CN108707583A - A kind of cell strain and application thereof of inducible stable expression PPR virus P albumen - Google Patents

A kind of cell strain and application thereof of inducible stable expression PPR virus P albumen Download PDF

Info

Publication number
CN108707583A
CN108707583A CN201810500641.1A CN201810500641A CN108707583A CN 108707583 A CN108707583 A CN 108707583A CN 201810500641 A CN201810500641 A CN 201810500641A CN 108707583 A CN108707583 A CN 108707583A
Authority
CN
China
Prior art keywords
albumen
cell strain
ppr virus
cell
hand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810500641.1A
Other languages
Chinese (zh)
Other versions
CN108707583B (en
Inventor
李霆
李茜
王娜
崔贝贝
张永宁
韩雪清
吴绍强
林祥梅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chinese Academy of Inspection and Quarantine CAIQ
Original Assignee
Chinese Academy of Inspection and Quarantine CAIQ
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chinese Academy of Inspection and Quarantine CAIQ filed Critical Chinese Academy of Inspection and Quarantine CAIQ
Priority to CN201810500641.1A priority Critical patent/CN108707583B/en
Publication of CN108707583A publication Critical patent/CN108707583A/en
Application granted granted Critical
Publication of CN108707583B publication Critical patent/CN108707583B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18411—Morbillivirus, e.g. Measles virus, canine distemper
    • C12N2760/18422—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18411—Morbillivirus, e.g. Measles virus, canine distemper
    • C12N2760/18434—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
    • G01N2333/08—RNA viruses
    • G01N2333/115—Paramyxoviridae, e.g. parainfluenza virus
    • G01N2333/12—Mumps virus; Measles virus

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Analytical Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Biotechnology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Food Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Gastroenterology & Hepatology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)

Abstract

Present disclose provides a kind of cell strains of inducible stable expression PPR virus P albumen, and the deposit number of the cell strain is CGMCC NO.14317.Optionally, the amino acid sequence of the PPR virus P albumen is SEQ ID NO.1.On the other hand, the disclosure additionally provides purposes of the cell strain as described above in screening drug.On the other hand, the disclosure additionally provides purposes of the cell strain as described above in preparing vaccine.On the other hand, the disclosure additionally provides purposes of the cell strain as described above in preparing test kit.Through the above technical solutions, the present invention provides the cell strain of inducible stable PPR virus P protein expressions, on the one hand can be used in screening drug, prepare vaccine and examining antibody；On the other hand, for furtheing investigate the pathogenesis of P albumen and its being of great significance with control aspect in the prevention of peste des petits ruminants.

Description

A kind of cell strain of inducible stable expression PPR virus P albumen and its Purposes
Technical field
The present invention relates to technical field of cell biology and animal health health field, and in particular, to one kind can induce steady Surely the cell strain and application thereof of PPR virus P albumen is expressed.
Background technology
Peste des petits ruminants (Peste des petits ruminants, PPR) is commonly called as sheep pest, is World Organization for Animal Health (OIE) necessary reported communicable disease as defined in, by PPR virus (the Peste des of paramyxovirus section Morbillivirus Petits ruminants virus, Small ruminant morbillivirus, PPRV) infection small ruminant caused by A kind of infectious disease characterized by generating heat suddenly, secretion, canker sore, pneumonia, diarrhea is discharged in eye nose, goat height are susceptible. The disease occurs in Africa for the first time in nineteen forty-two, then in the African continent wide-scale distribution, has involved the ground such as the Middle East, West Asia, South Asia Area.The disease was successively broken out in 2007 to 2008 years in Ali Area, Xizang and Nagqu Diqu；Winter in 2013, the disease are broken out in Xinjiang again； Since the large area of goat and sheep flows, which has propagated rapidly at present, until in September, 2014 is less than year, the whole nation 256 county's epidemic outbreaks for sharing 22 provinces or autonomous region, have generated the animal health health in China and have seriously threatened.
PPR virus (PPRV) is sub-thread minus-stranded rna virus, and Genome Size is 15948 nucleotide, gene 3 ' ends of group are targeting sequencing, and 5 ' ends are tailer sequence, and 6 encoder block sequence in the gene sequences are 3 '-N-P-M-F-H-L-5 ', 6 structural proteins, i.e. nucleocapsid protein (N), phosphoprotein (P), stromatin (M), fusion protein (F), blood clotting egg are encoded successively (H) and large protein (L) in vain, P genes also encode 2 non-structural proteins C and V.The gene total length of P albumen is 1655 nucleosides Acid, open reading frame length are 1530 nucleotide, encode 509 amino acid.The molecular weight of P albumen is about 54.8kd, in disease It plays a role during the transcription and replication of malicious RNA.
Studies have shown that the P albumen of PPRV plays a role during the transcription and replication of viral RNA：P albumen can be with difference The N protein of form combine or individually with N protein-RNA template composite combination activated transcriptions；P albumen is combined to be formed with L albumen It dependent on the RNA polymerase of RNA, then is combined to form ribonucleoprotein complex with N protein-RNA templates, carries out viral RNA Transcription and replication.In addition, herpesviral P albumen also plays a significant role in blocking host's ifn response access, P albumen Mainly by blocking JANUS kinases 1 (JAK1) to block interference to the phosphorylation of signal transduction and activating transcription factor 1 (STAT1) Element reaction.
H, N, F and M albumen are focused primarily upon to the research of PPR virus structural proteins at present, and are directed to H, N, F Albumen has been carried out including related applications researchs such as monoclonal antibody preparation, the preparation of antibody test test strips and antigen peptide screenings, to P The gene of albumen only has the report of a small number of strain Series Characteristics Anal Ysis.But it is also difficult to realize P albumen at present in eucaryotic cell strain In inducible stability and high efficiency expression.
Invention content
In order to realize inducible stability and high efficiency expression of the P albumen in eucaryotic cell strain, present disclose provides one kind to lure The cell strain for stablizing expression PPR virus P albumen is led, the deposit number of the cell strain is CGMCC NO.14317.
Optionally, the amino acid sequence of the PPR virus P albumen is SEQ ID NO.1.
On the other hand, the disclosure additionally provides purposes of the cell strain as described above in screening drug.
On the other hand, the disclosure additionally provides purposes of the cell strain as described above in preparing vaccine.
On the other hand, the disclosure additionally provides purposes of the cell strain as described above in preparing test kit.
Through the above technical solutions, the present invention provides the cells of inducible stable PPR virus P protein expressions On the one hand strain can be used in screening drug, prepare vaccine and examining antibody；On the other hand, causing a disease for further investigation P albumen It mechanism and its is of great significance with control aspect in the prevention of peste des petits ruminants.
Other feature and advantage of the disclosure will be described in detail in subsequent specific embodiment part.
Biomaterial preservation
The brain glioblastoma cell of the present invention is that the present inventor screens to have obtained one plant of inducible stability and high efficiency earth's surface Up to the cell strain of PPR virus P albumen, deposit number is CGMCC No.14317, and the deposit date is in Augusts, 2017 25, depositary institution was China Committee for Culture Collection of Microorganisms's common micro-organisms center, and address is located at Beijing's southern exposure No. 3 Institute of Microorganism, Academia Sinica of institute of area North Star West Road 1, Classification And Nomenclature are the protein stabilized cloned cell lines of P.
Description of the drawings
Attached drawing is for providing further understanding of the disclosure, and a part for constitution instruction, with following tool Body embodiment is used to explain the disclosure together, but does not constitute the limitation to the disclosure.In the accompanying drawings：
Figure 1A is the matter that the P gene coded sequences of PPRV are inserted into the restriction enzyme site of pcDNA4to carriers after amplification Kernel structure schematic diagram.
Figure 1B is pCDNA6/TR plasmid construct schematic diagrames.
Fig. 2A is the result that fortimicin can obviously induce the expression of PPRV-P albumen in 293TREX-PPRV-P cell strains Figure.
Fig. 2 B are that the expression of P albumen shows the result figure of induction time dependence.
Fig. 2 C are that the expression of P albumen shows the dose-dependent result figure of fortimicin.
Fig. 3 is that the expression quantity of the PPRV-P genes of fortimicin addition group obviously rises relative to control group (being not added with Dox) High result figure.
Fig. 4 is that the cell after fortimicin induction the result figure of apparent red fluorescence occurs.
Fig. 5 is to carry out the P albumen that immunoblotting analysis analyzes the cell expression of the application using the PPRV positives and negative serum Antigenic result figure.
Specific implementation mode
The specific implementation mode of the disclosure is described in detail below in conjunction with attached drawing.It should be understood that this place is retouched The specific implementation mode stated is only used for describing and explaining the disclosure, is not limited to the disclosure.
Present disclose provides a kind of cell strain of inducible stable expression PPR virus P albumen, the cell strain Deposit number is CGMCC NO.14317.
Above-mentioned cell strain is the restricted digestion that the P gene coded sequences of PPRV are inserted into pcDNA4to carriers after amplification Site generates pCDNA4-To-PPRV-P recombinant expression carriers；Then pCDNA4-To-PPRV-P plasmids are transferred to have stablized and are turned Enter the TREx-293 cells of pcNDA6/TR plasmids, then filtering out stabilization with piricularrin and bleomycin is transferred to pcNDA6/TR The cell survived with the cell clone of two kinds of plasmids of pCDNA4-To-PPRV-P continues culture and monoclonal, finishing screen The cell clone of a stable transfection is chosen, the expression of number 293TREx-PPRV-P, the cell clone can be by fortimicins (Dox) it controls；The cell clone is subjected to preservation to get the cell strain to deposit number for CGMCC NO.14317.
Optionally, wherein the nucleic acid sequence of the encoding gene of the PPR virus P albumen is SEQ ID NO.1.
SEQ ID NO.1 are：ATGGCAGAAGAACAAGCATACCATGTCAACAAGGGACTGGAATGTATCAAGTCTC TCAAAGCCTCTCCCCCGGATCTATCCACCATCAAAGATGCCCTTGAGAGCTGGAGAGAGGGGCTTAGCCCCTCAGGC CGTGCAACACCGAACCCTGATACGTCCGAGGGAGACCATCAGAATATCAACCAATCATGCTCACCAGCAATCGGATC AGACAAAGTCGACATGTCTCCTGAAGATAATCTCGGATTTAGAGAGATCACTTGTAATGACAGTGAGGCTGGGCTCG GAGGAGTTCTGGATAAAGGATCCAACTCTCAAGTACAGCGTTACTATGTTTATAGCCACGGGGGTGAAGAGATTGAA GGACTCGAGGATGCTGACTCTCTCGTGGTTCAAGCAAATCCTCCAGTTACTGACACCTTCAATGGAGGAGAGGATGG ATCTGACGACAGCGATGTGGACTCTGGCCCAGATGATCCCGGCAGAGATCCTCTATATGACCGGGGATCTGCTGCCG GCAATGATGTCTCTAGGTCAACAGATGTCGAAAAATTAGAAGGTGATGACATTCAAGAAGTTCTTAACTCCCAGAAG AGTAAAGGAGGAAGATTCCAAGGCGGGAAAATCTTGCGGGTCCCGGAAATACCCGATGTCAAGAACCCTAGACCATC AGCCCAATCAATTAAAAAGGGCACAGACGGGAACTCAGTCTTATCTGGAACGGTGACAGAGTGTTCATCGATAAGTG GTGCAACCCAAGCTGTGCCAGAGTCCAGATGGGAGTCATCAGAGCGAAATGCGTCTGTGGGGAGTGTCCCCAAATCT GCGAGGAGTGCAAAGACGATCCAGGGGTTGACACAAGAATCTGGTACCATAGCATCACTGACTCAGCCTAAAGAGAA TGACTCCGAGTTTGAGTATGAGGATGATCTATTCACAGAGATGCAGGAGATTCGTGCAAGCATTGCTAAGATCCATG ATGACAACAAAACTATCCTCTCAAAACTTGATTCTCTACTGTTATTGAAAGGAGAAATCGATACTATCAAGAAACAA ATCAGCAAACAAAATATAAGTATATCTACCATTGAGGGCCATCTATCCAGTATAATGATAGCCATCCCGGGCTTTGG GAAGGACATCAAGGACCCAACATCTGAGGTTGAGTTGAACCCGGATTTGAGACCTATAATCAGCCGTGATTCTGGCA GGGCTCTTGCGGAGGTCCTCAAGAAACCCGCTGTTGATAGGTCTCAGAAAAGCGGAATCAAAGTCAACTCCGGTTCA AAGGGTCAGCTCCTTAAGGATCTCCAGCTAAAACCTGTCGACAAACAGGCAAGCTCTGCAATCGAGTTTGTTCCATC TGACCATGAATCATCCAGGAGTGTCATCCGCTCCATAATCAAGTCGAGCAAGCTTAACATTGATCACAAGGACTATC TTCTAGATTTACTGAATGATGTGAAAGGCTCCAAGGATCTTAAGGAATTCCACAAGATGCTAACAGCCATTCTTGCC AAGCAGCCGTAA。
On the other hand, the disclosure additionally provides purposes of the cell strain as described above in screening drug.
More specifically, the drug is the drug for treating peste des petits ruminants.Wherein, the process for screening drug may include： Drug candidates to be measured are detected to PPR virus P albumen and other peste des petits ruminants disease using cell strain as described above The influence of the combination of toxalbumin, if drug candidates to be measured can inhibit PPR virus P albumen small to be ruminated with other The combination of epizootic disease virus protein, it indicates that the drug candidates to be measured can treat peste des petits ruminants；Described other small are ruminated Epizootic disease virus protein includes but not limited to PPR virus N protein, PPR virus M albumen, peste des petits ruminants disease At least one of malicious F protein, PPR virus H protein and PPR virus L albumen.
On the other hand, the disclosure additionally provides purposes of the cell strain as described above in preparing vaccine.
More specifically, the vaccine is the vaccine for preventing peste des petits ruminants.Wherein, the preparation method of the vaccine can wrap It includes：The PPR virus P albumen that purifying is prepared using cell strain as described above, then ruminates beast by the small of the purifying Epidemic disease virus P protein is mixed with immunologic adjuvant.
On the other hand, the disclosure additionally provides purposes of the cell strain as described above in preparing test kit.
Specifically, the test kit is for examining whether tested animal carries the antibody of anti-PPR virus Test kit.More specifically, the test kit is for examining whether tested animal carries anti-peste des petits ruminants disease The test kit of the antibody of malicious P albumen.If tested animal contacted PPR virus, once infected peste des petits ruminants Viral or once inoculated PPR virus vaccine, then may be tested out by above-mentioned test kit.
Wherein, as described above, the amino acid sequence of the PPR virus P albumen is SEQ ID NO.1.
Hereinafter, present invention will be further described in detail through examples.
Embodiment 1
The present embodiment is for being described in detail：The foundation for the 293TREX-PPRV-P cell strains that can be induced by fortimicin.
Test material therefor：PCDNA4/TO plasmids, pCDNA6/TR plasmids, TREx-293 cells.
Test specific steps：The P gene coded sequences of PPRV are inserted into the restricted digestion of pcDNA4to carriers after amplification Site such as figure (1A), generates pCDNA4-To-PPRV-P recombinant expression carriers, sequence verification sequence is correct.By pCDNA4-To- PPRV-P plasmids, which are transferred to, has stablized the TREx-293 cells for being transferred to pcNDA6/TR plasmids, such as schemes (1B), and the rice of 10 μ g/mL is added The bleomycin (Zeocin) of pest rhzomorph (blasticidin) and 300 μ g/mL with filter out stablize be transferred to pcNDA6/TR and The cell that the cell clone of two kinds of plasmids of pCDNA4-To-PPRV-P survives, constantly proliferation develop into cell line, are incubated at In the DMEM culture mediums of bleomycin containing 10% fetal calf serum, the piricularrin of 10 μ g/mL and 300 μ g/mL and monoclonal Change, finally screens the cell clone to a stable transfection, the expression of number 293TREx-PPRV-P, the cell clone can quilts Fortimicin (Dox) controls；The cell clone is subjected to preservation to get the cell to deposit number for CGMCC NO.14317 Strain.
Embodiment 2
The present embodiment is for being described in detail：The expression of P albumen in the 293TREX-PPRV-P cell strains of fortimicin induction.
Experiment cell used：293TREX-PPRV-P cell strains.
Test specific steps：After 293TREX-PPRV-P cell strains are inoculated on six orifice plates and continue culture 24 hours, The fortimicin of (10ng/mL) is added in the culture medium of processing group, and is continued culture and carried after (or 48,72 hours) for 24 hours Take total protein and total serum IgE；Immunoblotting analysis analysis is carried out to above-mentioned protein sample, compared with the control group for being not added with fortimicin, Fortimicin can obviously induce the expression (see Fig. 2A) of PPRV-P albumen in 293TREX-PPRV-P cell strains, and P albumen Expression shows induction time and relies on (see Fig. 2 B) pattern and fortimicin dose-dependant pattern (see Fig. 2 C)；To above-mentioned total serum IgE Sample carry out reverse transcription PCR and fluorescence relative quantification PCR analysis shows, the expression quantity of the PPRV-P genes of fortimicin addition group It is significantly raised (see Fig. 3) relative to control group (being not added with Dox).Equally 293TREX-PPRV-P cell inoculations are covered in advance On six orifice plates of coverslip and after continuing culture 24 hours, the fortimicin of (10ng/mL) is added in the culture medium of processing group, And after continuing culture for 24 hours, after fixing cell with 4% paraformaldehyde, indirect immunofluorescence analysis is carried out to cell.Coloration result is aobvious Show compared with the control cell for being not added with fortimicin, apparent red fluorescence occurs in the cell after fortimicin induction (see Fig. 4), it was demonstrated that P albumen is expressed.
Embodiment 3
The present embodiment is for being described in detail：The P eggs expressed in 293TREX-PPRV-P cells using fortimicin induction White detection PPRV infection.
Test specific steps：By 293TREX-PPRV-P cell inoculations on six orifice plates and continue culture 24 hours after, The fortimicin of (10ng/mL) is added in the culture medium of processing group, and is continued culture and extracted total protein afterwards for 24 hours；By fortimicin The P albumen of induced expression is respectively adopted the PPRV positives and negative serum carries out immunoblotting analysis analysis as diagnostic antigen.As a result it shows The antibody of P albumen in positive serum can clearly be detected by showing the P albumen of fortimicin induced expression, in negative serum then without Signal illustrates that the P albumen of cell strain expression has good antigenicity, and the immunoblotting assay suitable for PPRV and diagnosis (see Fig. 5).
Can be seen that the cell of the CGMCC No.14317 of the disclosure by the result of above-described embodiment 1-3 can induce surely It is fixed efficiently to express PPR virus P albumen, and can be used in screening drug, prepare vaccine and examining antibody.
The preferred embodiment of the disclosure is described in detail above in association with attached drawing, still, the disclosure is not limited to above-mentioned reality The detail in mode is applied, in the range of the technology design of the disclosure, a variety of letters can be carried out to the technical solution of the disclosure Monotropic type, these simple variants belong to the protection domain of the disclosure.
It is further to note that specific technical features described in the above specific embodiments, in not lance In the case of shield, can be combined by any suitable means, in order to avoid unnecessary repetition, the disclosure to it is various can The combination of energy no longer separately illustrates.
In addition, arbitrary combination can also be carried out between a variety of different embodiments of the disclosure, as long as it is without prejudice to originally Disclosed thought equally should be considered as disclosure disclosure of that.
Sequence table
<110>China Inst. of Quarantine Inspection Sciences
<120>A kind of cell strain and application thereof of inducible stable expression PPR virus P albumen
<130> 9439CAIQ
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1530
<212> DNA
<213>PPR virus (Peste-des-petits-ruminants virus)
<400> 1
atggcagaag aacaagcata ccatgtcaac aagggactgg aatgtatcaa gtctctcaaa 60
gcctctcccc cggatctatc caccatcaaa gatgcccttg agagctggag agaggggctt 120
agcccctcag gccgtgcaac accgaaccct gatacgtccg agggagacca tcagaatatc 180
aaccaatcat gctcaccagc aatcggatca gacaaagtcg acatgtctcc tgaagataat 240
ctcggattta gagagatcac ttgtaatgac agtgaggctg ggctcggagg agttctggat 300
aaaggatcca actctcaagt acagcgttac tatgtttata gccacggggg tgaagagatt 360
gaaggactcg aggatgctga ctctctcgtg gttcaagcaa atcctccagt tactgacacc 420
ttcaatggag gagaggatgg atctgacgac agcgatgtgg actctggccc agatgatccc 480
ggcagagatc ctctatatga ccggggatct gctgccggca atgatgtctc taggtcaaca 540
gatgtcgaaa aattagaagg tgatgacatt caagaagttc ttaactccca gaagagtaaa 600
ggaggaagat tccaaggcgg gaaaatcttg cgggtcccgg aaatacccga tgtcaagaac 660
cctagaccat cagcccaatc aattaaaaag ggcacagacg ggaactcagt cttatctgga 720
acggtgacag agtgttcatc gataagtggt gcaacccaag ctgtgccaga gtccagatgg 780
gagtcatcag agcgaaatgc gtctgtgggg agtgtcccca aatctgcgag gagtgcaaag 840
acgatccagg ggttgacaca agaatctggt accatagcat cactgactca gcctaaagag 900
aatgactccg agtttgagta tgaggatgat ctattcacag agatgcagga gattcgtgca 960
agcattgcta agatccatga tgacaacaaa actatcctct caaaacttga ttctctactg 1020
ttattgaaag gagaaatcga tactatcaag aaacaaatca gcaaacaaaa tataagtata 1080
tctaccattg agggccatct atccagtata atgatagcca tcccgggctt tgggaaggac 1140
atcaaggacc caacatctga ggttgagttg aacccggatt tgagacctat aatcagccgt 1200
gattctggca gggctcttgc ggaggtcctc aagaaacccg ctgttgatag gtctcagaaa 1260
agcggaatca aagtcaactc cggttcaaag ggtcagctcc ttaaggatct ccagctaaaa 1320
cctgtcgaca aacaggcaag ctctgcaatc gagtttgttc catctgacca tgaatcatcc 1380
aggagtgtca tccgctccat aatcaagtcg agcaagctta acattgatca caaggactat 1440
cttctagatt tactgaatga tgtgaaaggc tccaaggatc ttaaggaatt ccacaagatg 1500
ctaacagcca ttcttgccaa gcagccgtaa 1530

Claims (10)

1. a kind of cell strain of inducible stable expression PPR virus P albumen, which is characterized in that the preservation of the cell strain Number is CGMCC NO.14317.
2. cell strain according to claim 1, wherein the nucleic acid of the encoding gene of the PPR virus P albumen Sequence is SEQ ID NO.1.
3. purposes of the cell strain described in claim 1 in screening drug.
4. purposes according to claim 3, wherein the drug is the drug for treating peste des petits ruminants.
5. purposes of the cell strain described in claim 1 in preparing vaccine.
6. purposes according to claim 5, wherein the vaccine is the vaccine for preventing peste des petits ruminants.
7. purposes of the cell strain described in claim 1 in preparing test kit.
8. purposes according to claim 7, wherein whether the test kit is anti-for examining tested animal to carry The test kit of the antibody of PPR virus.
9. purposes according to claim 8, wherein whether the test kit is anti-for examining tested animal to carry The test kit of the antibody of PPR virus P albumen.
10. purposes according to claim 9, wherein the amino acid sequence of the PPR virus P albumen is SEQ ID NO.1。
CN201810500641.1A 2018-05-23 2018-05-23 Cell strain capable of inducing and stably expressing PPRV (peste des petits ruminants virus) P protein and application thereof Expired - Fee Related CN108707583B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810500641.1A CN108707583B (en) 2018-05-23 2018-05-23 Cell strain capable of inducing and stably expressing PPRV (peste des petits ruminants virus) P protein and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810500641.1A CN108707583B (en) 2018-05-23 2018-05-23 Cell strain capable of inducing and stably expressing PPRV (peste des petits ruminants virus) P protein and application thereof

Publications (2)

Publication Number Publication Date
CN108707583A true CN108707583A (en) 2018-10-26
CN108707583B CN108707583B (en) 2020-07-14

Family

ID=63868513

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810500641.1A Expired - Fee Related CN108707583B (en) 2018-05-23 2018-05-23 Cell strain capable of inducing and stably expressing PPRV (peste des petits ruminants virus) P protein and application thereof

Country Status (1)

Country Link
CN (1) CN108707583B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102071218A (en) * 2010-11-23 2011-05-25 中国农业科学院哈尔滨兽医研究所 Peste des petits ruminants virus (PPRV) reverse genetic operating system and application thereof
WO2014030137A1 (en) * 2012-08-24 2014-02-27 Centre De Cooperation Internationale En Recherche Agronomique Pour Le Developpement (Cirad) Vaccine strain marked with the plague virus of small ruminants, and preparation method thereof
CN105968175A (en) * 2016-04-14 2016-09-28 中国农业科学院哈尔滨兽医研究所 Recombinant peste des petits ruminants virus N protein and expression method and application thereof
CN107805628A (en) * 2017-10-26 2018-03-16 安徽农业大学 A kind of stable expression PPR virus acceptor Nectin 4 cell line and its construction method

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102071218A (en) * 2010-11-23 2011-05-25 中国农业科学院哈尔滨兽医研究所 Peste des petits ruminants virus (PPRV) reverse genetic operating system and application thereof
WO2014030137A1 (en) * 2012-08-24 2014-02-27 Centre De Cooperation Internationale En Recherche Agronomique Pour Le Developpement (Cirad) Vaccine strain marked with the plague virus of small ruminants, and preparation method thereof
CN105968175A (en) * 2016-04-14 2016-09-28 中国农业科学院哈尔滨兽医研究所 Recombinant peste des petits ruminants virus N protein and expression method and application thereof
CN107805628A (en) * 2017-10-26 2018-03-16 安徽农业大学 A kind of stable expression PPR virus acceptor Nectin 4 cell line and its construction method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
QIANQIAN HU等: "Rescue of recombinant peste des petits ruminants virus: creation of a GFP-expressing virus and application in rapid virus neutralization test", 《VETERINARY RESEARCH》 *
刘晓宇等: "可调控表达甲型流感病毒M2 蛋白的哺乳动物细胞系的建立与鉴定", 《生物工程学报》 *

Also Published As

Publication number Publication date
CN108707583B (en) 2020-07-14

Similar Documents

Publication Publication Date Title
Sellers Current limitations in control of viral arthritis and tenosynovitis caused by avian reoviruses in commercial poultry
Sakai et al. Lethal canine distemper virus outbreak in cynomolgus monkeys in Japan in 2008
Hu et al. Rescue of recombinant peste des petits ruminants virus: creation of a GFP-expressing virus and application in rapid virus neutralization test
Yan et al. Establishing a TaqMan-based real-time PCR assay for the rapid detection and quantification of the newly emerged duck Tembusu virus
Johne et al. Characterization of two novel polyomaviruses of birds by using multiply primed rolling-circle amplification of their genomes
Kováčová et al. Q fever–still a query and underestimated infectious disease
Balamurugan et al. Peste des petits ruminants virus detected in tissues from an Asiatic lion (Panthera leo persica) belongs to Asian lineage IV
Pritchard et al. Genetic diversity of bluetongue viruses in south east Asia
CN103320535B (en) Method for identifying wild strain and vaccine strain of hog cholera virus
CN105384803A (en) Schistosoma japonicum katsurada recombinant protein SjSAPLP4 as well as encoding gene and application thereof
CN106442981B (en) A kind of 1 type antibody indirect ELISA diagnostic kit of human bocavirus
CN110105436A (en) The ELISA detection kit and the preparation method and application thereof of 3 type antibody of pig circular ring virus
CN107056898A (en) 3 type of carp herpesviral, 1301 plants of ORF136 DNA recombinant expressions albumen, antibody and its application
Kumar et al. Evaluation of surface glycoproteins of classical swine fever virus as immunogens and reagents for serological diagnosis of infections in pigs: A recombinant Newcastle disease virus approach
Chauhan et al. Isolation of bluetongue virus serotype 1 from aborted goat fetuses
Wang et al. Expression of capsid proteins and non-structural proteins of waterfowl parvoviruses in Escherichia coli and their use in serological assays
Edward et al. Localization and functions of Japanese encephalitis virus nonstructural proteins NS3 and NS5 for viral RNA synthesis in the infected cells
Ren et al. Identification of three antigen epitopes on the nucleocapsid protein of the genotype C of bovine parainfluenza virus type 3
Stettler et al. Determinants of persistence in canine distemper viruses
Xie et al. Detection of antibodies specific to the non-structural proteins of fowl adenoviruses in infected chickens but not in vaccinated chickens
CN102108414B (en) Real-time fluorescence transcription-polymerase chain reaction (RT-PCR) detection method and kit for pike fry rhabdovirus (PFRV)
Wang et al. A novel viral vaccine platform based on engineered transfer RNA
CN109913423A (en) A kind of the recombination Vero cell line and application of stable expression pig Delta coronavirus N protein
Yen et al. Construction of an infectious plasmid clone of Muscovy duck parvovirus by TA cloning and creation of a partially attenuated strain
CN108384893A (en) Real-time fluorescence quantitative RT-PCR kit for detecting foot and mouth disease virus and Sai Nika paddy viruses and its application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20200714