical field for belonging to the present invention The normally understood meaning of technical staff it is identical.The term used in the description of the present invention is intended merely to describe specific reality The purpose for applying example is not used in the limitation present invention.Term "and/or" used in the present invention includes one or more relevant listed Any and all combinations of project.
It to facilitate the understanding of the present invention, below will be to invention is more fully described.But the present invention can be to be permitted Mostly different form is realized, however it is not limited to embodiment described herein.Make on the contrary, purpose of providing these embodiments is It is more thorough and comprehensive to the understanding of the disclosure.
Reagent used in following embodiment or raw material derive from commercially available unless otherwise specified.
Embodiment 1
1 method and material
1.1 patients and blood sample
The collection of sample is ratified according to mankind's Institutional Review Board of attached Nanfang Hospital of Guangzhou Nanfang Medical Univ Scheme carries out, and all participants give Written informed consent.30 gastric disease patients are made a definite diagnosis by endoscope and pathological diagnosis H.pylori infection states.Blood sample is collected, using Ficoll-Hypaque (TBDscience, Tianjin, China) density gradient Method separating periphery blood monocytic cell (PBMCs), is then stored in liquid nitrogen.With PCR-SBT identification H.pylori patients PBMC's HLA partings are identified by Hua Da gene studies institute (China Shenzhen).
1.2 recombinant antigens and synthetic peptide
Expression and purifying reference article of the recombination Lpp20 (rLpp20) of NCTC11639 plants of H.pylori in E.coli [Li Y, Ning YS, Wang YD, Hong YH, Luo J, Dong WQ and Li M.Production of mouse monoclonal antibodies against Helicobacter pylori Lpp20and mapping the antigenic epitope by phage display library.J Immunol Methods.2007；325(1-2):1- 8], it is stored in -70 DEG C.The amino acid sequence of Lpp20 albumen is from NCBI albumen databases (No.AAZ13599, by us submit) It obtains.The 18mer synthetic peptides of Lpp20 albumen are covered, 12 amino acid (table 1) and 13mer synthetic peptides are overlapped, are overlapped 11 ammonia Base acid (table 2 and table 3) synthesizes and purifies (purity by Shanghai GL Biochem companies>95%).Synthetic peptide is all dissolved in dimethyl Sulfoxide (dimethyl sulfoxide, Sigma, Chinese Shanghai), is stored in -80 DEG C.
Table 1 covers the 18mer synthetic peptides of Lpp20 albumen
Table 2 covers L55-7213mer synthetic peptides
location Sequence SEQ ID NO
L53-65 FLVAKYEKYSGVF 28
L55-67 VAKYEKYSGVFLG 29
L57-69 KYEKYSGVFLGRA 30
L59-71 EKYSGVFLGRAED 31
L61-73 YSGVFLGRAEDLI 32
Table 3 covers L79-9613mer synthetic peptides
location Sequence SEQ ID NO
L77-89 DVDYSTNQATAKA 33
L79-91 DYSTNQATAKARA 34
L81-93 STNQATAKARANL 35
L83-95 NQATAKARANLAA 36
L85-97 ATAKARANLAANL 37
1.3 amplification in vitro H.pylori the infected's Lpp20 specific Cs D4+T cell system
With (1-2 × 10 0.2 μm of ol/L Lpp20 (or immunodominance peptide of 5 μm of ol/L) stimulation PBMC6), in 48 hole cells On culture plate with RPMI 1640 (Gibco) cultivate, contain 5% human AB serum, 2mmol/L L- glutamine, 5 × 10-5mol/L 2 mercapto ethanol (2-mercaptoethanol, 2-ME) and antibiotic (penicillin 100U/mL, 100 μ g/mL of streptomysin) exist.The Five days, 50% culture medium is changed with the above-mentioned culture solution of RhIL-2 containing 10U/mL (IL-2), when culture medium turns yellow When changed with IL-2 containing 25U/mL 50% culture medium.The cell of culture divides on the 10th day, collects cell within the 13rd day.
1.4 screening system Lpp20CD4+T cell epitope
PBMC is detached from the 200mL blood that H.pylori the infected donates, is stimulated with 0.2 μm of ol/L rLpp20, the 13rd After it, Lpp20 specific T-cells are screened.Then screening 13mer synthetic peptides, to determine immunodominance CD4+The core of t cell epitope Heart sequence.
Bone-marrow-derived lymphocyte system (the Epstein-Barr virus transformed B of 1.5EB virus Transformations Lymphoblastoid cell lines, BLCLs) preparation and culture
Using the B95-8 cells and supernatants of production Epstein-Barr virus, BLCLs is established in self PBMC, with containing 10% fetal calf serum (GIBCO), 2mmol/L L- glutamine, 5 × 10-5Mol/L 2 mercapto ethanols and antibiotic (penicillin 100U/mL, streptomysin 100 μ g/mL) RPMI-1640 (GIBCO) cultivated.
1.6 intracellular cytokine dyeings (Intracellular cytokine staining, ICS)
In the screening experiment of 18mer and 13mer peptides, the Lpp20 specific T-cells of mass propgation and 5 μm of ol/L peptides exist It is incubated 5h in culture medium containing coban (monensin, Chinese Shanghai Becton Dickinson company).Measuring HLA In restrictive experiment, BLCLs 1h first are stimulated with 5 μm of ol/L peptides, coban, BLCLs and Lpp20 specificity Ts is then added Cell presses 1:10 ratio co-cultures 5h.Cell is collected, first in 50 μ l dye solutions (PBS contains 1% heat-inactivated FCS) Middle progress AntiCD3 McAb-PE and anti-CD4-APC (Biolegend, Beijing) dye 30min, 4 DEG C, with fixation/penetrate liquid (BD Cat, No.554715 it) cleans and fixed 20min, 4 DEG C, then cleans, is fixed and with anti-IFN-γ-FITC (Biolegend, Beijing) Dyeing.II stream type cell analyzers of FACSCanto (Becton Dickinson) obtain 1 × 105Cell, with FlowJo softwares (Tree Star, Ashland, OR) analyzes data.In antibody blocking experiments, before peptide and coban is added, antigen is first used Presenting cells (APC) are incubated with 5 μ g/mL HLA-DP (Abcam), HLA-DR (Biolegend) and HLA-DQ (Biolegend) 30min, subsequent t cell activation are measured with ICS.
1.7 prepare the complete cell lysates of H.pylori (H pylori Whole Cell Lysates, HP-WCL)
H.pylori is coated on brain heart infusion (brain-heart infusion, BHI) plate for NCTC11637 plants, is contained 7% blood of goats, polymyxin B (5 μ g/mL), methoxybenzyl aminopyrimidine (5 μ g/mL) and vancomycin (10 μ g/mL), then containing It is cultivated in 5% fetal calf serum brucella broth, 37 DEG C of jogs, micro- oxygen (10%CO2, 5%O2、N210%).After culture 1 day, collects and live Bacterium, washing and lytic cell, centrifuge pyrolysis product 20min, remove complete cell and big fragment by 4 DEG C, 10000g, ultrasound Supernatant is the complete cell lysates of H.pylori (HP-WCL).With BCA protein assay kits (Beyotime, on Sea, China) measure protein content, packing, -20 DEG C of storages.
The preparation of 1.8 Dendritic Cells (Dendritic Cells, DC) and total with immunodominant epitope specific T-cells Culture
Defrosting PBMC, uses CD14+Micro- magnetic bead (Miltenyi Biotec, Shanghai, China) detaches CD14 from PBMC+Carefully Born of the same parents, containing 5% people's AB serum, 10ng/mL IL-4 (interleukin-4, IL-4) and 20ng/mL-giant cell colony thorn Swash and is trained in the factor (granulocyte-macrophage colony-stimulating factor, GM-CSF) RPMI 1640 It supports, 5%CO2, 37 DEG C.After 6d, DC is collected, respectively with the immunodominant epitope (L of 50 μ g/mL57-69Or L83-95)、rLpp20、 HP-WCL and BSA stimulations are for 24 hours.It is washed out cell, coban is added, DC presses 1 with epitope specific T-cells:10 ratio Co-culture 5h.
BALB/c mouse is immunized in 1.9rLpp20 and immunodominant epitope peptide
The SPF grades female BAl BIc/c mouse for selecting 6~8 week old, add complete Freund's adjuvant (complete with rLpp20 for the first time Freund ' s adjuvant, CFA) subcutaneous multi-point injection is immune, every 100 μ g/0.5ml of mouse, with same dose of after 3 weeks RLpp20 adds incomplete Freund's adjuvant (incomplete Freund ' s adjuvant, IFA) booster immunization primary.Control group Mouse PBS substitutes rLpp20 and is immunized, and immune programme is identical, every group of 5 mouse.Use L57-69And L83-95It is small to BALB/c respectively Mouse is immunized, immune with the subcutaneous multi-point injections of IFA for the first time, and every 100 μ g/0.5ml of mouse is spaced 14 days booster immunizations one It is secondary, it is immunized altogether three times, every group of 5 mouse.Control group mice substitutes epitope polypeptide with PBS, and immune programme is identical, every group 5 small Mouse.
1.10 lymphocyte proliferation assay
It dislocates and puts to death after mouse final immunization 14 days, sterile taking-up spleen mills on steel mesh and prepares single cell suspension, uses Mouse lymphocyte separating liquid detaches mononuclearcell, and it is 5 × 10 that RPMI-1640 complete mediums, which adjust cell number,6/ mL is in 96 100 μ L cells are added per hole, while the epitope polypeptide L diluted is added for well culture plate57-69、L83-95(1.25 μ g/mL) and RLpp20 (15 μ g/mL), negative control hole are not added with any antigen, and final volume is 200 holes μ L/, and every group is done 3 parallel holes, 37 DEG C, 5%CO2Incubator culture 5 days, 12h is added before terminating to cultivate3The hole H-TdR, 37kBq/ continues to be collected in cell after cultivating 12h In glass fiber filter paper, umber of pulse (cpm) per minute is measured with liquid scintillation counter after drying, calculates the mean value of 3 multiple holes, as a result Indicate that (SI=experimental groups cpm mean values/negative control group cpm mean values, negative control, which refers to, is not added with antigenic stimulus with stimulus index (SI) Hole), SI >=2 be the positive.
1.11 flow cytometry
It dislocates and puts to death after mouse final immunization 14 days, sterile taking-up spleen prepares single cell suspension, thin with mouse lymph Born of the same parents' separating liquid detaches mononuclearcell, uses L57-69And L83-9572h is stimulated respectively, collects 1 × 106A cell, with anti-mouse CD16/ CD32 (clone 93, eBiosciensce) is incubated 10 minutes, excludes the receptor-mediated combinations of non-specific Fc.With cold PBS (2% bovine serum albumin(BSA)) washs cell, then (is cloned with PE-CD4 (clone RM4-5, eBiosciensce) and FITC-CD3 145-2C11) double dye 30min, collection sample are analyzed on flow cytometer on ice.
1.12ELISA and fluorescence quantitative PCR detection cell factor
It dislocates and puts to death after mouse final immunization 14 days, sterile taking-up spleen prepares single cell suspension, thin with mouse lymph Born of the same parents' separating liquid detaches mononuclearcell, then detaches CD4 with paramagnetic particle method+T cell is suspended in 24 well culture plates, and CD4 is added per hole+T Cell 5 × 105, mitomycin (mitomycin)-C (500 μ g/ml) processing spleens mononuclearcell 5 × 105(as APC), simultaneously The immunodominant epitope peptide (1.25 μ g/mgl of final concentration) diluted is added, negative control hole is not added with peptide, final volume 0.5ml/ Hole, every group is done 3 parallel holes.Collect 400 μ l of supernatant after stimulating 72h, with mono- γ of ELISA kit detection cell factor IFN and IL-4.In addition, extracting CD4 with Tripure reagents+T cell total serum IgE.Using SYBR Green methods, with quantitative fluorescent PCR (Q- PCR mono- γ and IL-4mRNA expressions of IFN) are detected, primer is as follows, and β-actin are used as internal reference.
Mono- γ of IFN:Sense primer:5 ' the one SEQ ID of AACTCAAGTGGCATAGATGTGG -3 ' NO.38
Downstream primer:5 ' one GACCTCAAACTTGGCAATACTC, mono- 3 ' SEQ ID NO.39
IL-4:Sense primer:5 ' one TGTCATCCTGCTCTTCTTTCTC, mono- 3 ' SEQ ID NO.40
Downstream primer:5 ' one TGATGCTCTTTAGGCTTTCCAG, mono- 3 ' SEQ ID NO.41
β-actin:Sense primer:5 ' one ATCCGTAAAGACCTCTATGCCAACA, mono- 3 ' SEQ ID NO.42
Downstream primer:5 ' one GTCGCCTTCACCGTTCCAGTTT, mono- 3 ' SEQ ID NO.43
1.13 statistical analysis
With the difference between two groups of Student ' s t check analyses of pairing, but when heterogeneity of variance, with non-matching Welch ' S t are examined.Work as p<0.05, difference is considered to have statistical significance.
2 results
2.1Lpp20 specific Cs D4+Frequency of the T cell in H.pylori the infected is higher than the H.pylori persons of being uninfected by
In order to assess Lpp20 specific Cs D4+Reaction of the T cell in H.pylori the infected, from H.pylori the infected PBMC is detached in blood, after the 18mer peptides stimulation of covering Lpp20 overall lengths, ICS detects Lpp20 specific Cs D4+The frequency of T. However, Lpp20 specific Cs D4+The frequency of T cell is too low, is difficult to detect (Figure 1A) in vitro.Cell expansion culture is typically low frequency Necessary to rate reaction, especially in terms of identifying epitope.Therefore, first expand culture Lpp20 spies with rLpp20 stimulations PBMCs Anisotropic CD4+T cell, Lpp20 specific Cs D4 after stimulated in vitro 13 days+The frequency of T cell is significantly raised (Figure 1B).In order into one Step confirms H.pylori the infected, and there are Lpp20 specific Cs D4+T cell responses and the H.pylori persons of being uninfected by do not have, detection 30 Lpp20 specific Cs D4 in a H.pylori the infected and 30 non-H.pylori the infected PBMC+As a result t cell responses are shown Lpp20 specific Cs D4+The frequency of T cell is apparently higher than H.pylori in H.pylori infected groups and is uninfected by group (Fig. 1 C).This The result shows that, the cell that rLpp20 was stimulated in vitro can identify the CD4 that antigen Zeng Zhimin is crossed a bit+T cell.
2.2Lpp20 specific Cs D4+T cell mainly identifies L55-72And L79-96Two epitopes
In order to systematically inquire into Lpp20 specific Cs D4+The specificity of t cell responses and comprehensive, separation H.pylori senses Dye person PBMC, is first stimulated with rLpp20, is stimulated respectively with 27 18mer overlapping peptides again after 13 days and is carried out screening immunodominance table Position, as a result shows Lpp20 specific Cs D4+T cell mainly identifies L55-72And L79-96Two epitopes (Fig. 2).Patient H6, H11 and The Lpp20 specific Cs D4 of H26+T cell mainly identifies L55-72(Fig. 2 B, 2C and 2F), and the Lpp20 of patient H1, H16 and H21 Specific C D4+T cell mainly identifies L79-96(Fig.2A, 2D and 2E).In conclusion L55-72And L79-96It is excellent to be that Lpp20 is immunized Gesture CD4+T cell epitope.
2.3L57-69And L83-95It is immunodominant epitope L respectively55-72And L79-96Core sequence
In order to further determine the immunodominance CD4 of Lpp20+T cell epitope L55-72And L79-96Core sequence, by as above The specific T-cells of described the two epitopes of method amplification cultivation, with the 13mer overlapping peptides of one group of covering 18mer peptide and each Kind N-terminal and C-terminal extension or 13mer peptides (table 2 and table 3) further screening and the titration blocked.For patient H6, L55-72Specificity CD4+T cell identifies two 13mer peptides (L57-69And L59-71)。L57-69Stimulate the reaction ratio L of T cell59-71It is more stronger, show This 13mer peptide is core sequence (Fig. 3 A), further to L55-72, L57-69And L59-71(5×10-9Mol/L~5 × 10- 5Mol/L it) carries out titration and also demonstrates this conclusion (Fig. 3 B).For patient H1, L79-96Specific C D4+T cell identifies two 13mer peptides (L83-95And L85-97)。L83-95Stimulate the reaction ratio L of T cell79-96It is more stronger, show that this 13mer peptide is core Sequence (Fig. 3 C), further to L79-96、L83-95And L85-97(5×10-9Mol/L~5 × 10-5Mol/L titration) is carried out to also confirm that This conclusion.In conclusion immunodominance CD4 most effective and minimum Lpp20+T cell epitope is L57-69And L83-95。
2.4L57-69And L83-95Reactive CD4+The restricted of T cell is HLA-DRB1 respectively*1501 and HLA-DRB1* 1602
In order to determine L57-69And L83-95The HLA of molecule is restricted, is identified with MHC-II class antibody blocking experiments.Point PBMC from H.pylori the infected H6, amplification in vitro establish the specificity T cell line/lineage of Lpp20, and anti-HLA-DR, HLA- is added The processing of DP or HLA-DQ antibody, uses L57-69Stimulation, ICS methods detect the CD4 of secretion of gamma-IFN+The ratio of T cell.Such as Fig. 4 A institutes Show, anti-HLA-DR antibody inhibits L57-69Specific C D4+T cell secretion of gamma-IFN, and anti-HLA-DP and HLA-DQ antibody does not have This effect.L is determined again with same method83-95HLA it is restricted, the PBMC of separation H.pylori the infected H1 is external to expand Increase the specificity T cell line/lineage for establishing Lpp20, anti-HLA-DR is added, L is used in the processing of HLA-DP or HLA-DQ antibody83-95Stimulation, into Row ICS experiments.Anti- HLA-DR antibody inhibits L83-95Specific C D4+T cell secretion of gamma-IFN, and anti-HLA-DP and HLA-DQ is anti- Body does not have this effect (Fig. 4 B).Therefore, epitope L57-69And L83-95All it is that HLA-DR is restricted.
For further clear L57-69HLA-DR hypotypes, using the BLCLs (Fig. 4 C) of one group of difference DR hypotype as APC, With 5 μm of ol/L L57-69Stimulation, ICS methods detect L57-69The reaction of specific T-cells.As shown in Figure 4 D, H.pylori the infected Self BLCLs (the expression of HLA-DR B1 of H6*1501) 0803 effectively activates L57-69Specific T-cells, the infected H11 and H26 BLCLs expression of HLA-DR B1*1501, it can stimulate L57-69Specific T-cells, although and the BLCLs of the infected H22 and H27 All expression of HLA-DR B1*0803, but fail submission L57-69.Therefore, L57-69It is restricted be HLA-DRB1*1501.Again with same Method identify L83-95HLA-DR it is restricted, using the BLCLs (Fig. 4 C) of one group of difference DR parting as APC, with 5 μm of ol/ L L83-95Stimulation, ICS methods detect L83-95The reaction of specific T-cells secretion of gamma-IFN.H.pylori the infected H1's is self BLCLs (expression of HLA-DR B1*1602) 0901 effectively activates L83-95Specific T-cells, the BLCLs tables of the infected H16 and H21 Up to HLA-DRB1*1602, it can stimulate L83-95Specificity T cell, although and the BLCL of the infected H17 and H22 express HLA- DRB1*0901, but fail submission L83-95.Therefore, L83-95It is restricted be HLA-DRB1*1602 (figure .4E).
2.5L57-69And L83-95It can naturally be processed and offered by antigen presenting cell (APC)
In order to assess L57-69And L83-95Whether can rLpp20 or HP-WCL be loaded to epitope by APC by APC submissions Natural submission characteristic is identified.First use rLpp20, HP-WCL, BSA or immunodominant epitope peptide stimulation Dendritic Cells (DC) For 24 hours, Monensin and epitope specific T-cells culture 5h is then added, using ICS and flow cytomery epitope specificity CD4+The ability of T cell secretion of gamma-IFN, the ability of assessment corresponding epitope specific T-cells identification APC.As shown in Figure 5A, quilt L57-69, rLpp20, HP-WCL stimulation the DC of H.pylori patient H6 can submission L57-69, excite L57-69Specific C D4+T cell Reaction.However, the DC stimulated by BSA or DMSO stimulates L57-69Specific C D4+T cells are only background level.With same side Method, we also confirm that L79-96It can naturally be processed by self DC and submission (Fig. 5 B).
Mouse is immunized in 2.6 immunodominant epitope peptides, stimulates CD4+T cell is proliferated
In order to detect the CD4 whether immunodominant epitope can induce body to generate specificity+T cell immune response, and And whether the immune response caused is directed to rLpp20.Use L57-69And L83-95BALB/c mouse is immunized respectively, separation is single Nucleus is used3H-TdR methods detect T lymphocyte proliferation assays.As shown in Figure 6A, from L57-69And L83-95Immune BALB/c The monocyte detached in mouse is respectively through L57-69And L83-95It can cause breeder reaction after being stimulated with rLpp20, and control mice Any stimulation is not reacted, shows L57-69And L83-95The lymphocyte reaction identification native antigen rLpp20 of induction.In addition, L is found with flow cytometry57-69And L83-95CD4 after immune mouse respectively+CD3+Ratio is higher than control group (p<0.05, figure 6B)。
2.8 immunodominant epitope peptides stimulate CD4+T cell is to Th1 cell differentiations
In order to which the epitope that Analysis and Screening goes out induces CD4+The CD4 of mouse is immunized in the differentiation direction of T cell, separation epitope peptide+T Cell is co-cultured with epitope peptide, collects supernatant, and ELISA detects IFN mono- γ and IL 1.From Fig. 7 A interpretations of result, L57-69With L83-95Epitope peptide mainly causes the secretion of INF- γ.In addition, detecting CD4 with fluorescence quantifying PCR method+Mono- γ of T cell IFN and The mRNA expressions of IL-4, as shown in Figure 7 B, the mRNA expressions of mono- γ of IFN are higher than IL-4.The above result shows that immune Dominant Epitopes peptide stimulates CD4+T cell is to Th1 cell differentiations.
In the present invention, Lpp20 specific Cs D4+Ratio of the T cell in H.pylori infected groups (is schemed higher than group is uninfected by 1C).In fact, finding low-level Lpp20 specific Cs D4 in some the H.pylori person's of being uninfected by samples+T cell responses (Fig. 1 C).It is considered that this may be diagnosed as the result of false negative due to of short duration or slight H.pylori the infected.So Afterwards, we systematically have evaluated H.pylori senses by the Lpp20 specific T-cells and 18mer overlapping peptides of amplification in vitro culture Dye person's Lpp20 specific Cs D4+T cell responses degree and power, reaction are concentrated mainly on two 18mer peptides (L55-72And L79-96) (Fig. 2). L55-72Patient H6, H11, H26 is induced to generate more t cell responses, L79- 96 induction patient H1, H16H21 generations More t cell responses (Fig. 2).L is identified followed in turn by 13mer overlapping peptides55- 72 and L79- 96 core sequence is respectively L57-69And L83-95(Fig. 3).
Because MHC molecule has high polymorphism in mammals, the usual submission of MHC allele of same species is not Same peptide, needless to say the MHC allele of different plant species.For example, in the H.pylori UreB CD4 reported+T epitopes In, neither one can be simultaneously by the CD4 of mouse and people+T cell responses identify.Therefore, identify that different HLA are restrictive immune excellent Gesture t cell epitope is most important for rationally designing H.pylori T cell vaccines.However, only minority HLA is restricted at present UreB and HpaA antigen CD4s+T cell epitope is identified, has between the individual of different HLA allele different immune excellent Gesture epitope].Gene frequency network data base (http://www.allelefrequencies.net/default.asp) Show HLA-DRB1*1501 frequency Chinese han population mouth it is relatively high (>10%), HLA-DRB1*1404 and HLA- The frequency of DRB1*0803 Chinese han population mouth it is relatively low (<1%).However, HLA-DRB1*0803 in some other crowd It is relatively common, as aborigines (>20%), Papua New Guinea and Taiwan native (>10%).Chen etc. Prove HpaA88-100Specific C D4+T cell responses are immunodominance reaction in the individual of expression of HLA-DR B1*1501, and with It is closely related to reduce serious gastric disease.It is interesting that HLA-DRB1*0901 specific Cs D4+T cell responses are in HLA-DRB1* Most immunodominance in 1501 negative groups.In the present invention, L57-69And L83-95HLA-DR genotype patients can mainly be caused CD4+T cell responses further measure the parting of HLA-DR with antibody blocking experiments.With different HLA allele BLCLs is as APC submission epitope peptides, with CD4+T cell responses, it has been found that L57-69And L83-95It is restricted be HLA- respectively DRB1*1501 and HLA-DRB1*1602, it can not only identify the self DC of load epitope peptide, moreover it is possible to identification load rLpp20 and HP- The DC of WCL, shows L57-69And L83-95It can naturally be processed by APC and submission.Therefore, HLA-DRB1*1501 restrictive L57-69 And HLA-DRB1*1602 restrictive L83-95The development of H.pylori vaccines may be had potential application.We Mouse is immunized in immunodominant epitope peptide respectively, discovery can cause CD4+The proliferation and secretion of gamma-IFN of T cell, illustrate epitope peptide With good immunogenicity and promote CD4+T cell is to Th1 cell differentiations.
Each technical characteristic of embodiment described above can be combined arbitrarily, to keep description succinct, not to above-mentioned reality It applies all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited In contradiction, it is all considered to be the range of this specification record.
Several embodiments of the invention above described embodiment only expresses, the description thereof is more specific and detailed, but simultaneously It cannot therefore be construed as limiting the scope of the patent.It should be pointed out that coming for those of ordinary skill in the art It says, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the protection of the present invention Range.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.
Sequence table
<110>Nanfang Medical Univ
<120>Helicobacter pylori immunodominant epitope peptide L<sub>79-96</sub>And its application
<160> 43
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 1
Met Lys Asn Gln Val Lys Lys Ile Leu Gly Met Ser Val Ile Ala Ala
1 5 10 15
Met Val
<210> 2
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 2
Lys Ile Leu Gly Met Ser Val Ile Ala Ala Met Val Ile Val Gly Cys
1 5 10 15
Ser His
<210> 3
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 3
Val Ile Ala Ala Met Val Ile Val Gly Cys Ser His Ala Pro Lys Ser
1 5 10 15
Gly Ile
<210> 4
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 4
Ile Val Gly Cys Ser His Ala Pro Lys Ser Gly Ile Ser Lys Ser Asn
1 5 10 15
Lys Ala
<210> 5
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 5
Ala Pro Lys Ser Gly Ile Ser Lys Ser Asn Lys Ala Tyr Lys Glu Ala
1 5 10 15
Thr Lys
<210> 6
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 6
Ser Lys Ser Asn Lys Ala Tyr Lys Glu Ala Thr Lys Gly Ala Pro Asp
1 5 10 15
Trp Val
<210> 7
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 7
Tyr Lys Glu Ala Thr Lys Gly Ala Pro Asp Trp Val Val Gly Asp Leu
1 5 10 15
Glu Lys
<210> 8
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 8
Gly Ala Pro Asp Trp Val Val Gly Asp Leu Glu Lys Val Ala Lys Tyr
1 5 10 15
Glu Lys
<210> 9
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 9
Val Gly Asp Leu Glu Lys Val Ala Lys Tyr Glu Lys Tyr Ser Gly Val
1 5 10 15
Phe Leu
<210> 10
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 10
Val Ala Lys Tyr Glu Lys Tyr Ser Gly Val Phe Leu Gly Arg Ala Glu
1 5 10 15
Asp Leu
<210> 11
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 11
Tyr Ser Gly Val Phe Leu Gly Arg Ala Glu Asp Leu Ile Thr Asn Asn
1 5 10 15
Asp Val
<210> 12
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 12
Gly Arg Ala Glu Asp Leu Ile Thr Asn Asn Asp Val Asp Tyr Ser Thr
1 5 10 15
Asn Gln
<210> 13
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 13
Ile Thr Asn Asn Asp Val Asp Tyr Ser Thr Asn Gln Ala Thr Ala Lys
1 5 10 15
Ala Arg
<210> 14
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 14
Asp Tyr Ser Thr Asn Gln Ala Thr Ala Lys Ala Arg Ala Asn Leu Ala
1 5 10 15
Ala Asn
<210> 15
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 15
Ala Thr Ala Lys Ala Arg Ala Asn Leu Ala Ala Asn Leu Lys Ser Thr
1 5 10 15
Leu Gln
<210> 16
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 16
Ala Asn Leu Ala Ala Asn Leu Lys Ser Thr Leu Gln Lys Asp Leu Glu
1 5 10 15
Asn Glu
<210> 17
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 17
Leu Lys Ser Thr Leu Gln Lys Asp Leu Glu Asn Glu Lys Thr Arg Thr
1 5 10 15
Val Asp
<210> 18
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 18
Lys Asp Leu Glu Asn Glu Lys Thr Arg Thr Val Asp Ala Ser Gly Lys
1 5 10 15
Arg Ser
<210> 19
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 19
Lys Thr Arg Thr Val Asp Ala Ser Gly Lys Arg Ser Ile Ser Gly Thr
1 5 10 15
Asp Thr
<210> 20
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 20
Ala Ser Gly Lys Arg Ser Ile Ser Gly Thr Asp Thr Glu Lys Ile Ser
1 5 10 15
Gln Leu
<210> 21
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 21
Ile Ser Gly Thr Asp Thr Glu Lys Ile Ser Gln Leu Val Asp Lys Glu
1 5 10 15
Leu Ile
<210> 22
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 22
Glu Lys Ile Ser Gln Leu Val Asp Lys Glu Leu Ile Ala Ser Lys Met
1 5 10 15
Leu Ala
<210> 23
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 23
Val Asp Lys Glu Leu Ile Ala Ser Lys Met Leu Ala Arg Tyr Val Gly
1 5 10 15
Lys Asp
<210> 24
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 24
Ala Ser Lys Met Leu Ala Arg Tyr Val Gly Lys Asp Arg Val Phe Val
1 5 10 15
Leu Val
<210> 25
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 25
Arg Tyr Val Gly Lys Asp Arg Val Phe Val Leu Val Gly Leu Asp Lys
1 5 10 15
Gln Ile
<210> 26
<211> 18
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 26
Arg Val Phe Val Leu Val Gly Leu Asp Lys Gln Ile Val Asp Lys Val
1 5 10 15
Arg Glu
<210> 27
<211> 19
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 27
Gly Leu Asp Lys Gln Ile Val Asp Lys Val Arg Glu Glu Leu Gly Met
1 5 10 15
Val Lys Lys
<210> 28
<211> 13
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 28
Phe Leu Val Ala Lys Tyr Glu Lys Tyr Ser Gly Val Phe
1 5 10
<210> 29
<211> 13
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 29
Val Ala Lys Tyr Glu Lys Tyr Ser Gly Val Phe Leu Gly
1 5 10
<210> 30
<211> 13
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 30
Lys Tyr Glu Lys Tyr Ser Gly Val Phe Leu Gly Arg Ala
1 5 10
<210> 31
<211> 13
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 31
Glu Lys Tyr Ser Gly Val Phe Leu Gly Arg Ala Glu Asp
1 5 10
<210> 32
<211> 13
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 32
Tyr Ser Gly Val Phe Leu Gly Arg Ala Glu Asp Leu Ile
1 5 10
<210> 33
<211> 13
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 33
Asp Val Asp Tyr Ser Thr Asn Gln Ala Thr Ala Lys Ala
1 5 10
<210> 34
<211> 13
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 34
Asp Tyr Ser Thr Asn Gln Ala Thr Ala Lys Ala Arg Ala
1 5 10
<210> 35
<211> 13
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 35
Ser Thr Asn Gln Ala Thr Ala Lys Ala Arg Ala Asn Leu
1 5 10
<210> 36
<211> 13
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 36
Asn Gln Ala Thr Ala Lys Ala Arg Ala Asn Leu Ala Ala
1 5 10
<210> 37
<211> 13
<212> PRT
<213>Artificial sequence (Artificial Sequence)
<400> 37
Ala Thr Ala Lys Ala Arg Ala Asn Leu Ala Ala Asn Leu
1 5 10
<210> 38
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 38
aactcaagtg gcatagatgt gg 22
<210> 39
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 39
gacctcaaac ttggcaatac tc 22
<210> 40
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 40
tgtcatcctg ctcttctttc tc 22
<210> 41
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 41
tgatgctctt taggctttcc ag 22
<210> 42
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 42
atccgtaaag acctctatgc caaca 25
<210> 43
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 43
gtcgccttca ccgttccagt tt 22

Claims (6)

1. the restricted CD4 of HLA of helicobacter pylori Lpp20 a kind of+T cell epitope immunodominance peptide, which is characterized in that its group At as shown in SEQ ID NO.14.
2. the restricted CD4 of HLA of helicobacter pylori Lpp20 a kind of+T cell epitope immunocore peptide, which is characterized in that its group At as shown in SEQ ID NO.36.
3. application of the immunodominance peptide in preparing helicobacter pylori epiposition vaccine described in claim 1.
4. application of the immunocore peptide in preparing helicobacter pylori epiposition vaccine described in claim 2.
5. a kind of helicobacter pylori epiposition vaccine, which is characterized in that its active ingredient includes or comes from described in claim 1 Immunodominance peptide.
6. a kind of helicobacter pylori epiposition vaccine, which is characterized in that its active ingredient includes or comes from described in claim 2 Immunocore peptide.
CN201810386324.1A 2018-04-26 2018-04-26 Helicobacter pylori immunodominant epitope peptide L79-96And its application Pending CN108752436A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810386324.1A CN108752436A (en) 2018-04-26 2018-04-26 Helicobacter pylori immunodominant epitope peptide L79-96And its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810386324.1A CN108752436A (en) 2018-04-26 2018-04-26 Helicobacter pylori immunodominant epitope peptide L79-96And its application

Publications (1)

Publication Number Publication Date
CN108752436A true CN108752436A (en) 2018-11-06

Family

ID=64011893

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810386324.1A Pending CN108752436A (en) 2018-04-26 2018-04-26 Helicobacter pylori immunodominant epitope peptide L79-96And its application

Country Status (1)

Country Link
CN (1) CN108752436A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102353794A (en) * 2011-07-22 2012-02-15 中国人民解放军第三军医大学 Method for screening and identifying helicobacter pylori epitope peptides
CN102924576A (en) * 2012-11-05 2013-02-13 中国人民解放军第三军医大学药学院 Helicobacter pylori immunodominance epitope peptide and preparation method and application thereof
CN105106945A (en) * 2015-09-01 2015-12-02 宁夏医科大学 Helicobacter pylori tetravalent virulence factor multi-epitope vaccine and preparation method thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102353794A (en) * 2011-07-22 2012-02-15 中国人民解放军第三军医大学 Method for screening and identifying helicobacter pylori epitope peptides
CN102924576A (en) * 2012-11-05 2013-02-13 中国人民解放军第三军医大学药学院 Helicobacter pylori immunodominance epitope peptide and preparation method and application thereof
CN105106945A (en) * 2015-09-01 2015-12-02 宁夏医科大学 Helicobacter pylori tetravalent virulence factor multi-epitope vaccine and preparation method thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
YAN LI ET AL.: "Identification and characterization of H-2d restricted CD4+T cell epitopes on Lpp20 of Helicobacter pylori", 《BMC IMMUNOLOGY》 *
陈惠鹏: "《医学生物工程进展》", 31 July 2004 *

Similar Documents

Publication Publication Date Title
Huber et al. Coxsackievirus B3 induces T regulatory cells, which inhibit cardiomyopathy in tumor necrosis factor-α transgenic mice
CN103103246B (en) The method of activation of helper t cell and the composition for this method
CN109609584A (en) The detection method of mescenchymal stem cell immunoregulation capability
Lozano-Rodríguez et al. Cellular and humoral functional responses after BNT162b2 mRNA vaccination differ longitudinally between naive and subjects recovered from COVID-19
CN104628833B (en) A kind of tuberculosis infection cellular immunization detectable antigens composition and application thereof
CN102608333B (en) Tuberculosis diagnostic composition and application thereof
ES2601105T3 (en) Method for stimulating antigen-specific T cell responses using accelerated cocultured dendritic cells
Kasatskaya et al. Functionally specialized human CD4+ T-cell subsets express physicochemically distinct TCRs
CN102391996A (en) Recombination VTT and method for detecting vaccinia virus neutralizing antibody by using same
Santos et al. IgG from non-atopic individuals induces in vitro IFN-γ and IL-10 production by human intra-thymic γδT cells: a comparison with atopic IgG and IVIg
CN107091932B (en) Tuberculosis immunodiagnosis molecular marker and its medical usage
CN110433285B (en) Individualized tumor antigen peptide vaccine and preparation method thereof
CN102353794B (en) Method for screening and identifying helicobacter pylori epitope peptides
CN102746381B (en) Helicobacter pylori antigen HLA restrictive immunodominance epitope peptide and preparation method and application thereof
Ning et al. Identification of two Lpp20 CD4+ T cell epitopes in Helicobacter pylori-infected subjects
CN110257478A (en) A kind of rapid screening method of effective neoantigen peptide of tumour individuation vaccine
US20230015932A1 (en) Method of generation of lympho-myeloid niches
CN108752436A (en) Helicobacter pylori immunodominant epitope peptide L79-96And its application
CN102924576B (en) Helicobacter pylori immunodominance epitope peptide and preparation method and application thereof
CN108752427A (en) Helicobacter pylori immunodominant epitope peptide L55-72And its application
CN106480003B (en) The combination of helicobacter pylori dominant antigen and screening technique based on CD4+T cellular immunity
CN101580539B (en) Polypeptide for inducing CD4&lt;+&gt;CD25&lt;+&gt; regulatory T cells and application
CN104628834B (en) A kind of tuberculosis infection T cell immunodetection antigen and application thereof
de Sousa et al. Non-atopic neonatal thymic innate lymphoid cell subsets (ILC1, ILC2, and ILC3) identification and the modulatory effect of igG from dermatophagoides pteronyssinus (Derp)-atopic individuals
CN106754712A (en) The method that induction of cord blood mononuclear cell is divided into myeloid cell

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20181106

RJ01 Rejection of invention patent application after publication