CN108720848A - Diabetes very-long-range intelligence diagnosis and therapy system and its application in treating diabetes - Google Patents

Diabetes very-long-range intelligence diagnosis and therapy system and its application in treating diabetes Download PDF

Info

Publication number
CN108720848A
CN108720848A CN201710266870.7A CN201710266870A CN108720848A CN 108720848 A CN108720848 A CN 108720848A CN 201710266870 A CN201710266870 A CN 201710266870A CN 108720848 A CN108720848 A CN 108720848A
Authority
CN
China
Prior art keywords
diabetes
blood glucose
long
blood sugar
blood
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710266870.7A
Other languages
Chinese (zh)
Inventor
叶海峰
于袁欢
邵佳伟
薛帅
白郁
余贵玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Sai Sai Biotechnology Co Ltd
Original Assignee
Suzhou Sai Sai Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Sai Sai Biotechnology Co Ltd filed Critical Suzhou Sai Sai Biotechnology Co Ltd
Priority to CN201710266870.7A priority Critical patent/CN108720848A/en
Priority to PCT/CN2017/100448 priority patent/WO2018192156A1/en
Publication of CN108720848A publication Critical patent/CN108720848A/en
Pending legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/145—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue
    • A61B5/1455—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue using optical sensors, e.g. spectral photometrical oximeters
    • A61B5/1459—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue using optical sensors, e.g. spectral photometrical oximeters invasive, e.g. introduced into the body by a catheter
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B5/00—Measuring for diagnostic purposes; Identification of persons
    • A61B5/145—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue
    • A61B5/14532—Measuring characteristics of blood in vivo, e.g. gas concentration, pH value; Measuring characteristics of body fluids or tissues, e.g. interstitial fluid, cerebral tissue for measuring glucose, e.g. by tissue impedance measurement
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61M—DEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
    • A61M31/00—Devices for introducing or retaining media, e.g. remedies, in cavities of the body
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61M—DEVICES FOR INTRODUCING MEDIA INTO, OR ONTO, THE BODY; DEVICES FOR TRANSDUCING BODY MEDIA OR FOR TAKING MEDIA FROM THE BODY; DEVICES FOR PRODUCING OR ENDING SLEEP OR STUPOR
    • A61M2230/00—Measuring parameters of the user
    • A61M2230/20—Blood composition characteristics
    • A61M2230/201—Glucose concentration

Abstract

The invention discloses a kind of diabetes very-long-range intelligence diagnosis and therapy systems, it includes the LED that can be implanted and the transplantation carrier containing engineering cell, such as hydrogel far-red light LED, the customization cell and far-red light LED by far-red light regulating and expressing, excreting insulin or glucagon-like peptide that it is wrapped up by hydrogel are constituted.Present system can convert blood sugar concentration high-low signal to optical signal or user mobile phone control instruction to control the expression quantity that the optical module to implant precisely adjusts insulin or glucagon-like peptide, to achieve the purpose that automation, precision, individualized treatment diabetes.The present invention integrates diabetes diagnosis and treatment, with very-long-range control, to diabetic condition accuracy of judgement, treatment is precisely rapid, it is easy to operate, intelligence degree is high, the features such as treating good insulating and having no toxic side effect, being customized in artificial intelligence has huge potential using value in the Disciplinary Frontiers such as the diagnosis and treatment of cell and disease.

Description

Diabetes very-long-range intelligence diagnosis and therapy system and its application in treating diabetes
Technical field
The present invention relates to the multi-crossed disciplines fields such as electronic engineering, synthetic biology, light science of heredity, and in particular to Yi Zhongtong Cross in vivo implantation optical module integrate diagnosing and treating diabetes diabetes very-long-range intelligence diagnosis and therapy system and its Application in treating diabetes.
Background technology
Diabetes are one group of lifelong participation metabolic diseases caused by multi-pathogenesis characterized by chronic hyperglycemia, are current Threaten one of the most important chronic epidemic disease of global human health.With the exacerbation of conditions of patients, it will involve body Each important organ and body tissue, especially eye, kidney, heart, blood vessel, nerve chronic lesion, cause multiple complications.Its Middle type 1 diabetes mostly occur in Children and teenager, can also betide other ages.Normally due to excreting insulin in pancreas Beta Cell of islet by the targeted disruption of autoreactive T cell, cause internal insulin absolutely insufficient, be easy to happen ketone Disease acid poisoning, patient usually requires to receive insulin therapy all the life, otherwise by threat to life.Diabetes B is mostly at 35~40 years old It falls ill later, accounts for 90% or more diabetic.The insulin deficit of diabetes B patient is inactivated derived from islet beta cell function Or insulin resistance, the i.e. target organ of insulin action, tissue are reduced or are lost, body to the reactivity of its biological effect It needs to secrete the next compensatory this defect of more insulin, diabetes B, which can pass through, injects glucagon-like peptide (GLP-1- Fc) state of an illness is made to be eased.Current medical level still cannot thoroughly cure diabetes, and diabetic need to take orally drop daily Hypoglycemic medicament or insulin injection maintain glucostasis, and insulin injection is unable to reach and controllably discharges insulin, easily Cause risk of hypoglycemia.Therefore, it is possible to blood sugar concentration in the self-monitoring body of real-time intelligent and can be accurately to blood glucose Concentration is adjusted extremely important for treatment diabetes in time.Occur a small number of Intelligent blood sugar monitors currently on the market, only Blood glucose value can simply be provided, and intelligence degree is not high, patient still need to according to provide blood glucose value adjustment therapeutic scheme and Living habit, there are no the diabetes very-long-range intelligence diagnosis and therapy systems that can integrate diagnosing and treating.
Invention content
Technical problem to be solved by the present invention lies in view of the above shortcomings of the prior art, propose one kind by vivo Implantation optical module integrates diabetes very-long-range intelligence diagnosis and therapy system and intelligence diagnosis and treatment of diagnosing and treating diabetes Application of the system in treating diabetes, the optical module that the present invention implants is by internal blood sugar concentration feedback regulation and user The direct very-long-range of mobile phone controls dual regulation and control, has very-long-range control, to diabetic condition accuracy of judgement, treatment is rapid, operation Simplicity, intelligence degree is high, the features such as treating good insulating and have no toxic side effect, can reach automation, precision, individuation The purpose for treating diabetes has huge potential using value, future in the diagnosis and treatment that artificial intelligence customizes cell and disease It can be widely applied to clinical treatment.
The present invention proposes a kind of diabetes very-long-range intelligence diagnosis and therapy system, and the equipment includes：Blood glucose level data is controlled automatically System processed, blood glucose level data tele-control system, wireless power supply module, optical module；The blood glucose level data automatic control system packet Include blood sugar concentration detector and blood glucose level data processing unit；The blood glucose level data automatic control system is examined by the blood sugar concentration After surveying instrument acquisition blood glucose concentration value, blood sugar concentration data are generated；The blood glucose level data processing unit is from the blood sugar concentration data Middle extraction blood glucose concentration value, according to the electric current of blood glucose concentration value output corresponding voltage to the wireless power supply module；The blood glucose Remote data control system includes being equipped with the mobile device and Intelligence Remote Controller of application terminal；The mobile device is to institute It states Intelligence Remote Controller and sends instruction, the Intelligence Remote Controller is communicated with the blood glucose level data processing unit, the blood Electric current of the sugared data processing unit according to instruction output corresponding voltage；The wireless power supply module is according to the voltage of institute's input current The sine wave signal of the corresponding transmission power of value output；The optical module include the induction receiving coil being arranged in series, capacitance, LED and contain engineering cell transplantation carrier；The induction receiving coil receive generate after sine wave signal induced current with The light emission luminance for adjusting the LED induces the engineering cell in the transplantation carrier to generate different amounts of hypoglycemic drug.
In the diabetes very-long-range intelligence diagnosis and therapy system proposed by the present invention, the blood sugar concentration tester includes：Blood Sugared test strips, blood sugar concentration sensor assembly, Bluetooth of mobile phone wireless transport module and its client software.
In the diabetes very-long-range intelligence diagnosis and therapy system proposed by the present invention, the blood glucose level data processing unit is to blood glucose Concentration range judges, and is divided according to the blood sugar concentration threshold value of setting and is opened to control relay different in relay unit It closes, the output voltage of the system switching power supply is regulated and controled by relay to export corresponding electric current to the wireless power supply module.
In the diabetes very-long-range intelligence diagnosis and therapy system proposed by the present invention, the blood glucose level data automatic control system into One step is equipped with DC power supply power supply module；For showing blood glucose concentration value, output voltage values, optical module LED luminance value liquid crystal Display module；Switching Power Supply；Wireless power supply module.
In the diabetes very-long-range intelligence diagnosis and therapy system proposed by the present invention, the blood sugar concentration detector passes through bluetooth It is wirelessly transferred blood sugar concentration data transmission to blood glucose level data processing unit.
In the diabetes very-long-range intelligence diagnosis and therapy system proposed by the present invention, in the blood glucose level data tele-control system The mobile device there is wireless receiving module, the mobile device to obtain blood sugar concentration data and simultaneously be read using application terminal Blood glucose concentration value；Pass through wireless signal telecommunication between the Intelligence Remote Controller and the mobile device.
In the diabetes very-long-range intelligence diagnosis and therapy system proposed by the present invention, the blood glucose level data tele-control system into One step is equipped with microcontroller；Relay driving module；Relay group；Power supply adaptor and Switching Power Supply.
In the diabetes very-long-range intelligence diagnosis and therapy system proposed by the present invention, the wireless power supply module is further provided with Low pressure difference linearity voltage stabilizing chip, electromagnetic viscosimeter circuit, power amplification circuit and launching circuit.
In the diabetes very-long-range intelligence diagnosis and therapy system proposed by the present invention, the LED transmittings light includes purple light, indigo plant Light, green light, feux rouges, near infrared light and far-red light.
In the diabetes very-long-range intelligence diagnosis and therapy system proposed by the present invention, it is thin that the transplantation carrier contains engineering Born of the same parents, the cell of the engineering are the customization cell of light induction regulating controlling gene expression, including a variety of prokaryotic cells and eukaryon Cell.
In the diabetes very-long-range intelligence diagnosis and therapy system proposed by the present invention, the form of the transplantation carrier includes water-setting Glue, semi-permeable membrane bag filter, hollow fiber conduit, microcapsules.
The invention also provides the application of the diabetes very-long-range intelligence diagnosis and therapy system in treating diabetes.
Diabetes very-long-range intelligence diagnosis and therapy system of the present invention tests blood sugar concentration by blood sugar concentration tester, surveys Examination data can be fed back to the LED of internal optical module by blood glucose level data processing unit and wireless power supply module, according to setting Blood sugar concentration threshold value (blood glucose range corresponds to the brightness of LED), patient blood glucose's concentration is higher, and the LED of internal optical module is bright Degree is stronger, and the hypoglycemic drug of the cell secretion of the engineering of light regulation and control is more, and blood sugar decreasing effect is more apparent；Work as patient blood glucose When concentration restores normal or relatively low, system can close optical module, stop generating hypoglycemic drug, to prevent patient blood glucose's mistake It is low.
Description of the drawings
Fig. 1 is the overall work principle of diabetes very-long-range intelligence diagnosis and therapy system；
Fig. 2 is the circuit diagram of diabetes very-long-range intelligence diagnosis and therapy system；
Fig. 3 is that the blood sugar concentration tester, bluetooth wireless transmitter module, DC power supply of blood glucose level data automatic control system supply Electric module pictorial diagram；
Fig. 4 is blood glucose level data automatic control system LCD MODULE pictorial diagram；
Fig. 5 is that wireless power supply module and optical module far-red light LED line circle exist together pictorial diagram in a certain range；
Fig. 6 is blood glucose level data tele-control system intelligent controller pictorial diagram；
Fig. 7 is the mating APP snapshots of blood glucose level data tele-control system intelligent controller；
Fig. 8 is optical module pictorial diagram；
Fig. 9 is optical module structure ideograph；
Figure 10 is the induction receiving coil, capacitance, far infrared LED pictorial diagrams of optical module；
Figure 11 is that the glucose solution of verification various concentration in vitro can control the difference of internal optical module far-red light LED Brightness is to induce the experimental result picture of different SEAP expression quantity；
Figure 12 is to verify the blood sample that different blood sugar concentrations are taken out out of wild-type mice and diabetic mice body in vitro The different brightness of optical module far-red light LED are to induce the experimental result of different mouse islets element expression quantity in product control volume Figure；
Figure 13 is to verify the blood sample control that different blood sugar concentrations are taken out out of Healthy People and diabetic's body in vitro The different brightness of internal optical module far-red light LED are made to induce the experimental result picture of different GLP-1-Fc expression quantity；
Figure 14 is that it is super remote that diabetes are verified in wild-type mice and diabetes B Mice Body using SEAP as reporter gene Cheng Zhineng diagnosis and therapy systems are directed to the experimental result picture of self feedback function of the digitlization of different blood sugar concentrations；
Figure 15,16,17 are that diabetes very-long-range intelligence diagnosis and therapy system is verified in diabetes B Mice Body for 2 types sugar Urinate the diagnosing and treating function result figure of disease：
Wherein, Figure 15 is that diabetes very-long-range intelligence diagnosis and therapy system carries out diagnoses and treatment induction to diabetes B mouse GLP-1-Fc for 24 hours, the expression quantity result figure of 48h, 72h；
Wherein, Figure 16 is that diabetes very-long-range intelligence diagnosis and therapy system carries out diagnoses and treatment to diabetes B mouse, for 24 hours, The blood sugar concentration result figure that 48h, 72h are measured；
Wherein, Figure 17 is that diabetes very-long-range intelligence diagnosis and therapy system carries out diagnoses and treatment to diabetes B mouse, each The brightness of the optical module far-red light LED at blood sugar monitoring time point and its corresponding blood sugar concentration result figure.
Specific implementation mode
Using embodiment below, the present invention is further elaborated.These embodiments are only used for illustrating invention, without right The scope of the present invention constitutes any restrictions.Implementation process, condition, reagent, the experimental method etc. of the present invention, specially refers to except following Content except, be that content is not particularly limited in the universal knowledege of this field and generally acknowledged common sense, the present invention.In following embodiment Reagent, instrument used etc. and test method without specific conditions, according to the item proposed by routine or goods supplier Part carries out.
Diabetes very-long-range intelligence diagnosis and therapy system of the present invention is by blood glucose level data automatic control system, blood glucose level data remote control System, wireless power supply module and optical module composition.Blood glucose level data automatic control system includes blood sugar concentration detector and blood glucose Data processing unit；After blood sugar concentration detector in blood glucose level data automatic control system obtains blood glucose concentration value, blood glucose is generated Concentration data；By the blood glucose level data processing unit in blood glucose level data automatic control system from blood sugar concentration extracting data blood glucose Concentration value, according to the electric current of blood glucose concentration value output corresponding voltage to wireless power supply module；
Blood glucose level data tele-control system includes the mobile device and Intelligence Remote Controller for being equipped with application terminal；The two By accessing same WLAN WLAN, sends and instruct from mobile device to Intelligence Remote Controller, pass through intelligent remote control Device processed is input to the electric current that corresponding voltage is exported in blood glucose level data processing unit；
Wireless power supply module exports the sine wave signal of corresponding transmission power according to the voltage value of institute's input current；Optical mode Block includes induction receiving coil, capacitance, LED and the hydrogel containing engineering cell being arranged in series；Induction receiving coil connects Induced current is generated to adjust the light emission luminance of optical module LED after receiving sine wave signal, induces the engineering in hydrogel thin Born of the same parents generate different amounts of hypoglycemic drug.The light emission luminance of remote adjustment optical module LED simultaneously induces the engineering in hydrogel Change cell and generates different amounts of hypoglycemic drug.
Blood sugar concentration tester used in present embodiment is happy limited at biological electronic technology purchased from BeiJing, China It is transformed in company, it is carried out data with Bluetooth of mobile phone wirless transmitting and receiving module docks, and completes to blood sugar concentration The measuring distance of the wireless transmission of data, transmission is within 10m.The chargeable lithium of 3.7V polymer is used in blood sugar concentration detector Battery reads instrument and Bluetooth transmission module for power supply to blood glucose.
Blood glucose level data automatic control system in present embodiment further comprises DC power supply power supply module, blood glucose Data processing unit, LCD MODULE, relay unit, Switching Power Supply.DC power supply power supply module is AC-DC power adaptations The alternating current of AC220V is converted in device, completion, and for the DC voltage of conversion to switch power module, blood glucose level data processing is single Member, bluetooth wirless transmitting and receiving module, LCD MODULE, relay unit power supply.Blood glucose level data processing unit is U.S.'s moral The low-power consumption serial blood glucose data processing unit chip MSP430 of state instrument company connects with bluetooth wirless transmitting and receiving module It connects, the blood sugar concentration data of bluetooth wireless transmitter module transmission is received by the general serial asynchronous receiving-transmitting bus of standard.Blood glucose Data processing unit MSP430 extracts the blood glucose level data of reception according to communication protocol, and transfers data to display mould Block is shown, while being judged to blood glucose range, and different relay switches is controlled according to the division of the threshold value of concentration, according to This regulates and controls the output voltage of the system switching power supply to reach the brightness control to internal optical module.
Blood sugar concentration threshold value is divided into<6.1mM,6.1-11.1mM,11.1-16.8mM,>16.8mM, it is corresponding remote The brightness of red-light LED is 0mW/cm2, 0.2mW/cm2, 1.0mW/cm2, 5.0mW/cm2。
It is blood sugar concentration control programming below：
The above blood sugar concentration threshold value and its pseudocode are one of the specific implementation mode of the present invention, and the present invention is for above-mentioned threshold Value does not limit.
Blood glucose level data tele-control system in present embodiment includes：Be equipped with application terminal mobile device, Intelligence Remote Controller, microcontroller, relay driving module, relay group, power supply adaptor, Switching Power Supply.
In above-mentioned specific implementation mode, the input voltage of Switching Power Supply:It is excellent to be used in 5~23V, highest 23V, 20V, defeated Enter anti-reversed (voltage of input must be higher 1V or more than output voltage)；Adjustable output voltage range 0V~16.5V is continuously adjustable, from It is dynamic to preserve last time setting voltage；Peak point current 3A, it is excellent to be used in 2A.Precision 1%, minimum show 0.01A；Transfer efficiency Height, up to 95% (efficiency is related with input, output voltage, electric current, pressure difference)；Load regulation S (I)≤0.8%, voltage adjustment Rate S (u)≤0.8%.Mobile device is one or multi-section smart mobile phone, and application terminal is corresponding client software App. Intelligence Remote Controller supports mobile phone remote control, supports WiFi, 2G/3G/4G control models, maximum allowable 10A high currents, branch Hold multi-channel control, per road can independent control, control effect real time push is to mobile device, and in being shown in application terminal；Intelligence Remote controllers can also support time switch, scene mode, realize time switch and a key switch function, support Android, apple Mobile phone and tablet, software support Custom Attributes with a software support multiple equipment, multiple switch, and can be supported further Data backup and data are restored, and support scans the two-dimensional code importing equipment, and equipment, easy to operate victory can be also shared with other staff.
Wireless power supply module includes：It low pressure difference linearity voltage stabilizing chip, electromagnetic viscosimeter circuit, power amplification circuit and is transmitted back to Road.Low pressure difference linearity voltage stabilizing chip provides the voltage of the stabilization needed for module, and electromagnetic viscosimeter circuit is generating frequency 180KHz just String wave signal, power amplification circuit provide the power needed for the sine wave signal transmitting of frequency 180KHz, and launching circuit will be sinusoidal Wave signal is emitted to space, forms an electromagnetic environment.Wherein, outer diameter is made of launching circuit selects fine copper conducting wire coiling The transmitting coil of 20cm simultaneously constitutes a relatively uniform wireless electromagnetic environment using multiple transmitting coils.
Optical module includes：Incude receiving coil, capacitance, LED and the hydrogel containing engineering cell.LED is two The far-red light LED that patch type 3535 encapsulates.Further, feeding for the engineering regulated and controled by far-red light has been wrapped up in hydrogel LED Newborn zooblast HEK-293, specific preparation process are as follows：HEK-293 cells through transfecting far-red light system are suspended in In the sodium alginate buffer solution of 1.5% (w/v) (sodium alginate is dissolved in DMEM), it is every milliliter to reach final cell densities 4×106A cell is equivalent in each hydrogel LED and wraps up 2 × 106It is a through the above-mentioned HEK-293 cells transfected.By optics The far-red light LED line circle of module, which faces up, is positioned over 24 orifice bore bottoms, and the 500 above-mentioned cell suspending liquids of μ l are drawn with pipettor It is added drop-wise on far-red light LED line circle.Then plus 500 μ l polymerize buffer solution (100mM CaCl2, 10mM MOPS, pH=7.2) and solid Change 10min or more, is finally positioned over Poly-L-Lysine Solution (0.05%poly-L-lysine, the MW 0.05%:15,000- 30,000,10mM MOPS, 0.85%NaCl, pH=7.2) in be incubated 10min again.
Molecular cloning
All expression plasmids of the molecule clone technology structure present invention, step is common sense in the industry.
The primer of be useful for PCR is synthesized by Jin Wei intelligence bio tech ltd.It is built in the embodiment of the present invention Expression plasmid all passes through sequencing, and sequencing is completed by Jin Wei intelligence bio tech ltd.Institute in the embodiment of the present invention Phanta Max Super-Fidelity archaeal dna polymerases are purchased from Nanjing Vazyme Biotechnology Co., Ltd..In nucleic acid Enzyme cutting, T4DNA ligases are purchased from TaKaRa companies.Homologous recombination enzyme is purchased from and the limited public affairs of first biotechnology (Shanghai) share Department.PhantaMax Super-Fidelity archaeal dna polymerases are accompanied with corresponding polymerase buffer and dNTP when buying.Core It is accompanied with corresponding buffer solution when sour restriction endonuclease, T4DNA ligases, the purchase of homologous recombination enzyme.Yeast extract (Yeast Extract), tryptone (Trypton), agar powder, ammonia benzyl blueness enzyme plain (Amp) are limited purchased from Shanghai life work biotechnology Company.DNA Marker DL5000, DNAMarker DL2000 (precious bioengineering Co., Ltd)；Nucleic acid dye EB (Guangdong states Biotech company difficult to understand)；The small pumping extracts kit (TIANGEN Biotech (Beijing) Co., Ltd.) of plasmid；DNA glue reclaim reagents It is century bio tech ltd that box, PCR product purification kit, which are purchased from health,；The absolute ethyl alcohol that is referred in embodiment, Remaining reagent such as NaCl is domestic analysis net product.Glue recycling, the purifying recycling of DNA fragmentation, step are recycled according to DNA glue The operational manual of kit, PCR product purification kit (health is century bio tech ltd)；Plasmid extraction step root According to small pumping (TIANGEN Biotech (Beijing) Co., Ltd.) the extracts kit specification of plasmid.
Cell culture and transfection
With the gene for illustrating far-red light regulation and control transgene expression for following cell line and PEI transfections in the embodiment of the present invention Working condition of the loop remote control and regulation system in cell and animal body, but invention protection domain of the present invention is not limited.
Centrifuge tube for the 10cm Tissue Culture Dish of cell culture, tissue culture plate (24 hole), 15mL and 50mL is purchased From Thermo Fisher Scientific companies of the U.S. (Labserv)；Improved Eagle culture mediums, the tire ox blood used Clearly, penicillin and Streptomycin Solution are purchased from Gibico companies of the U.S.；Transfection PEI used is purchased from Polysciences companies；Carefully Born of the same parents' incubator is purchased from Thermo Fisher Scientific companies of the U.S.；Remaining consumptive material is common domestic consumptive material.
Cell culture：Human embryonic kidney cell (HEK-293, ATCC:CRL-11268 improved Eagle cultures) are incubated at In base, the penicillin and Streptomycin Solution of the fetal calf serum and 1% (v/v) of 10% (v/v) are added in culture medium；Cell culture in 37 DEG C, in the incubator containing 5% gas concentration lwevel.
Transfection：All cell line transfections use operating procedure (the Wieland M, Methods 56 (3) of the PEI after optimization: 351).Briefly, 4 × 10 as are inoculated in cultivating system is 10mL 10cm Tissue Culture Dish6A cell, in culture 16h Afterwards, by the DNA of best proportion according to 3:1(PEI:DNA mass ratio) stands 6h with PEI mixed dissolutions in the culture medium of 2mL.
The detection of reporter gene secreted alkaline phosphatase (SEAP)
Homoarginine, magnesium chloride, diethanol amine, HCl for configuring examining report Gene response buffer solution are purchased to life Work bioengineering (Shanghai) limited liability company；Chromogenic substrate (pNPP:P-Nitrophenylphosphate) purchase is brilliant to Shanghai Pure biochemical technology limited liability company (Aladdin).
(1) reagent configures：
2xbuffer:
20mM homoarginine is noted：It is to inhibit endogenic alkaline phosphatase activities that it, which is acted on,
1mM magnesium chlorides
2% diethanol amine
PH to 9.8 is adjusted with HCl
Substrate solution：
120mM chromogenic substrates (pNPP:p-Nitrophenylphosphate)
·In 2x assay buffer
(2) experimental procedure：
1. drawing cell culture supernatant liquid, (note in 200 μ L to centrifuge tube：Generally to be more than 150 μ L, because follow-up add A volume part can be lost in heat).
2.65 DEG C of water-bath 30min (notes：Heating mainly allows endogenic alkaline phosphatase to inactivate, and SEAP high temperature resistants, It will not be inactivated at a temperature of this).
3. drawing 80 μ L (experimental situation voluntarily dilutes) to 96 orifice plates, 2x preheated in advance is rapidly joined 20 μ l of buffer100 μ l and substrate solution.
4. microplate reader 405nm is surveyed 10 times, per minor tick 1min (experimental situation can separately set condition).
(3) calculating of enzyme activity
The enzyme activity of alkaline phosphatase (SEAP) defines:37 DEG C, when pH 9.8, in 1min with substrate p-nitrophenyl phosphorus Acid disodium (PNPP-Na2) alkaline phosphatase for generating 1mol/L p-nitrophenols is reacted, it is defined as 1 unit of activity (1U).It is right Nitrophenol itself has glassy yellow, and in wavelength 405nm, the p-nitrophenol of various concentration corresponds to different light absorption values.It calculates Method is：It is enzyme activity that the surveyed OD values of different time points, which make slope of a curve * 256.8, during sample and substrate reactions, single Position U/L.
It prepares the sodium alginate used in optical module hydrogel far-red light LED and is purchased from Buchi companies of Switzerland, poly-D-lysine Purchased from Sigma Co., USA, sodium chloride, calcium chloride, MOPS (Morpholinopropanesulfonic acid) are purchased from Hai Shenggong biotechnologies Co., Ltd.
The detection method of insulin (Insulin)
Experiment detection kit for insulin (Mouse Insulin ELISAkit) used is public purchased from Sweden Mercodia Department, specific assay method refer to product description.
The detection method of glucagon (GLP-1-Fc)
Experiment glucagon detection kit (Millipore Corporation, Billerica, MA used 01821USA, Cat.no.EGLP-35K, Lot.no.2639195) Millipore companies of the U.S. are purchased from, specific assay method is detailed See product description.
Embodiment 1, the composition of diabetes very-long-range intelligence diagnosis and therapy system and making
In the present invention by taking attached drawing 2 as an example, illustrate the production method of diabetes very-long-range intelligence diagnosis and therapy system, but does not limit this Invention protection domain.
The first step is transformed blood glucose meter, and bluetooth wireless transmitter module and the chargeable lithium electricity of 3.7V polymer is added Pond.Bluetooth serial ports transmitting and receiving module model HC-05, slave integral type bluetooth module, integrated universal serial asynchronous receiving-transmitting Bus, interface level are the Transistor-Transistor Logic level of international standard, HC-05 slave integral type bluetooth modules and blood sugar concentration tester into The wireless transmission to blood sugar concentration data is completed in the docking of row data, and the measuring distance of transmission is within 10m；3.7V polymer can fill Electric lithium battery is to blood sugar concentration tester and Bluetooth transmission module for power supply.
Second step connects blood glucose level data processing unit with bluetooth wireless receiving module.Blood glucose level data processing unit, that is, micro- Controller (MCU) is the low-power consumption Series of MCU chip MSP430 and bluetooth wireless receiving mould of Texas Instruments Block connects, and the blood sugar concentration data of Bluetooth transmission module transfer are received by the general serial asynchronous receiving-transmitting bus of standard.Blood glucose The blood sugar concentration tester of data automatic control system, bluetooth wirless transmitting and receiving module, DC power supply power supply module pictorial diagram Refer to attached drawing 3.
Third walks, and blood glucose level data processing unit is connected with LCD MODULE.Microcontroller MSP430 is according to communication protocols View, extracts the blood glucose level data of reception, and transfer data to LCD MODULE and show.Blood glucose level data, which automatically controls, is System LCD MODULE pictorial diagram refers to Figure of description 4.
4th step connects blood glucose level data processing unit with the relay under different mode.Blood glucose level data processing unit pair Blood glucose range judges, and is divided according to the threshold value of blood sugar concentration to export the low and high level under corresponding various concentration range Signal drives the relay switch state under different mode.
5th step connects relay with wireless power supply module, and wireless power supply module and optical module are in certain model together In enclosing.Relay switch state under different mode determines the transmission power of wireless power supply module, to regulator control system switch electricity The output voltage in source reaches the brightness regulation to optical module.Wireless power supply module and optical module far-red light LED line circle are same Pictorial diagram refers to Figure of description 5 in place's a certain range.
6th step, the realization of App clients.Experiment material and side (are specifically shown in by the intelligent controller manufacturer bought Method) provide the App to match, specifically setting and its application method refer to producer's operation instructions.The function packet of the App Include the brightness for controlling optical module far-red light LED, irradiation time, time switch；The blood glucose that may also display in current patents' body is dense The brightness value of angle value, far-red light LED；And the blood glucose situation of patient can be placed on record, be sent to its guardian and hold shifting The App clients of dynamic equipment.The mating App snapshots of blood glucose level data tele-control system intelligent controller refer to Figure of description 7。
7th step, the realization of blood glucose level data tele-control system.Blood glucose level data tele-control system in the present invention is (specific Function and parameter refer to experimental method and material) it is purchased from smart home operating room, smart mobile phone can be used to utilize office by it Domain net WiFi or 2G/3G/4G Internet resources realize the brightness of direct very-long-range control far-red light light source, different to control The expression quantity of SEAP, insulin or GLP-1-Fc.Blood glucose level data tele-control system intelligent controller pictorial diagram refers to specification Attached drawing 6.
8th step, the making of optical module.Optical module is by induction receiving coil, capacitance, two patch type in the present invention The far infrared LED of 3535 encapsulation is constituted with the hydrogel for being engineered cell by far-red light induction regulating controlling has been wrapped up.Capacitance and remote Infrared LED is parallel relationship.It is that the HEK-293 through necessary component needed for transfection is thin to be engineered cell by far-red light induction regulating controlling Born of the same parents.Optical module pictorial diagram refers to Figure of description 8, and tactic pattern figure refers to Figure of description 9, induction receiving coil, capacitance, Far infrared LED pictorial diagrams refer to Figure of description 10.
Embodiment 2, the glucose solution for verifying various concentration in vitro can by diabetes very-long-range intelligence diagnosis and therapy system The different brightness of control optical module far-red light LED are to induce engineering cell in hydrogel to generate different SEAP expression quantity
For this example using SEAP as reporter gene, citing proves that the various concentration of glucose solution can control internal optical module The different brightness of far-red light LED to induce different SEAP expression quantity, but do not limit protection scope of the present invention. It is as follows：
The first step, making (the specific implementation mode materials and methods as detailed above of diabetes very-long-range intelligence diagnosis and therapy system And embodiment 1)
Second step, plasmid construction.Plasmid construction in this example refers to table 1.
Third walks, inoculating cell.Will the good HEK-293 cells of growth conditions with 0.25% pancreatin digestion after kind in In 10cm Tissue Culture Dish, per ware kind 4 × 106A cell, and add DMEM culture mediums of the 10mL containing 10%FBS.
4th step, transfection.It is arrived in for 24 hours in inoculating cell 16,4 μ g pWS46,4 μ gpGY32,4 μ g pXY34, PEI is turned The DMEM mixings of transfection reagent and serum-free drop evenly after being stored at room temperature 15min in 10cm Tissue Culture Dish.Wherein per ware Preparation total volume is 2mL, and plasmid is 1 with PEI mass ratioes:3.Transfect 6h after change DMEM culture mediums of the 10mL containing 10%FBS into Row culture.
5th step, the preparation (specific method reference material and method) of hydrogel far-red light LED.
Hydrogel far-red light LED obtained above is placed in 24 orifice plates and cultivates by the 6th step, respectively not with preparation With concentration of glucose threshold value glucose solution (concentration is respectively 2mM, 4mM, 6mM, 7mM, 9mM, 11mM, 12mM, 14mM, Totally 12 groups of 16mM, 18mM, 20mM, 22mM) it is added dropwise respectively on blood sugar test paper item, blood sugar concentration detector obtains blood glucose concentration value Afterwards, blood sugar concentration data are generated；By the blood glucose level data processing unit in blood glucose level data automatic control system from blood sugar concentration number According to middle extraction blood glucose concentration value, according to the electric current of blood glucose concentration value output corresponding voltage to wireless power supply module；Wireless power mould Root tuber corresponds to the sine wave signal of transmission power according to the voltage value output of institute's input current；Optical module includes the sense being arranged in series Answer receiving coil, capacitance, far-red light LED and the transplantation carrier containing engineering cell；Incude receiving coil and receives sine wave letter Induced current is generated after number to adjust the light emission luminance of optical module far-red light LED, induces the above-mentioned engineering in hydrogel thin Born of the same parents generate different SEAP expression quantity.
7th step, examining report gene.The cell culture supernatant of each group is taken to measure the table of SEAP after cultivating 48h respectively Up to amount (specific method reference material and method).
For example, by a concentration of 2mM, the glucose solution of 4mM, 6mM are added drop-wise on blood sugar test paper item, this concentration exists<6.1mM Threshold range in, the brightness of corresponding far-red light LED is 0mW/cm2, thus measure the expression of SEAP in 24 orifice plate supernatants Amount is almost 0；The glucose solution of a concentration of 7mM, 9mM, 11mM are added drop-wise on blood sugar test paper item, this concentration is in 6.1- In the threshold range of 11.1mM, the brightness of corresponding far-red light LED is 0.2mW/cm2, thus measure in 24 orifice plate supernatants The expression quantity of SEAP is 100U/L or so；The glucose solution of a concentration of 12mM, 14mM, 16mM are added drop-wise to blood sugar test paper item On, for this concentration in the threshold range of 11.1-16.8mM, the brightness of corresponding far-red light LED is 1.0mW/cm2, thus measure The expression quantity of SEAP is 200U/L or so in 24 orifice plate supernatants；The glucose solution of a concentration of 18mM, 20mM, 22mM are added dropwise Onto blood sugar test paper item, this concentration exists>In the threshold range of 16.8mM, the brightness of corresponding far-red light LED is 5.0mW/cm2, The expression quantity for thus measuring SEAP in 24 orifice plate supernatants is 300U/L or so.
The results show that can basis by the blood glucose level data automatic control system in diabetes very-long-range intelligence diagnosis and therapy system The electric current of the glucose solution output corresponding voltage of the different concentration of glucose threshold values of input is to wireless power supply module, optical module Induction receiving coil receive sine wave signal after generate induced current to adjust the light emission luminance of optical module far-red light LED, The above-mentioned engineering cell in hydrogel is induced to generate different SEAP expression quantity.The present embodiment is using SEAP as reporter gene, in body The function of the diabetes very-long-range intelligence diagnosis and therapy system is demonstrated outside.Experimental data refers to Figure of description 11.
Embodiment 3 verifies the blood that different blood sugar concentrations are taken out out of wild-type mice and diabetic mice body in vitro Sample can control the different brightness of optical module far-red light LED to induce water-setting by diabetes very-long-range intelligence diagnosis and therapy system It is engineered cell in glue and generates different mouse islets element expression quantity
For this example using mouse islets element as reporter gene, citing proves that the blood glucose of various concentration can control optical module not Different mouse islets element expression quantity is induced with brightness, but protection scope of the present invention is not limited.Specific steps It is as follows：
The first step, making (the specific implementation mode materials and methods as detailed above of diabetes very-long-range intelligence diagnosis and therapy system And embodiment 1).
Second step, plasmid construction.Plasmid construction in this example refers to table 1.
Third walks, inoculating cell.Will the good HEK-293 cells of growth conditions with 0.25% pancreatin digestion after kind in In 10cm Tissue Culture Dish, per ware kind 4 × 106A cell, and add DMEM culture mediums of the 10mL containing 10%FBS.
4th step, transfection.It is arrived in for 24 hours in inoculating cell 16,4 μ g pWS46,4 μ gpGY32,4 μ g pWS213, PEI is turned The DMEM mixings of transfection reagent and serum-free drop evenly after being stored at room temperature 15min into 10 cm cell culture dishes.Wherein per ware Preparation total volume be 2mL, plasmid and PEI mass ratioes are 1:3.DMEM culture mediums of the 10mL containing 10%FBS is changed to after transfecting 6h It is cultivated.
5th step, the preparation (specific method reference material and method) of hydrogel far-red light LED.
Hydrogel far-red light LED obtained above is placed in 24 orifice plates and cultivates by the 6th step, wild with being derived from respectively The blood sample of different blood sugar concentrations in type mouse and diabetic mice body, respectively 5.7mM, 8.4mM, 14.8mM, 21.2mM.It is added dropwise on blood sugar test paper item, after blood sugar concentration detector obtains blood glucose concentration value, generates blood sugar concentration data；It is logical Blood glucose level data processing unit in blood glucose level data automatic control system is crossed from blood sugar concentration extracting data blood glucose concentration value, according to Blood glucose concentration value exports the electric current of corresponding voltage to wireless power supply module；Wireless power supply module is according to the voltage value of institute's input current The sine wave signal of the corresponding transmission power of output；Optical module includes induction receiving coil, capacitance, the far-red light being arranged in series LED and contain engineering cell transplantation carrier；Incude after receiving coil receives sine wave signal and generates induced current to adjust The light emission luminance of optical module far-red light LED induces the above-mentioned engineering cell in hydrogel to generate different mouse islets element tables Up to amount.7th step, examining report gene.The cell culture supernatant of each group is taken to measure mouse islets element after cultivating 48h respectively Expression quantity (specific method reference material and method).
For example, the blood sample that blood sugar concentration is 5.7mM is added drop-wise on blood sugar test paper item, this concentration exists<The threshold of 6.1mM It is worth in range, the brightness of corresponding far-red light LED is 0mW/cm2, thus measure mouse insulin expression in 24 orifice plate supernatants Amount is about 1.5ng/mL；The blood sample that blood sugar concentration is 8.4mM is added drop-wise on blood sugar test paper item, this concentration is in 6.1- In the threshold range of 11.1mM, the brightness of corresponding far-red light LED is 0.2mW/cm2, thus measure small in 24 orifice plate supernatants Mouse insulin expression amount is about 4.5ng/mL；The blood sample that blood sugar concentration is 14.8mM is added drop-wise on blood sugar test paper item, this For concentration in the threshold range of 11.1-16.8mM, the brightness of corresponding far-red light LED is 1.0mW/cm2, thus measure 24 orifice plates Mouse insulin expression amount is about 7.5ng/mL in supernatant；The blood sample that blood sugar concentration is 21.2mM is added drop-wise to blood glucose examination On paper slip, this concentration exists>In the threshold range of 16.8mM, the brightness of corresponding far-red light LED is 5.0mW/cm2, thus measure Mouse insulin expression amount is about 12.5ng/mL in 24 orifice plate supernatants.
The results show that the blood glucose level data automatic control system in diabetes very-long-range intelligence diagnosis and therapy system can be according to input Different blood sugar concentration threshold values blood sample (being derived from wild-type mice and diabetic mice) output corresponding voltage electric current arrive Wireless power supply module, the induction receiving coil of optical module generate induced current to adjust optical module after receiving sine wave signal The light emission luminance of far-red light LED induces the above-mentioned engineering cell in hydrogel to generate different mouse islets element expression quantity.This reality Example is applied using mouse islets element as reporter gene, demonstrates the function of the diabetes very-long-range intelligence diagnosis and therapy system in vitro.Experiment Data refer to Figure of description 12.
Embodiment 4 verifies the blood sample that different blood sugar concentrations are taken out out of Healthy People and diabetic's body in vitro The different brightness of optical module far-red light LED in control volume, to induce different GLP-1-Fc expression quantity
For this example using GLP-1-Fc as reporter gene, citing proves that the blood glucose of various concentration can control the difference of optical module Brightness does not limit protection scope of the present invention to induce different GLP-1-Fc expression quantity.It is as follows：
The first step, making (the specific implementation mode materials and methods as detailed above of diabetes very-long-range intelligence diagnosis and therapy system And embodiment 1).
Second step, plasmid construction.Plasmid construction in this example refers to table 1.
Third walks, inoculating cell.Will the good HEK-293 cells of growth conditions with 0.25% pancreatin digestion after kind in In 10cm Tissue Culture Dish, per ware kind 4 × 106A cell, and add DMEM culture mediums of the 10mL containing 10%FBS.
4th step, transfection.It is arrived in for 24 hours in inoculating cell 16, by 4 μ g pWS46,4 μ g pGY32,4 μ gp WS212, PEI The DMEM mixings of transfection reagent and serum-free drop evenly after being stored at room temperature 15min in 10cm Tissue Culture Dish.Wherein per ware Preparation total volume be 2mL, plasmid and PEI mass ratioes are 1:3.DMEM culture mediums of the 10mL containing 10%FBS is changed to after transfecting 6h It is cultivated.
5th step, the preparation (specific method reference material and method) of hydrogel far-red light LED.
Hydrogel far-red light LED obtained above is placed in 24 orifice plates and cultivates by the 6th step, respectively with being derived from health The blood sample of different blood sugar concentrations in people and diabetic's body, respectively 6.0mM, 8.3mM, 13.6mM, 18.4mM.Drop It is added on blood sugar test paper item, after blood sugar concentration detector obtains blood glucose concentration value, generates blood sugar concentration data；Pass through blood glucose level data Blood glucose level data processing unit in automatic control system is from blood sugar concentration extracting data blood glucose concentration value, according to blood glucose concentration value The electric current of corresponding voltage is exported to wireless power supply module；Wireless power supply module exports corresponding hair according to the voltage value of institute's input current Penetrate the sine wave signal of power；Optical module includes the induction receiving coil being arranged in series, capacitance, far-red light LED and contains work The transplantation carrier of journey cell；It is far red to adjust optical module to incude generation induced current after receiving coil receives sine wave signal The light emission luminance of light LED induces the above-mentioned engineering cell in hydrogel to generate different GLP-1-Fc expression quantity.
7th step, examining report gene.The cell culture supernatant of each group is taken to measure GLP-1-Fc after cultivating 48h respectively Expression quantity (specific method reference material and method).
For example, the blood sample that blood sugar concentration is 6.0mM is added drop-wise on blood sugar test paper item, this concentration exists<The threshold of 6.1mM It is worth in range, the brightness of corresponding far-red light LED is 0mW/cm2, thus measure GLP-1-Fc expression quantity in 24 orifice plate supernatants About 40pM；The blood sample that blood sugar concentration is 8.3mM is added drop-wise on blood sugar test paper item, threshold of this concentration in 6.1-11.1mM It is worth in range, the brightness of corresponding far-red light LED is 0.2mW/cm2, thus measure GLP-1-Fc in 24 orifice plate supernatants and express Amount is about 200pM；The blood sample that blood sugar concentration is 13.6mM is added drop-wise on blood sugar test paper item, this concentration is in 11.1- In the threshold range of 16.8mM, the brightness of corresponding far-red light LED is 1.0mW/cm2, thus measure in 24 orifice plate supernatants GLP-1-Fc is about 400pM；The blood sample that blood sugar concentration is 18.4mM is added drop-wise on blood sugar test paper item, this concentration exists> In the threshold range of 16.8mM, the brightness of corresponding far-red light LED is 5.0mW/cm2, thus measure in 24 orifice plate supernatants GLP-1-Fc is about 570pM.
The results show that the blood glucose level data automatic control system in diabetes very-long-range intelligence diagnosis and therapy system can be according to input Different blood sugar concentration threshold values blood sample (being derived from Healthy People and diabetic) output corresponding voltage electric current to wirelessly Power supply module, the induction receiving coil of optical module receive that generate induced current after sine wave signal far red to adjust optical module The light emission luminance of light LED induces the above-mentioned engineering cell in hydrogel to generate different GLP-1-Fc expression quantity.The present embodiment with GLP-1-Fc is reporter gene, demonstrates the function of the diabetes very-long-range intelligence diagnosis and therapy system in vitro.Experimental data refers to Figure of description 13.
It is super to verify diabetes using SEAP as reporter gene in wild-type mice and diabetes B Mice Body for embodiment 5 Long-distance intelligent diagnosis and therapy system is directed to the digitlization of different blood sugar concentrations self feedback function
For this example using SEAP as reporter gene, citing proves that the controllable implantation of the different blood sugar concentrations of different mouse itself is each The different brightness of optical module far-red light LED in Mice Body, to induce different SEAP expression quantity, but not to the present invention's Protection domain is limited.It is as follows：
The first step, making (the specific implementation mode materials and methods as detailed above of diabetes very-long-range intelligence diagnosis and therapy system And embodiment 1).
Second step, plasmid construction.Plasmid construction in this example refers to table 1.
Third walks, inoculating cell.Will the good HEK-293 cells of growth conditions with 0.25% pancreatin digestion after kind in In 10cm Tissue Culture Dish, per ware kind 4 × 106A cell, and add DMEM culture mediums of the 10mL containing 10%FBS.
4th step, transfection.It is arrived in for 24 hours in inoculating cell 16,4 μ g pWS46,4 μ gpGY32,4 μ g p XY34, PEI is turned The DMEM mixings of transfection reagent and serum-free drop evenly after being stored at room temperature 15min in 10cm Tissue Culture Dish.Wherein per ware Preparation total volume is 2mL, and plasmid is 1 with PEI mass ratioes:3.Transfect 6h after change DMEM culture mediums of the 10mL containing 10%FBS into Row culture.
5th step, the preparation (specific method reference material and method) of hydrogel far-red light LED.
Hydrogel far-red light LED obtained above is implanted into the abdomen of wild-type mice and diabetes B mouse by the 6th step In chamber, tail vein is carried out to above-mentioned mouse respectively and takes blood, is respectively 5.9mM, 9.4mM, 14.2mM by the blood sample of acquirement, 17.2mM.It is added dropwise on blood sugar test paper item, after blood sugar concentration detector obtains blood glucose concentration value, generates blood sugar concentration data；It is logical Blood glucose level data processing unit in blood glucose level data automatic control system is crossed from blood sugar concentration extracting data blood glucose concentration value, according to Blood glucose concentration value exports the electric current of corresponding voltage to wireless power supply module；Wireless power supply module is according to the voltage value of institute's input current The sine wave signal of the corresponding transmission power of output；Optical module includes induction receiving coil, capacitance, the far-red light being arranged in series LED and contain engineering cell transplantation carrier；Incude after receiving coil receives sine wave signal and generates induced current to adjust The light emission luminance of optical module far-red light LED induces the above-mentioned engineering cell in hydrogel to generate different SEAP expression quantity.The Seven steps, examining report gene.Diabetes very-long-range intelligence diagnosis and therapy system self feedback system operation 48h after, to mouse into Row eyeball endocanthion takes blood, measures the expression quantity (specific method reference material and method) of SEAP in mouse blood.
For example, the blood sample that blood sugar concentration is 5.9mM is added drop-wise on blood sugar test paper item, this concentration exists<The threshold of 6.1mM It is worth in range, the brightness of corresponding far-red light LED is 0mW/cm2, thus measure SEAP expression quantity in 24 orifice plate supernatants and be about 10mU/L；The blood sample that blood sugar concentration is 9.4mM is added drop-wise on blood sugar test paper item, threshold value of this concentration in 6.1-11.1mM In range, the brightness of corresponding far-red light LED is 0.2mW/cm2, thus measure SEAP expression quantity in 24 orifice plate supernatants and be about 100mU/L；The blood sample that blood sugar concentration is 14.2mM is added drop-wise on blood sugar test paper item, this concentration is 11.1-16.8mM's In threshold range, the brightness of corresponding far-red light LED is 1.0mW/cm2, thus measure SEAP in 24 orifice plate supernatants and be about 200mU/L；The blood sample that blood sugar concentration is 17.2mM is added drop-wise on blood sugar test paper item, this concentration exists>16.8mM threshold value In range, the brightness of corresponding far-red light LED is 5.0mW/cm2, thus it is about 300mU/ to measure SEAP in 24 orifice plate supernatants L。
The results show that the blood glucose level data automatic control system in diabetes very-long-range intelligence diagnosis and therapy system can be according to input Different blood sugar concentration threshold values blood sample (being derived from wild-type mice and diabetes B mouse) output corresponding voltage electric current To wireless power supply module, the induction receiving coil of optical module generates induced current to adjust optical mode after receiving sine wave signal The light emission luminance of block far-red light LED induces the above-mentioned engineering cell in hydrogel to generate different SEAP expression quantity.The present embodiment Using SEAP as reporter gene, the function of the diabetes very-long-range intelligence diagnosis and therapy system is demonstrated in diabetes B Mice Body.It is real It tests data and refers to Figure of description 14.
Embodiment 6 verifies diabetes very-long-range intelligence diagnosis and therapy system for diabetes B in diabetes B Mice Body Diagnosing and treating function
For the present embodiment by taking diabetes B mouse as an example, citing proves diabetes very-long-range intelligence diagnosis and therapy system for glycosuria The diagnosing and treating function of disease, but protection scope of the present invention is not limited.It is as follows：
The first step, making (the specific implementation mode materials and methods as detailed above of diabetes very-long-range intelligence diagnosis and therapy system And embodiment 1).
Second step, plasmid construction.Plasmid construction in this example refers to table 1.
Third walks, inoculating cell.Will the good HEK-293 cells of growth conditions with 0.25% pancreatin digestion after kind in In 10cm Tissue Culture Dish, per ware kind 4 × 106A cell, and add DMEM culture mediums of the 10mL containing 10%FBS.
4th step, transfection.It is arrived in for 24 hours in inoculating cell 16,4 μ g pWS46,4 μ gpGY32,4 μ g pWS212, PEI is turned The DMEM mixings of transfection reagent and serum-free drop evenly after being stored at room temperature 15min in 10cm Tissue Culture Dish.Wherein per ware Preparation total volume is 2mL, and plasmid is 1 with PEI mass ratioes:3.Transfect 6h after change DMEM culture mediums of the 10mL containing 10%FBS into Row culture.
5th step, the preparation (specific method reference material and method) of hydrogel far-red light LED.
6th step, experiment in vivo process and experimental result measure.Hydrogel far-red light LED obtained above is implanted into In the abdominal cavity of the wild-type mice of fasting 8h and diabetes B mouse (5, number is 1,2,3,4,5 respectively), after transplanting 1h (will be denoted as at this time the 0th hour) carries out tail vein to above-mentioned mouse respectively and eyeball endocanthion takes blood, with eyeball endocanthion blood sampling product The amount for surveying GLP-1-Fc in mouse blood, the blood sample drops obtained from tail vein are added on blood sugar test paper item, blood sugar concentration inspection After surveying instrument acquisition blood glucose concentration value, blood sugar concentration data are generated；At the blood glucose level data in blood glucose level data automatic control system Unit is managed from blood sugar concentration extracting data blood glucose concentration value, the electric current that corresponding voltage is exported according to blood glucose concentration value is supplied to wireless Electric module；Wireless power supply module exports the sine wave signal of corresponding transmission power according to the voltage value of institute's input current；Optical mode Block includes induction receiving coil, capacitance, far-red light LED and the transplantation carrier containing engineering cell being arranged in series；Induction connects Take-up circle generates induced current to adjust the light emission luminance of optical module far-red light LED after receiving sine wave signal, induces water-setting Above-mentioned engineering cell in glue generates different GLP-1-Fc expression quantity, and records the brightness of far-red light LED, through far-red light LED After irradiating 4h, stop illumination up to the 16th hour, then fasting 8h, is the 24th hour at the end of fasting, at this time again respectively to above-mentioned Mouse carries out tail vein and eyeball endocanthion takes blood, and the amount of GLP-1-Fc in mouse blood is surveyed with eyeball endocanthion blood sampling product, will be from tail The blood sample drops that vein obtains are added on blood sugar test paper item, by the operation of diabetes very-long-range intelligence diagnosis and therapy system by data It is transmitted to optical module and exports corresponding far-red light LED luminance (concrete principle is same as above, and is not repeated herein), and record far-red light The brightness of LED stops illumination up to the 40th hour, then fasting 8h after far-red light LED illumination 4h, is the 48th at the end of fasting Hour, tail vein is carried out to above-mentioned mouse respectively again at this time and eyeball endocanthion takes blood, mouse is surveyed with eyeball endocanthion blood sampling product The amount of GLP-1-Fc in blood, the blood sample drops obtained from tail vein are added on blood sugar test paper item, pass through diabetes very-long-range The operation of intelligent diagnosis and therapy system send data to optical module export corresponding far-red light LED luminance (concrete principle is same as above, this Place is not repeated), and the brightness of far-red light LED is recorded, after far-red light LED illumination 4h, stop illumination up to the 53rd hour, then Fasting 8h is the 72nd hour at the end of fasting, surveys the amount of GLP-1-Fc in the 72nd hour blood glucose value and blood again at this time.It measures small The expression quantity (specific method reference material and method) of GLP-1-Fc in mouse blood.
In this experiment, 3 groups of data are recorded simultaneously, be the time respectively, blood sugar concentration of the mouse in each period, and Pass through the brightness for the different far-red light LED that diabetes very-long-range intelligence diagnosis and therapy system inspires.For example, in 0h, 1,2,3, No. 4 The blood sugar concentration of mouse is in 18mM or more, by the diabetes very-long-range intelligence diagnosis and therapy system, the far-red light LED's inspired Brightness is 5.0mW/cm2, No. 5 blood sugar concentrations are 15mM, and by the diabetes very-long-range intelligence diagnosis and therapy system, what is inspired is remote red The brightness of light LED is 1.0mW/cm2, and then produce different degrees of blood sugar decreasing effect.Blood sugar concentration, Isosorbide-5-Nitrae blood are detected for 24 hours Sugared concentration is reduced to 14mM or so, and by the diabetes very-long-range intelligence diagnosis and therapy system, the brightness of the far-red light LED inspired is 1.0mW/cm2, No. 3 blood sugar concentrations are reduced to 10.5mM or so, by the diabetes very-long-range intelligence diagnosis and therapy system, inspire The brightness of far-red light LED is 0.2mW/cm2, 2, No. 5 blood sugar concentrations are reduced to 18mM or so, pass through diabetes very-long-range intelligence The brightness of diagnosis and therapy system, the far-red light LED inspired is 5.0mW/cm2.48h detects blood sugar concentration, 1,3, No. 5 blood sugar concentration drop To 8.5mM or so, by the diabetes very-long-range intelligence diagnosis and therapy system, the brightness of the far-red light LED inspired is 0.2mW/ cm2, 2, No. 4 blood sugar concentrations are down to 14mM or so, by the diabetes very-long-range intelligence diagnosis and therapy system, the far-red light inspired The brightness of LED is 1mW/cm2.72h detects blood sugar concentration, and 1,3,4, No. 5 blood sugar concentration is down to 8.5mM or so, passes through the glycosuria The brightness of sick very-long-range intelligence diagnosis and therapy system, the far-red light LED inspired is 0.2mW/cm2, it is left that No. 2 blood sugar concentrations are down to 13mM The right side, by the diabetes very-long-range intelligence diagnosis and therapy system, the brightness of the far-red light LED inspired is 1mW/cm2.It measures for 24 hours, The expression quantity average value of GLP-1-Fc is respectively 45pM, 65pM, 65pM or so in 48h, 72h mouse blood.Control group blood glucose is normal Far-red light LED in Mice Body is then closed always, and the expression quantity of GLP-1-Fc is in reduced levels always in blood, about 12pM or so.
The results show that the blood glucose level data automatic control system in diabetes very-long-range intelligence diagnosis and therapy system can be according to 2 types sugar The electric current of the blood glucose level output corresponding voltage of the sick mouse itself of urine is to wireless power supply module, the induction receiving coil of optical module Induced current is generated to adjust the light emission luminance of optical module far-red light LED after receiving sine wave signal, is induced in hydrogel Above-mentioned engineering cell generates different GLP-1-Fc expression quantity to reduce the blood sugar concentration in diabetes B Mice Body, and compares Group is compared, and pole significant difference is shown, and hyperglycemic symptoms are obviously eased, and blood sugar concentration is down to normal level substantially.This reality Example is applied using hypoglycemic drug GLP-1-Fc as reporter gene, the optical module of diabetes very-long-range intelligence diagnosis and therapy system is transplanted to In diabetes B Mice Body, the diagnosis of the diabetes very-long-range intelligence diagnosis and therapy system is demonstrated in diabetes B Mice Body With treatment function, that is, after measuring blood glucose, system can precisely adjust glucagon-like peptide (GLP-1- according to its blood glucose level Fc expression quantity), is targetedly treated, and is avoided the hypoglycemic of traditional blood sugar reducing method generation and is excessively brought bad Consequence, to achieve the purpose that automation, precision, individualized treatment diabetes.Self diagnosis by this system and treatment The blood glucose of function, diabetes B mouse returns normal level substantially.Experimental data refers to Figure of description 15,16,17.
Table 1, plasmid construction table
The protection content of the present invention is not limited to above example.Without departing from the spirit and scope of the invention, originally Field technology personnel it is conceivable that variation and advantage be all included in the present invention, and with appended claims be protect Protect range.
<110>The Suzhou bio tech ltd Xin Sai
<120>Diabetes very-long-range intelligence diagnosis and therapy system and its application in treating diabetes
<160> 12
<210> 1
<211> 41
<212> DNA
<213>Artificial sequence
<400> 1
AGTGCCACCTGACGTCCGATCCAGACATGATAAGATACATT
<210> 2
<211> 35
<212> DNA
<213>Artificial sequence
<400> 2
GAGCGTAGCGTGAGGTTTAAAAAACCTCCCACACC
<210> 3
<211> 52
<212> DNA
<213>Artificial sequence
<400> 3
GGAGGCCTAGGCTTTTGCAAAAAGCTTGCCACCATGGCTAGAGGCTGCCTCA
<210> 4
<211> 53
<212> DNA
<213>Artificial sequence
<400> 4
GAAGCGGCCGGCCGCCCCGACTCTAGAGTGGTGATGGTGGTGGTGGTACTCGG
<210> 5
<211> 51
<212> DNA
<213>Artificial sequence
<400> 5
GATAGTGCTGGTAGTGCTGGTAGTGCTGGTGGCTCCGGGCGCGCCGACGCG
<210> 6
<211> 47
<212> DNA
<213>Artificial sequence
<400> 6
GATCCGAGCTCGGTACCAAGCTTTTAGTTTTCCTCGTGAGCCACAGC
<210> 7
<211> 48
<212> DNA
<213>Artificial sequence
<400> 7
CTTAAGCTTGGTACCGCCACCATGCCTTCAGGGCAGATCAGCAACCAG
<210> 8
<211> 51
<212> DNA
<213>Artificial sequence
<400> 8
ACCAGCACTACCAGACTACCAGCACTATCCAGTGACTGGGGTGGTCCTGGG
<210> 9
<211> 44
<212> DNA
<213>Artificial sequence
<400> 9
CGGAATTCGCCACCATGAAGATCATCCTGTGGCTGTGTGTGTTC
<210> 10
<211> 42
<212> DNA
<213>Artificial sequence
<400> 10
CCCAAGCTTTTATTTACCAGGAGAGTGGGAGAGGCTCTTCTC
<210> 11
<211> 47
<212> DNA
<213>Artificial sequence
<400> 11
CGGAATTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGG
<210> 12
<211> 40
<212> DNA
<213>Artificial sequence
<400> 12
CCCAAGCTTTTAGTTGCAGTAGTTCTCCAGTTGGTAGAGG

Claims (12)

1. a kind of diabetes very-long-range intelligence diagnosis and therapy system, which is characterized in that the equipment includes：Blood glucose level data, which automatically controls, is System,
Blood glucose level data tele-control system, wireless power supply module, optical module；
The blood glucose level data automatic control system includes blood sugar concentration detector and blood glucose level data processing unit；The blood glucose level data After automatic control system obtains blood glucose concentration value by the blood sugar concentration detector, blood sugar concentration data are generated；The blood glucose Data processing unit exports the electricity of corresponding voltage according to blood glucose concentration value from the blood sugar concentration extracting data blood glucose concentration value Flow to the wireless power supply module；
The blood glucose level data tele-control system includes the mobile device and Intelligence Remote Controller for being equipped with application terminal；It is described Mobile device sends to the Intelligence Remote Controller and instructs, the Intelligence Remote Controller and the blood glucose level data processing unit Communication, electric current of the blood glucose level data processing unit according to instruction output corresponding voltage；
The wireless power supply module exports the sine wave signal of corresponding transmission power according to the voltage value of institute's input current；
The optical module includes that the induction receiving coil being arranged in series, capacitance, LED and the transplanting containing engineering cell carry Body；
The induction receiving coil generates induced current to adjust the light emission luminance of the LED after receiving sine wave signal, induces Engineering cell in the transplantation carrier generates different amounts of hypoglycemic drug.
2. diabetes very-long-range intelligence diagnosis and therapy system as described in claim 1, which is characterized in that the blood sugar concentration tester Including：
Blood sugar test paper item, blood sugar concentration sensor assembly, Bluetooth of mobile phone wireless transport module and its client software.
3. diabetes very-long-range intelligence diagnosis and therapy system as described in claim 1, which is characterized in that the blood glucose level data processing is single Member judges blood glucose range, according to the blood sugar concentration threshold value of setting divide control in relay unit it is different after Electric switch regulates and controls the output voltage of the system switching power supply to export corresponding electric current to the wireless power by relay Module.
4. diabetes very-long-range intelligence diagnosis and therapy system as described in claim 1, which is characterized in that the blood glucose level data is controlled automatically System processed is further provided with DC power supply power supply module；For showing that blood glucose concentration value, output voltage values, optical module LED are bright Angle value LCD MODULE；Switching Power Supply；Wireless power supply module.
5. diabetes very-long-range intelligence diagnosis and therapy system as described in claim 1, which is characterized in that the blood sugar concentration detector By Bluetooth wireless transmission by blood sugar concentration data transmission to blood glucose level data processing unit.
6. diabetes very-long-range intelligence diagnosis and therapy system as described in claim 1, which is characterized in that the blood glucose level data is remotely controlled There is the mobile device in system processed wireless receiving module, the mobile device to obtain blood sugar concentration data and utilize application Terminal reads blood glucose concentration value；Pass through wireless signal telecommunication between the Intelligence Remote Controller and the mobile device.
7. diabetes very-long-range intelligence diagnosis and therapy system as described in claim 1, which is characterized in that the blood glucose level data is remotely controlled System processed is further provided with microcontroller；Relay driving module；Relay group；Power supply adaptor and Switching Power Supply.
8. diabetes very-long-range intelligence diagnosis and therapy system as described in claim 1, which is characterized in that the wireless power supply module into One step is equipped with low pressure difference linearity voltage stabilizing chip, electromagnetic viscosimeter circuit, power amplification circuit and launching circuit.
9. diabetes very-long-range intelligence diagnosis and therapy system as described in claim 1, which is characterized in that the LED emits light and includes Purple light, blue and green light, feux rouges, near infrared light and far-red light.
10. diabetes very-long-range intelligence diagnosis and therapy system as described in claim 1, which is characterized in that the transplantation carrier contains It is engineered cell, the cell of the engineering is the customization cell of light induction regulating controlling gene expression, including a variety of protokaryons are thin Born of the same parents and eukaryocyte.
11. diabetes very-long-range intelligence diagnosis and therapy system as described in claim 1, which is characterized in that the shape of the transplantation carrier Formula includes hydrogel, semi-permeable membrane bag filter, hollow fiber conduit, microcapsules.
12. a kind of application of diabetes very-long-range intelligence diagnosis and therapy system in treating diabetes.
CN201710266870.7A 2017-04-21 2017-04-21 Diabetes very-long-range intelligence diagnosis and therapy system and its application in treating diabetes Pending CN108720848A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201710266870.7A CN108720848A (en) 2017-04-21 2017-04-21 Diabetes very-long-range intelligence diagnosis and therapy system and its application in treating diabetes
PCT/CN2017/100448 WO2018192156A1 (en) 2017-04-21 2017-09-05 Ultra-remote intelligent diagnosis and treatment system for diabetes

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710266870.7A CN108720848A (en) 2017-04-21 2017-04-21 Diabetes very-long-range intelligence diagnosis and therapy system and its application in treating diabetes

Publications (1)

Publication Number Publication Date
CN108720848A true CN108720848A (en) 2018-11-02

Family

ID=63933571

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710266870.7A Pending CN108720848A (en) 2017-04-21 2017-04-21 Diabetes very-long-range intelligence diagnosis and therapy system and its application in treating diabetes

Country Status (1)

Country Link
CN (1) CN108720848A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111726914A (en) * 2020-06-05 2020-09-29 华东师范大学 Far-red light intelligent regulation and control system
CN112690786A (en) * 2020-12-28 2021-04-23 复旦大学附属中山医院 Sugar tolerance test system and method thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102836481A (en) * 2012-09-29 2012-12-26 哈尔滨工业大学 Novel insulin pump

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102836481A (en) * 2012-09-29 2012-12-26 哈尔滨工业大学 Novel insulin pump

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
HAIFENG YE等: "A Synthetic Optogenetic Transcription Device Enhances Blood-Glucose Homeostasis in Mice", 《SCIENCE》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111726914A (en) * 2020-06-05 2020-09-29 华东师范大学 Far-red light intelligent regulation and control system
CN112690786A (en) * 2020-12-28 2021-04-23 复旦大学附属中山医院 Sugar tolerance test system and method thereof

Similar Documents

Publication Publication Date Title
Shao et al. Smartphone-controlled optogenetically engineered cells enable semiautomatic glucose homeostasis in diabetic mice
Folcher et al. Mind-controlled transgene expression by a wireless-powered optogenetic designer cell implant
EP2004241A2 (en) Implantable sensor
WO2002072004A3 (en) Implantable artificial organ and physiological monitoring system
CN108720848A (en) Diabetes very-long-range intelligence diagnosis and therapy system and its application in treating diabetes
Ye et al. Optogenetic medicine: synthetic therapeutic solutions precision-guided by light
CN103403148A (en) Production of dentin, cementum and enamel by cells
CN107174655A (en) A kind of application of far-red light gene loop expression control system in treatment diabetes
CN109988746A (en) A kind of mescenchymal stem cell adipogenic induction differentiation method
Khalifa et al. Injectable wireless microdevices: challenges and opportunities
CN110468153A (en) A kind of subgenomic transcription device, construction method and application based on CRISPR/Cas9 system of far-red light regulation
CN107177499A (en) A kind of gene loop remote control and regulation system
US20070104694A1 (en) Breast stimulation and augmentation system
CN101237904B (en) Methods for modulating chondrocyte proliferation using pulsing electromagnetic fields
Liu et al. Wireless passive stimulation of engineered cardiac tissues
CN101003792A (en) Constructing 9LLUC cell strain of expressing luciferase stably, and application
KR102157896B1 (en) Cell cultivation device capable of identifying cell cultivation state using transmittance of light and cell cultivation monitoring and control system
Renaud et al. Biosensors in Diabetes: How to get the most out of evolution and transpose it into a signal
CN101266242A (en) Probe and method for detecting membrane of glucose transporter 4
KR102191186B1 (en) Cell cultivation device capable of identifying cell cultivation state using transmittance of light and cell cultivation monitoring and control system
CN107177498A (en) A kind of application of the gene cyclic system of remote control and regulation in treatment diabetes
WO2022226146A1 (en) Hybrid bioelectronic/engineered cell implantable system for therapeutic agents delivery and applications thereof
CN108766506A (en) A kind of multipotential stem cell diagnosis and therapy system
WO2018192156A1 (en) Ultra-remote intelligent diagnosis and treatment system for diabetes
Differding Biotechnology in India: An Analysis of ‘Biotechnology Industry Research Assistance Council’(BIRAC)‐Supported Projects

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20181102