CN108707694A - A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus - Google Patents
A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus Download PDFInfo
- Publication number
- CN108707694A CN108707694A CN201810392927.2A CN201810392927A CN108707694A CN 108707694 A CN108707694 A CN 108707694A CN 201810392927 A CN201810392927 A CN 201810392927A CN 108707694 A CN108707694 A CN 108707694A
- Authority
- CN
- China
- Prior art keywords
- raa
- ranaspinosa david
- diagnostic techniques
- nucleic acid
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of RAA diagnostic techniques methods of Ranaspinosa David irido virus, under constant temperature, recA recombinases from Escherichia coli can be combined closely with primed DNA, form the condensate of enzyme and primer, when primer searches the sequence of complete complementary therewith on template DNA, with the help of single-stranded DNA binding protein, the duplex structure of template DNA is opened, and under the action of archaeal dna polymerase, new DNA complementary strands are formed.Diagnostic techniques method is expanded without PCR instrument, it need to only ensure the reaction condition of constant temperature, detecting the presence of amplified band by nucleic acid electrophoresis, either the method for artificial observation amplified production turbidity or amplified production chemiluminescence detection carries out interpretation of result, this detection method is easy to operate, detection speed is fast, accuracy of detection is high, disclosure satisfy that the demand in market.
Description
Technical field
The present invention relates to irido virus diagnostic fields, more particularly, to a kind of diagnostic techniques sides RAA of Ranaspinosa David irido virus
Method.
Technical background
Ranaspinosa David also known as the stone frog, chukar belong to vertebrate, Amphibia, Anura, Ranidae, Rana, have higher medicinal
Value and edible value, it is deep to be liked by everybody.Ranaspinosa David fine and tender taste is pure white, and taste is sweet and refreshing, full of nutrition, be classified as hotel,
The mountain delicacy famous dish that wineshop is recommended also is the rare rare delicacies of people.And with nourishing and fit keeping function, heart clearing, lung moistening, strong liver stomach, qi-restoratives
Damage and relieving heat toxin control infantile malnutrition due to digestive disturbances or intestinalparasites disease and other effects, therefore have the title of " mountain delicacy ".It is increasingly deficient with wild resource, Ranaspinosa David it is artificial
Cultivation is developed faster in recent years.But since Ranaspinosa David cultivation history is short, artificial breeding and disease prevention techniques are still located
In the stage of fumbling.
The irido virus found earliest is that Xeros in 1954 is separated in Britain Camb out of marsh daddy-longlegs body, after
It is divided into and does not isolate a variety of irido virus from scarab beetle, aedes taeniorhynchus and the frog and fish, since irido virus is in the insect of infection
In larva body or in the viral particles of purifying concentration, virion is in the abnormal proper alignment of periodic intervals, is formed brilliant
Lattice plane simultaneously overlaps each other, and blue or purple iris are presented when there is oblique ray irradiation.Irido virus be one group from insect and
The big DNA virus of cytoplasm being separated in alternating temperature vertebrate host, to the water including fish, amphibian animal and reptile
Lively object has extensive infectivity, is one of the arch-criminal for causing the viral epidemic disease outburst of culture fishery.This viroid is flowed
Row is fast, easily causes the burst of cultivated animals dead, lethality up to 30~100%, to the world various regions are light, seawater is supported
It grows industry and causes serious financial consequences.Ranaspinosa David irido virus（QSIV）Be endanger Ranaspinosa David large-scale cultivation Major Diseases it
One.
Invention content
The purpose of the present invention is to provide a kind of RAA diagnostic techniques method of Ranaspinosa David irido virus, the operations of this detection method
Simply, detection speed is fast, accuracy of detection is high, and can carry out analysis judgement to testing result with a variety of methods, while with freezing
Liquid preserves the biological organization of Ranaspinosa David, is conducive to the duration of irido virus in Ranaspinosa David, repeatability detection.
The present invention is directed to the problem of being mentioned in background technology, and the technical solution taken is：
A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus, including：It extracts viral nucleic acid, design primer, prepare amplification body
System is incubated, analysis, specifically includes following steps：
Extract viral nucleic acid：It takes Ranaspinosa David liver, brain tissue to be placed in preserve in liquid, then in -80~-85 DEG C of freezings；By spine chest
Frog liver, brain tissue according to Full automatic instrument for extracting nucleic acid and kit requirement extract viral DNA after thawing, freeze in-
It is 70~-80 DEG C, spare as template；The biological organizations such as liver, the brain tissue for preserving Ranaspinosa David with freezing liquid, not only contribute to
The duration of irido virus, repeatability detection in Ranaspinosa David, and freezing liquid can preferably preserve the liver of Ranaspinosa David, brain group
It knits, effectively prevent liver, liquefaction of brain tissue, self-dissolving, efficiently preserve its biological function；
Design primer：The primer suitable length of RAA nucleic acid amplification technologies is 28~35bp, and 4 pairs of primers of design are as shown in table 1；
Primer used in table 1.RAA nucleic acid amplification technologies
Prepare amplification system：According to RAA nucleic acid amplification detection kits（The Hangzhou bio tech ltd Zhong Ce produces, and provides A
Buffer, B Buffer, recombinase dry powder pipe）Illustrate to prepare amplification system：
A buffer 44.5μL
Primers F（10μm） 1μL
Primer R（10μm） 1μL
1 μ L of DNA profiling
Whirlpool mixes and centrifuges above-mentioned solution after supplement, and above-mentioned mixed solution is added to the 50 μ L dry powder pipes for being preinstalled with recombinase
In, it adds 2.5 μ L B Buffer and is sufficiently mixed, turn upside down reaction tube 8~10 times, then 1~2min of low-speed centrifugal；
It is incubated：Above-mentioned reaction tube is put into Rotor Gene Real-time PCR instruments, 28 are incubated under the conditions of 37~39 DEG C
~30min；
Analysis：After reaction, with weight ratio 24~25:25 phenol, chloroform mixture extractive reaction liquid, then in 10000
~12000rpm centrifuges 3~5min, takes supernatant to carry out electrophoresis detection and analysis result, or pass through artificial observation amplified production
The method of turbidity or amplified production chemiluminescence detection carries out interpretation of result；The recombinase-mediated of constant temperature fast-amplifying nucleic acid expands
Increasing technology, under constant temperature, the recA recombinases from Escherichia coli can be combined closely with primed DNA, form enzyme and primer
Condensate, when primer searches the sequence of complete complementary therewith on template DNA, in the help of single-stranded DNA binding protein
Under, the duplex structure of template DNA is opened, and under the action of archaeal dna polymerase, form new DNA complementary strands, reaction is not necessarily to PCR
Instrument is expanded, and need to only ensure the reaction condition of constant temperature, amplified band, artificial observation are detected the presence of by nucleic acid electrophoresis
It is noninductive that the method for amplified production turbidity or amplified production chemiluminescence detection progress interpretation of result can detect that template DNA has
Irido virus is contaminated, this detection method is easy to operate, detection speed is fast, accuracy of detection is high, disclosure satisfy that the demand in market.
Preferably, the substance and its content that preserve in liquid are：1.5~1.8g/L of dimethyl sulfoxide (DMSO), acetamide 1.6~
1~2g/L of 1.8g/L, 1,2- propylene glycol, 0.4~0.5g/L of PEG-800,0.15~0.2g/L of nasmil, reproducibility paddy Guang
Sweet 0.02~0.025g/L of peptide, 5~6g/L of lecithin, 4~5g/L of benzoate, 10~12.5g/L of sodium nitrate, glycerine 14~
16g/L, 120~150IU/mL of penicillin, 100~110IU/mL of streptomysin, with phosphate buffer adjustment pH for 7.1~7.3,
Surplus is distilled water；To preserve the liver of liquid freezen protective Ranaspinosa David, brain tissue, it can be achieved that efficient freezen protective liver, brain
Tissue, effectively prevent liver, liquefaction of brain tissue, self-dissolving, biological characteristics performance efficiently to be preserved, the tissue solution of freezen protective
It can be directly used for fabric analysis after jelly, contribute to high efficiency, the integrality extraction of DNA.
Preferably, 5- (4- hydroxyphenyls) glycolylureas in phenol, chloroform mixture containing 0.05~0.051mM and 0.02~
R- (+)-amphetamine of 0.022mM；5- (4- hydroxyphenyls) glycolylureas of special proportioning and R- (+)-amphetamine
With synergistic effect, the two cooperation can be with the Mg in chelatropic reaction liquid2+、Fe2+Equal metal ions, it is anti-so as to effectively reduce
Answer Mg in liquid2+、Fe2+The content of equal metal ions prevents when electrophoresis metal ion in turn result in DNA enzymatic activation and is broken to DNA
It is bad, in addition, reducing Mg2+、Fe2+The content of equal metal ions can also prevent metal ion from generating precipitation with nucleic acid, to effectively protect
The nucleic acid quality and content in reaction solution are demonstrate,proved, nucleic acid electrophoresis, visual turbidity or anti-when amplified production chemiluminescence detection are improved
Sensitivity and specificity are answered, the precise degrees of Ranaspinosa David irido virus RAA diagnostic techniques are improved.
Compared with the prior art, the advantages of the present invention are as follows：
1）To preserve the liver of liquid freezen protective Ranaspinosa David, brain tissue, it can be achieved that efficient freezen protective liver, brain tissue, have
Effect prevents liver, liquefaction of brain tissue, self-dissolving, biological characteristics performance from efficiently being preserved, can after the tissue defrosting of freezen protective
It is directly used in fabric analysis, contributes to high efficiency, the integrality extraction of DNA；
2）5- (4- hydroxyphenyls) glycolylureas of special proportioning have synergistic effect with R- (+)-amphetamine, and the two cooperation can
Effectively to reduce Mg in reaction solution2+、Fe2+The content of equal metal ions, metal ion was to DNA enzymatic when can both prevent electrophoresis
Activation, and can prevent metal ion from being generated with nucleic acid and precipitate, to effectively improve the essence of Ranaspinosa David irido virus RAA diagnostic techniques
Quasi- degree；
3）Under constant temperature, the recA recombinases from Escherichia coli can be combined closely with primed DNA, form enzyme and primer
Condensate, when primer searches the sequence of complete complementary therewith on template DNA, with the help of single-stranded DNA binding protein,
The duplex structure of template DNA is opened, and under the action of archaeal dna polymerase, form new DNA complementary strands, reaction is not necessarily to PCR instrument
It is expanded, need to only ensure the reaction condition of constant temperature, amplified band is detected the presence of by nucleic acid electrophoresis, artificial observation expands
The progress interpretation of result of the method for product turbidity or amplified production chemiluminescence detection can detect that template DNA, and whether there is or not infection rainbows
Color virus, this detection method is easy to operate, detection speed is fast, accuracy of detection is high, disclosure satisfy that the demand in market.
Description of the drawings
Fig. 1 is the electrophoresis detection schematic diagram of the present invention.
Reference numeral：M is Marker, and 1 is negative control, and 2 be PCR amplification positive control；3,4 be primer QSIV1；5,6
For primer QSIV2；7,8 be primer QSIV3；9,10 be primer QSIV4.
Specific implementation mode
The present invention program is described further below by embodiment：
Embodiment 1：
A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus, including：It extracts viral nucleic acid, design primer, prepare amplification body
System is incubated, analysis, specifically includes following steps：
1）Extract viral nucleic acid：It takes Ranaspinosa David liver, brain tissue to be placed in preserve in liquid, then in -80 DEG C of freezings；By Ranaspinosa David liver
Viral DNA is extracted according to Full automatic instrument for extracting nucleic acid and kit requirement after dirty, brain tissue defrosting, is frozen in -70 DEG C,
It is spare as template；The biological organizations such as liver, the brain tissue for preserving Ranaspinosa David with freezing liquid, not only contribute to rainbow in Ranaspinosa David
The duration of color virus, repeatability detection, and freezing liquid can preferably preserve liver, the brain tissue of Ranaspinosa David, it is effectively anti-
Only liver, liquefaction of brain tissue, self-dissolving efficiently preserve its biological function；
2）Design primer：One of the nucleotide sequence of primer for detecting irido virus, the primer and irido virus
Point or its complementary strand thereof, and the one of irido virus nucleotide sequence can be specifically expanded under the action of archaeal dna polymerase
Part, design primer are：QSIV1-F：TCCATGTATGCCGTGTTAAAGGACTGG, QSIV1-R：
TTACATCCTCAACGCCTGGTTGGTGCTCAAG；
3）Prepare amplification system：According to RAA nucleic acid amplification detection kits（The Hangzhou bio tech ltd Zhong Ce produces, and carries
For A Buffer, B Buffer, recombinase dry powder pipe）Illustrate to prepare amplification system：44.5 μ L of A buffer, primers F（10μm）
1 μ L, primer R（10μm）1 μ L, 1 μ L of DNA templates, whirlpool mixes and centrifuges above-mentioned solution after supplement, and above-mentioned mixed solution is added
In the 50 μ L dry powder pipes for entering to be preinstalled with recombinase, adds 2.5 μ L B Buffer and be sufficiently mixed, turn upside down reaction tube 10
It is secondary, then low-speed centrifugal 1min；
4）It is incubated：Above-mentioned reaction tube is put into Rotor Gene Real-time PCR instruments, is incubated under the conditions of 37 DEG C
28min；
5）Analysis：After reaction, with weight ratio 24:25 phenol, chloroform mixture extractive reaction liquid, then in 10000rpm
5min is centrifuged, supernatant is taken to carry out nucleic acid electrophoresis detection and analysis result.
Substance and its content in preservation liquid are：Dimethyl sulfoxide (DMSO) 1.5g/L, acetamide 1.6g/L, 1,2- propylene glycol 1g/
L, PEG-800 0.4g/L, nasmil 0.15g/L, reductive glutathione 0.02g/L, lecithin 5g/L, benzoate 4g/
L, sodium nitrate 10g/L, glycerine 14g/L, penicillin 120IU/mL, streptomysin 100IU/mL adjust pH with phosphate buffer
It is 7.1, surplus is distilled water；To preserve the liver of liquid freezen protective Ranaspinosa David, brain tissue, it can be achieved that efficient freezen protective liver
Dirty, brain tissue effectively prevent liver, liquefaction of brain tissue, self-dissolving, biological characteristics performance efficiently to be preserved, freezen protective
Tissue can be directly used for fabric analysis after thawing, and contribute to high efficiency, the integrality extraction of DNA.
R- (+) -1- phenyl-of 5- (4- hydroxyphenyls) glycolylureas and 0.02mM in phenol, chloroform mixture containing 0.05mM
2- propylamine；5- (4- hydroxyphenyls) glycolylureas of special proportioning have synergistic effect with R- (+)-amphetamine, and the two cooperation can
With the Mg in chelatropic reaction liquid2+、Fe2+Equal metal ions, so as to effectively reduce Mg in reaction solution2+、Fe2+Equal metal ions
Content, prevent metal ion when electrophoresis from turn resulting in the destruction to DNA to DNA enzymatic activation, in addition, reducing Mg2+、Fe2+Equal gold
Belonging to the content of ion can also prevent from metal ion and nucleic acid from generating precipitating, the nucleic acid quality to be effectively ensured in reaction solution with contain
Amount improves reaction sensitivity and specificity when nucleic acid electrophoresis, visual turbidity or amplified production chemiluminescence detection, improves spine chest
The precise degrees of Basidiobolus spp RAA diagnostic techniques.
Embodiment 2：
A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus, including：It extracts viral nucleic acid, design primer, prepare amplification body
System is incubated, analysis, specifically includes following steps：
Extract viral nucleic acid：It takes Ranaspinosa David liver, brain tissue to be placed in preserve in liquid, then in -85 DEG C of freezings；By Ranaspinosa David liver
Viral DNA is extracted according to Full automatic instrument for extracting nucleic acid and kit requirement after dirty, brain tissue defrosting, is frozen in -80 DEG C,
It is spare as template；The biological organizations such as liver, the brain tissue for preserving Ranaspinosa David with freezing liquid, not only contribute to rainbow in Ranaspinosa David
The duration of color virus, repeatability detection, and freezing liquid can preferably preserve liver, the brain tissue of Ranaspinosa David, it is effectively anti-
Only liver, liquefaction of brain tissue, self-dissolving efficiently preserve its biological function；
Design primer：The primer suitable length of RAA nucleic acid amplification technologies is 28~35bp, and design primer is as follows：QSIV2-F：
CCGTGTTAAAGGACTGGGCGCTGATGTCG, QSIV2-R：GCAGCAGTTTTCGGTCGGCGTTCCCAGG；
Prepare amplification system：According to RAA nucleic acid amplification detection kits（The Hangzhou bio tech ltd Zhong Ce produces, and provides A
Buffer, B Buffer, recombinase dry powder pipe）Illustrate to prepare amplification system：
A buffer 44.5μL
Primers F（10μm） 1μL
Primer R（10μm） 1μL
1 μ L of DNA templates
Whirlpool mixes and centrifuges above-mentioned solution after supplement, and above-mentioned mixed solution is added to the 50 μ L dry powder pipes for being preinstalled with recombinase
In, it adds 2.5 μ L B Buffer and is sufficiently mixed, turn upside down reaction tube 8 times, then low-speed centrifugal 2min；
It is incubated：Above-mentioned reaction tube is put into Rotor Gene Real-time PCR instruments, 30min is incubated under the conditions of 38 DEG C；
Analysis：After reaction, with weight ratio 25:25 phenol, chloroform mixture extractive reaction liquid, then in 10000rpm from
Heart 5min takes supernatant to carry out electrophoresis detection and analysis result, or is produced by artificial observation amplified production turbidity or amplification
The method of object chemiluminescence detection carries out interpretation of result；The recombinase-mediated amplification technique of constant temperature fast-amplifying nucleic acid, in constant temperature
Under the conditions of, the recA recombinases from Escherichia coli can be combined closely with primed DNA, the condensate of enzyme and primer be formed, when drawing
Object is when searching the sequence of complete complementary therewith on template DNA, with the help of single-stranded DNA binding protein, open template DNA
Duplex structure form new DNA complementary strands and under the action of archaeal dna polymerase, reaction is expanded without PCR instrument,
The reaction condition that need to ensure constant temperature, detecting the presence of amplified band by nucleic acid electrophoresis, to can detect that template DNA has noninductive
Irido virus is contaminated, this detection method is easy to operate, detection speed is fast, accuracy of detection is high, disclosure satisfy that the demand in market.
Substance and its content in preservation liquid are：Dimethyl sulfoxide (DMSO) 1.8g/L, acetamide 1.8g/L, 1,2- propylene glycol 2g/
L, PEG-800 0.5g/L, nasmil 0.2g/L, reductive glutathione 0.025g/L, lecithin 6g/L, benzoate 5g/
L, sodium nitrate 12.5g/L, glycerine 16g/L, penicillin 150IU/mL, streptomysin 110IU/mL, are adjusted with phosphate buffer
PH is 7.3, and surplus is distilled water；To preserve the liver of liquid freezen protective Ranaspinosa David, brain tissue, it can be achieved that efficient freezen protective
Liver, brain tissue effectively prevent liver, liquefaction of brain tissue, self-dissolving, biological characteristics performance efficiently to be preserved, freezen protective
Tissue thaw after can be directly used for fabric analysis, contribute to DNA high efficiency, integrality extraction.
R- (+) -1- benzene of 5- (4- hydroxyphenyls) glycolylureas and 0.021mM in phenol, chloroform mixture containing 0.051mM
Base -2- propylamine；5- (4- hydroxyphenyls) glycolylureas of special proportioning have synergistic effect, the two association with R- (+)-amphetamine
Work can be with the Mg in chelatropic reaction liquid2+、Fe2+Equal metal ions, so as to effectively reduce Mg in reaction solution2+、Fe2+Equal metals
The content of ion prevents metal ion when electrophoresis from activating the destruction in turn resulted in DNA to DNA enzymatic, in addition, reducing Mg2+、Fe2+
The content of equal metal ions can also prevent metal ion from generating precipitation with nucleic acid, to which the nucleic acid quality in reaction solution be effectively ensured
With content, reaction sensitivity and specificity when nucleic acid electrophoresis, visual turbidity or amplified production chemiluminescence detection are improved, is improved
The precise degrees of Ranaspinosa David irido virus RAA diagnostic techniques.
Embodiment 3：
A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus, specifically includes following steps：
Extract viral nucleic acid：It takes Ranaspinosa David liver, brain tissue to be placed in preserve in liquid, then in -80 DEG C of freezings, preserves the object in liquid
Matter and its content are：Dimethyl sulfoxide (DMSO) 1.6g/L, acetamide 1.6g/L, 1,2- propylene glycol 1g/L, PEG-800 0.4g/L, color are sweet
Sour sodium 0.15g/L, reductive glutathione 0.02g/L, lecithin 5g/L, benzoate 4.5g/L, sodium nitrate 12g/L, the third three
Alcohol 15g/L, penicillin 140IU/mL, streptomysin 100IU/mL, with phosphate buffer adjustment pH for 7.2, surplus is distilled water；
Viral DNA is extracted according to Full automatic instrument for extracting nucleic acid and kit requirement after Ranaspinosa David liver, brain tissue are thawed, is frozen
- 80 DEG C are stored in, it is spare as template；
Design primer：The primer suitable length of RAA nucleic acid amplification technologies is 28~35bp, and design primer is as follows：QSIV3-F：
CTGGGCGCTGATGTCGTTGAATGAGAGAGTG, QSIV3-R：CGGCTTTCGGGCAGCAGTTTTCGGTCGGCG；
Prepare amplification system：According to RAA nucleic acid amplification detection kits（The Hangzhou bio tech ltd Zhong Ce produces, and provides A
Buffer, B Buffer, recombinase dry powder pipe）Illustrate to prepare amplification system：
A buffer 44.5μL
Primers F（10μm） 1μL
Primer R（10μm） 1μL
1 μ L of DNA templates
Whirlpool mixes and centrifuges above-mentioned solution after supplement, and above-mentioned mixed solution is added to the 50 μ L dry powder pipes for being preinstalled with recombinase
In, it adds 2.5 μ L B Buffer and is sufficiently mixed, turn upside down reaction tube 10 times, then low-speed centrifugal 2min；
It is incubated：Above-mentioned reaction tube is put into Rotor Gene Real-time PCR instruments, 30min is incubated under the conditions of 39 DEG C；
Analysis：It is 25 to prepare weight ratio:25 phenol, chloroform mixture, the 5- (4- hydroxyphenyls) containing 0.05mM in mixture
R- (+)-amphetamine of glycolylurea and 0.02mM；After reaction, with phenol, chloroform mixture extractive reaction liquid, then
3min is centrifuged in 12000rpm, supernatant is taken to carry out nucleic acid electrophoresis detection and analysis result.
Embodiment 4：
A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus, including：It extracts viral nucleic acid, design primer, prepare amplification body
System is incubated, analysis, specifically includes following steps：
Extract viral nucleic acid：It takes Ranaspinosa David liver, brain tissue to be placed in preserve in liquid, then in -80 DEG C of freezings；By Ranaspinosa David liver
Viral DNA is extracted according to Full automatic instrument for extracting nucleic acid and kit requirement after dirty, brain tissue defrosting, is frozen in -75 DEG C,
It is spare as template；The biological organizations such as liver, the brain tissue for preserving Ranaspinosa David with freezing liquid, not only contribute to rainbow in Ranaspinosa David
The duration of color virus, repeatability detection, and freezing liquid can preferably preserve liver, the brain tissue of Ranaspinosa David, it is effectively anti-
Only liver, liquefaction of brain tissue, self-dissolving efficiently preserve its biological function；
Design primer：The primer suitable length of RAA nucleic acid amplification technologies is 28~35bp, and design primer is as follows；QSIV4-
F：CGCTGATGTCGTTGAATGAGAGAGTGACG, QSIV4-R：GTAACCCGGCTTTCGGGCAGCAGTTTTCGG；
Prepare amplification system：According to RAA nucleic acid amplification detection kits（The Hangzhou bio tech ltd Zhong Ce produces, and provides A
Buffer, B Buffer, recombinase dry powder pipe）Illustrate to prepare amplification system：44.5 μ L of A buffer, primers F（10μm）1μL,
Primer R（10μm）1 μ L, 1 μ L of DNA templates, whirlpool mixes and centrifuges above-mentioned solution after supplement, above-mentioned mixed solution is added pre-
In the 50 μ L dry powder pipes equipped with recombinase, adds 2.5 μ L B Buffer and be sufficiently mixed, turn upside down reaction tube 10 times, then
Low-speed centrifugal 1min；
It is incubated：Above-mentioned reaction tube is put into Rotor Gene Real-time PCR instruments, 30min is incubated under the conditions of 39 DEG C；
Analysis：After reaction, with weight ratio 25:25 phenol, chloroform mixture extractive reaction liquid, then in 12000rpm from
Heart 5min takes supernatant to carry out electrophoresis detection and analysis result, or is produced by artificial observation amplified production turbidity or amplification
The method of object chemiluminescence detection carries out interpretation of result；The recombinase-mediated amplification technique of constant temperature fast-amplifying nucleic acid, in constant temperature
Under the conditions of, the recA recombinases from Escherichia coli can be combined closely with primed DNA, the condensate of enzyme and primer be formed, when drawing
Object is when searching the sequence of complete complementary therewith on template DNA, with the help of single-stranded DNA binding protein, open template DNA
Duplex structure form new DNA complementary strands and under the action of archaeal dna polymerase, reaction is expanded without PCR instrument,
The reaction condition that need to ensure constant temperature, detecting the presence of amplified band by nucleic acid electrophoresis, to can detect that template DNA has noninductive
Irido virus is contaminated, this detection method is easy to operate, detection speed is fast, accuracy of detection is high, disclosure satisfy that the demand in market.
Substance and its content in preservation liquid are：Dimethyl sulfoxide (DMSO) 2g/L, 1 g/L of acetamide 1.6g/L, 1,2- propylene glycol,
PEG-800 0.5g/L, nasmil 0.15g/L, reductive glutathione 0.02g/L, 6.0 g/L of lecithin, benzoate
5g/L, sodium nitrate 12.5g/L, glycerine 16g/L, penicillin 150IU/mL, streptomysin 110IU/mL, 120mg/L erythrose,
23mg/L's（S）Ethyl lactate, with phosphate buffer adjustment pH for 7.3, surplus is distilled water；To preserve liquid freezen protective
Liver, the brain tissue of Ranaspinosa David are, it can be achieved that efficient freezen protective brain tissue, effectively prevent liver, liquefaction of brain tissue, brain cell
Self-dissolving, biological characteristics performance are efficiently preserved, and the brain tissue of freezen protective can be directly used for fabric analysis, contribute to DNA
High efficiency, integrality extraction；The erythrose of specific proportioning has cooperative gain effect, the gain effect with (S)-ethyl lactate
(S)-ethyl lactate can be made to crosslink conclusion, and (S)-ethyl lactate with the carbohydrate active group in brain cell cell membrane
Hydroxyl can substitute the hydroxyl of water on protein surface, so that protein surface is formed one layer " water layer ", can thus protect
(S) crosslinking of-ethyl lactate and carbohydrate is concluded position and is not directly exposed in ambient enviroment, which, which concludes, can be changed cell membrane
The microenvironment on surface can reduce water diffusion to extracellular, to prevent brain tissue dehydration, reduce brain tissue cell wrinkle
Contracting；Meanwhile erythrose can generate steric hindrance between protein, the formation of ice crystal when can preferably inhibit cold storage, control and slow
The variation for rushing refrigerating process mesencephalic tissue pH value, brain group when to ensure that the structure of brain tissue, the integrality of function and freezing
The stability knitted extends brain tissue activity；Under conditions of can meet fabric analysis, DNA extraction demands, addition erythrose,
(S) the preservation liquid phase of-ethyl lactate can prolong compared with the preservation liquid for being not added with erythrose, (S)-ethyl lactate, pot-life
Long 40% or more, illustrate that the two plays an important role the preservation of Ranaspinosa David liver organization, brain tissue, shelf effect.
R- (+) -1- phenyl-of 5- (4- hydroxyphenyls) glycolylureas and 0.022mM in phenol, chloroform mixture containing 0.05mM
2- propylamine；5- (4- hydroxyphenyls) the glycolylurea glycolylureas of special proportioning have synergistic effect, the two association with R- (+)-amphetamine
Work can be with the Mg in chelatropic reaction liquid2+、Fe2+Equal metal ions, so as to effectively reduce Mg in reaction solution2+、Fe2+Equal metals
The content of ion prevents metal ion when electrophoresis from activating the destruction in turn resulted in DNA to DNA enzymatic, in addition, reducing Mg2+、Fe2+
The content of equal metal ions can also prevent metal ion from generating precipitation with nucleic acid, to which the nucleic acid quality in reaction solution be effectively ensured
With content, reaction sensitivity and specificity when nucleic acid electrophoresis, visual turbidity or amplified production chemiluminescence detection are improved, is improved
The precise degrees of Ranaspinosa David irido virus RAA diagnostic techniques.
To be uninfected by irido virus Ranaspinosa David as negative control, using PCR amplification as positive control, by embodiment 1-4
In RAA diagnosis testing result do electrophoresis detection, testing result is as shown in Figure 1.As shown in Figure 1, the RAA of Ranaspinosa David irido virus
Diagnostic techniques method have can with PCR amplification compare specificity and precision, and RAA diagnostic techniques without PCR instrument into
Row amplification, only need to ensure that the reaction condition of constant temperature can be detected the presence of amplified band by nucleic acid electrophoresis and detect that template DNA has
Without infection irido virus, detection method is easy to operate, detection speed is fast, accuracy of detection is high, disclosure satisfy that the demand in market.
Routine operation in operating procedure of the present invention is well known to those skilled in the art, herein without repeating.
Technical scheme of the present invention is described in detail in embodiment described above, it should be understood that the above is only
For specific embodiments of the present invention, it is not intended to restrict the invention, all any modifications made in the spirit of the present invention,
Supplement or similar fashion replacement etc., should all be included in the protection scope of the present invention.
Claims (9)
1. a kind of RAA diagnostic techniques method of Ranaspinosa David irido virus, it is characterised in that：The diagnostic techniques method includes：
Extract viral nucleic acid：Ranaspinosa David liver, brain tissue is taken to be placed in preservation liquid simultaneously freezen protective；By Ranaspinosa David liver, brain group
It knits according to Full automatic instrument for extracting nucleic acid and kit requirement extraction viral DNA and freezen protective after thawing, as template
It is spare；
Design primer：The primer suitable length of RAA nucleic acid amplification technologies is 28~35bp, designs 4 pairs of primers；
Prepare amplification system：Illustrated to prepare amplification system according to RAA nucleic acid amplification detection kits；
It is incubated：Above-mentioned reaction tube is put into PCR instrument and is incubated；
Analysis：It is mixed with phenol, the chloroform doped with 5- (4- hydroxyphenyls) glycolylureas and R- (+)-amphetamine after reaction
Object extractive reaction liquid is closed, is then centrifuged for that supernatant is taken to be analyzed.
2. a kind of RAA diagnostic techniques method of Ranaspinosa David irido virus according to claim 1, it is characterised in that：It is described to carry
Take in viral nucleic acid step, Ranaspinosa David liver, brain tissue preserve liquid freezen protective temperature be -80~-85 DEG C, extraction virus
The freezen protective temperature of DNA is -70~-80 DEG C.
3. a kind of RAA diagnostic techniques method of Ranaspinosa David irido virus according to claim 1, it is characterised in that：It is described to carry
It takes in viral nucleic acid step, the substance and its content preserved in liquid is：1.5~1.8g/L of dimethyl sulfoxide (DMSO), acetamide 1.6~
1~2g/L of 1.8g/L, 1,2- propylene glycol, 0.4~0.5g/L of PEG-800,0.15~0.2g/L of nasmil, reproducibility paddy Guang
Sweet 0.02~0.025g/L of peptide, 5~6g/L of lecithin, 4~5g/L of benzoate, 10~12.5g/L of sodium nitrate, glycerine 14~
16g/L, 120~150IU/mL of penicillin, 100~110IU/mL of streptomysin, with phosphate buffer adjustment pH for 7.1~7.3,
Surplus is distilled water.
4. a kind of RAA diagnostic techniques method of Ranaspinosa David irido virus according to claim 1, it is characterised in that：It is described to set
It counts in primer step, primer is respectively：
QSIV1-F TCCATGTATGCCGTGTTAAAGGACTGG
QSIV1-R TTACATCCTCAACGCCTGGTTGGTGCTCAAG
QSIV2-F CCGTGTTAAAGGACTGGGCGCTGATGTCG
QSIV2-R GCAGCAGTTTTCGGTCGGCGTTCCCAGG
QSIV3-F CTGGGCGCTGATGTCGTTGAATGAGAGAGTG
QSIV3-R CGGCTTTCGGGCAGCAGTTTTCGGTCGGCG
QSIV4-F CGCTGATGTCGTTGAATGAGAGAGTGACG
QSIV4-R GTAACCCGGCTTTCGGGCAGCAGTTTTCGG。
5. a kind of RAA diagnostic techniques method of Ranaspinosa David irido virus according to claim 1, it is characterised in that：It is described to match
In amplification system step processed, amplification system is：44.5 μ L of A buffer, 1 μ L of primers F, 1 μ L of primer R, 1 μ L of DNA profiling are mended
It fills rear whirlpool and mixes and centrifuge above-mentioned solution, the addition of above-mentioned mixed solution is preinstalled in 50 μ L dry powder pipes of recombinase, then is added
Enter 2.5 μ L B Buffer and be sufficiently mixed, turn upside down reaction tube 8-10 times, then low-speed centrifugal 1-2min.
6. a kind of RAA diagnostic techniques method of Ranaspinosa David irido virus according to claim 1, it is characterised in that：It is described to incubate
It educates in step, incubation temperature is 37~39 DEG C, and incubation time is 28~30min.
7. a kind of RAA diagnostic techniques method of Ranaspinosa David irido virus according to claim 1, it is characterised in that：Described point
Analyse step in, phenol, chloroform mixture mass ratio be 24~25:25.
8. a kind of RAA diagnostic techniques method of Ranaspinosa David irido virus according to claim 7, it is characterised in that：Described point
It analyses in step, 5- (4- hydroxyphenyls) glycolylureas in phenol, chloroform mixture containing 0.05~0.051mM and 0.02~0.022mM
R- (+)-amphetamine.
9. a kind of RAA diagnostic techniques method of Ranaspinosa David irido virus according to claim 1, it is characterised in that：Described point
It analyses in step, analysis method includes electrophoresis detection and analyze, artificial observation amplified production turbidity or amplified production chemiluminescence
The method of detection carries out interpretation of result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810392927.2A CN108707694A (en) | 2018-04-27 | 2018-04-27 | A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810392927.2A CN108707694A (en) | 2018-04-27 | 2018-04-27 | A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108707694A true CN108707694A (en) | 2018-10-26 |
Family
ID=63867561
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810392927.2A Pending CN108707694A (en) | 2018-04-27 | 2018-04-27 | A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108707694A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113789398A (en) * | 2021-10-14 | 2021-12-14 | 盐城市畜牧兽医站(盐城市动物疫病预防控制中心) | Amplification primer and kit for detecting mycoplasma synoviae and application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1448519A (en) * | 2003-05-06 | 2003-10-15 | 中山大学 | Frog virogene diagnostic kit and detecting method thereof |
| CN103045757A (en) * | 2012-05-17 | 2013-04-17 | 上海七海复泰生物科技有限公司 | Extraction-free iridescent virus polymerase chain reaction (PCR) detection method |
| CN104099428A (en) * | 2014-07-10 | 2014-10-15 | 北京出入境检验检疫局检验检疫技术中心 | Triplex real-time fluorescent PCR (polymerase chain reaction) primer, probe and kit for identifying ranavirus virus |
-
2018
- 2018-04-27 CN CN201810392927.2A patent/CN108707694A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1448519A (en) * | 2003-05-06 | 2003-10-15 | 中山大学 | Frog virogene diagnostic kit and detecting method thereof |
| CN103045757A (en) * | 2012-05-17 | 2013-04-17 | 上海七海复泰生物科技有限公司 | Extraction-free iridescent virus polymerase chain reaction (PCR) detection method |
| CN104099428A (en) * | 2014-07-10 | 2014-10-15 | 北京出入境检验检疫局检验检疫技术中心 | Triplex real-time fluorescent PCR (polymerase chain reaction) primer, probe and kit for identifying ranavirus virus |
Non-Patent Citations (3)
| Title |
|---|
| 李惠芳等: "虹彩病毒蛙病毒属病毒实时荧光PCR检测方法的建立", 《华中农业大学学报》 * |
| 李江宇等: "蛙病毒三重荧光PCR检测方法的建立", 《高技术通讯》 * |
| 汪环等: "东北林蛙种蛙蛙病毒LAMP快速检测", 《野生动物学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113789398A (en) * | 2021-10-14 | 2021-12-14 | 盐城市畜牧兽医站(盐城市动物疫病预防控制中心) | Amplification primer and kit for detecting mycoplasma synoviae and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nicholson et al. | Detection of Tilapia Lake Virus in Egyptian fish farms experiencing high mortalities in 2015 | |
| Tageldin et al. | Lumpy skin disease of cattle: an emerging problem in the Sultanate of Oman | |
| Winton et al. | Molecular diagnosis of Phytophthora lateralis in trees, water, and foliage baits using multiplex polymerase chain reaction | |
| Page-Karjian et al. | Presence of chelonid fibropapilloma-associated herpesvirus in tumored and non-tumored green turtles, as detected by polymerase chain reaction, in endemic and non-endemic aggregations, Puerto Rico | |
| Verwoerd et al. | Aetiology of jaagsiekte: transmission by means of subcellular fractions and evidence for the involvement of a retrovirus | |
| CN109234450A (en) | A kind of swamp eel rhabdovirus CrERV RT-CPA detection primer and application | |
| CN108707694A (en) | A kind of RAA diagnostic techniques method of Ranaspinosa David irido virus | |
| CN109182277B (en) | Monopterus albus rhabdovirus CrERV and RT-PCR detection primer and application | |
| Yao et al. | Improved RNA isolation from Laminaria japonica Aresch (Laminariaceae, Phaeophyta) | |
| CN106755565A (en) | A kind of kit based on fluorescent PCR method joint-detection dengue fever virus and datum hole Kenya virus | |
| Wang et al. | Development of a loop-mediated isothermal amplification for rapid diagnosis of Aphelenchoides ritzemabosi | |
| CN109593737B (en) | Safflower CtACO3 gene, and coding protein and application thereof | |
| Caruso et al. | Detection of a phylogenetically divergent eel virus European X (EVEX) isolate in European eels (Anguilla anguilla) farmed in experimental tanks in Italy | |
| CN106754748A (en) | Aedes albopictus densovirus and its application | |
| CN109266785A (en) | A kind of swamp eel rhabdovirus CrERV RT-LAMP detection primer and application | |
| CN102477423B (en) | Method for extracting DNA from shrimp shell of procambarus clarkii | |
| Martin et al. | The use of collagenase to improve the detection of plant viruses in vector nematodes by RT-PCR | |
| Jiang et al. | Development of a novel real-time quantitative PCR method for detection of Ilyonectria robusta, the predominant species causing ginseng rusty root rot | |
| CN106337047B (en) | A kind of alcohol extraction procedure with high salt of cowpea blade DNA | |
| CN104059931B (en) | RNA interference vector of bactrocera dorsalis cytochrome P450 genes and construction method and application thereof | |
| CN102628088B (en) | Polymerase chain reaction (PCR) detection method universal for viruses | |
| CN106754978A (en) | A kind of specific molecular marker of bacterial strains of asparagus NG1 92 and its preparation method and application | |
| CN102776284B (en) | The diagnostic primers of Dai-ju stock Pseudosciaena crocea and Fujian-East Guangdong race large yellow croaker and discrimination method thereof | |
| CN110004232A (en) | The specific gene of east Storehouse midge, the kit and method for identifying east Storehouse midge | |
| CN117050919B (en) | Application of rhodococcus strain ND011 and tobacco planting method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |