CN108676919A - A kind of HBV pgRNA fluorescent quantificationally PCR detecting kits - Google Patents
A kind of HBV pgRNA fluorescent quantificationally PCR detecting kits Download PDFInfo
- Publication number
- CN108676919A CN108676919A CN201810682313.8A CN201810682313A CN108676919A CN 108676919 A CN108676919 A CN 108676919A CN 201810682313 A CN201810682313 A CN 201810682313A CN 108676919 A CN108676919 A CN 108676919A
- Authority
- CN
- China
- Prior art keywords
- hbv
- sequence
- reverse transcriptase
- primer
- pgrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Communicable Diseases (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of HBV pgRNA fluorescent quantificationally PCR detecting kits, the kit includes sense primer, downstream primer and the reverse transcriptase primer of fluorescent quantitative PCR, and it includes 15 22 T to carry out special reverse transcription portion with HBV pgRNA Poly A tails in the reverse transcriptase primer.HBV pgRNA detection kits high sensitivity and specific detection effect of the present invention are good.
Description
Technical field
The present invention relates to technical field of molecular biology, more particularly to a kind of HBV pgRNA fluorescence quantitative PCR detection reagents
Box.
Background technology
Hepatitis type B virus (hepatitis B virus, HBV) belongs to Hepadnaviridae, and genome is about 3.2kb, is
Partially double stranded cyclic DNA (relaxed circular DNA, rcDNA).HBV DNA long-chains are minus strand, and position and length are opposite
It is fixed.Short chain is normal chain, and length is variable, about the 50%~80% of minus strand.Hepatitis type B virus (HBV) infection is one tight
The public health problem of weight, there are about 2,000,000,000 people to infect HBV in the WHO Report whole world, and wherein hundred million people of 3-4 are Chronic HBV
Infection.In China's hepatic sclerosis and liver cancer patient, the ratio caused by HBV infection is up to 60% and 80% or more respectively.It is existing
Medicine be mainly nucleotide analog, although can effectively inhibit virus, there are long-term administration, viral drug resistance,
The problems such as virus load bounce-back.For chronic HBV infection patient, the always puzzlement one of patient that when can be discontinued safely is asked
Topic, therefore the mechanism for understanding HBV infection liver cell can aid in the reason of we find the above problem.
Continuous exploration by researchers to chronic HBV infection patient's body hbv replication mechanism, at present more fully
HBV infection replicative cycle is as follows：HBV virions with surface of hepatocytes receptor by being combined, and into cell, viral DNA enters
After host cell nuclear, under the action of archaeal dna polymerase, the cccDNA of virus covalently closed circular is formed, using cccDNA as template, transcription
Form the pgRNA of 3.5kb long.Then viral dna polymerase startup process of reverse-transcription synthesizes virus using pgRNA as template
A rcDNA parts of DNA, i.e. rcDNA, synthesis are discharged into extracellularly in the form of Dane particles, and another part directly returns carefully
The ponds supplement cccDNA in karyon；But the not actuated reverse transcriptions of pgRNA in fraction nucleocapsid, directly obtain peplos, with pgRNA
The form of virus-like particle is discharged into extracellularly, into hematological system.
According to the duplication infection mechanism of HBV, there are mainly three types of current drug withdrawal indexs.First, serum HBV DNA is less than inspection
Lower limit is surveyed as the treatment terminal being discontinued, but studies the transcriptionally active state for finding that the index can not objectively respond cccDNA,
There are prodigious Viral rebound and palindromia risk；Second is that clinically being turned out cloudy using serum HBV surface antigen (HBsAg) as facing
The index that bed is cured, as a result also not fully up to expectations, because in addition to complete Dane particles, HBsAg also has other two kinds, and there are shapes
Formula, the far super Dane particles of quantity, and as HBV viral nucleic acids long-term existence is in liver cell, HBV nucleic acid fragments can be integrated into
In host genome, also can transcription and translation generate HBsAg, most slow hepatitis B patients can be made to be faced with lifelong medication.Third,
The removing of cccDNA, this is optimal drug withdrawal index, but since cccDNA is present in the liver cell of infection, can only pass through liver
Tissue biopsy is discontinued come the removing and safety for judging virus, this in clinical practice and is not suitable for.
As researcher more fully recognizes HBV infection replicanism, serum HBV pgRNA's is horizontal just at reflection
In Patients ' Hepatocytes there is the best index with transcriptional activity state in cccDNA.When can't detect HBV pgRNA in serum, carry
Show that disappearance or the transcription of cccDNA in Patients ' Hepatocytes are silent, implying to be discontinued safely.
Invention content
In one embodiment, the present invention provides a kind of HBV pgRNA fluorescent quantificationally PCR detecting kits, the examination
Agent box includes sense primer, downstream primer and the reverse transcriptase primer of fluorescent quantitative PCR, in the reverse transcriptase primer with HBV
It includes 15-22 T that pgRNA Poly A tails, which carry out special reverse transcription portion,.
In one embodiment, Poly A and HBV pgRNA the sequences junction of the reverse transcriptase primer be designed with
The merger bases G W of target specific bond.
In one embodiment, the sequence of the reverse transcriptase primer includes under HBV pgRNA quantitative fluorescent PCRs successively
It swims primer sequence, 15-22 T and annexs bases G W.
In one embodiment, the sense primer is for sequence highly conserved different genotype HBV, it is ensured that no
It can be because HBV sequence type differences cause missing inspection or detection sensitivity low；The downstream primer be different genotype HBV height not
Conservative sequence, to avoid the interference of HBV DNA sequence dnas.
In one embodiment, the upstream primer sequence is SEQ ID NO 1：
GGAGGCTGTAGGCATAAATTGGTC；Downstream primer sequence is SEQ ID NO 2：ATCGTCGTCGTAGGCTGCTC；And institute
It is SEQ ID NO 3 to state reverse transcriptase primer sequence：ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTTTTTTGW.
In one embodiment, the kit further includes TaqMan probe, 68.0 DEG C -70.0 of the probe Tm values
DEG C, GC values 40.0%-70.0%.
In one embodiment, the probe 5 ' end label is a kind of fluorescence radiation group, be FAM, VIC,
One kind in TET, JOE, ROX, CY3, CY5, HEX；And the end of probe 3 ' label is a kind of fluorescent quenching group, is
One kind in BHQ1, BHQ2, BHQ3, TAMRA, DABCYL, NFQ.
In one embodiment, the TaqMan probe sequence is SEQ ID NO 11：
CCTACTGTTCAAGCCTCCAAGCTGTG。
In one embodiment, the kit further comprises：ROX correcting fluids, polymerase, reverse transcriptase, PCR increase
Strong agent, dUTP/UDG decontamination systems, the gentle fliud flushing of ribonucleotide acid inhibitor.
The present invention the experimental results showed that, in the reversion rate primer of kit, as T increases to 15 by 8, with T quantity
Increase sensitivity all increase, 15-22 T sensitivity is almost the same, illustrate special reverse transcription portion include 15-22 T
When Reverse Transcription Efficiency higher.The reverse transcription effect for the specific reverse transcriptase primer junction bases G W that kit of the present invention uses is more
It is high.In addition, due to the presence of reversion rate primer of the present invention so that kit of the present invention has good specificity, effectively avoids sample
The interference of DNA in this avoids false sun.
Description of the drawings
It in order to more clearly explain the technical solutions in the embodiments of the present application, below will be to needed in the embodiment
Attached drawing is briefly described, it should be apparent that, the accompanying drawings in the following description is only some embodiments described in the application, right
For those of ordinary skill in the art, without creative efforts, it can also be obtained according to these attached drawings
Its attached drawing.
Fig. 1 is the specific reverse transcriptase primer sensitivity results figure of the different number T in the kit of the present invention, wherein A
Curve is band 8T reverse transcriptase primer sequence results, and B curves are band 10T reverse transcriptase primer sequence results, and C curve is that band 12T is reversed
Primer sequence is recorded as a result, D curves are band 14T reverse transcriptase primer sequence results, E curves are band 15T reverse transcriptase primer sequence results,
F curves are band 19T reverse transcriptase primers sequence results and G curves are band 22T reverse transcriptase primer sequence results；
Poly A shown in Fig. 2 and the design of HBV sequences junction and target specific bond base sensitivity evaluation result figure,
Middle A curves are that Poly A scheme with the design of HBV sequences junction with target specific bond bases G W, and B is that Poly A connect with HBV sequences
Place's design is connect with target specific bond base VN to scheme；
Fig. 3 is kit detection HBV pgRNA sensitivity technique result figures of the present invention, and wherein A is 1x105copies/ml
Pseudovirus RNA curves, B be 1x104copies/ml pseudovirus RNA curves, C be 1x103copies/ml pseudovirus RNA
Curve, D are the pseudovirus RNA curves of 100copies/ml；With
Fig. 4 is kit specific detection design sketch of the present invention, and wherein A is that kit reaction system of the present invention examines RNA
(DNase I digestion) design sketch；B is that document patent reaction system examines RNA (DNase I digestion) design sketch；C be document patent not
Add reverse transcriptase reaction system inspection RNA (DNase I digestion) design sketch；D is that kit of the present invention is not added with reverse transcriptase reaction body
System inspection RNA (DNase I digestion) design sketch.
Specific implementation mode
In order to make those skilled in the art more fully understand the technical solution in the application, below in conjunction with embodiment to this
Invention is described further, it is clear that described embodiments are only a part of embodiments of the present application, rather than whole implementation
Example.Based on the embodiment in the application, obtained by those of ordinary skill in the art without making creative efforts
All other embodiment, shall fall within the protection scope of the present application.
It is this field conventional method unless otherwise specified in following embodiments.In following embodiment, material used,
Unless otherwise specified, it is that this field conventional biochemical reagent company is commercially available.
In the examples below that sample rna is prepared using viral RNA extracts kit.
1 HBV pgRNA detection kits specific reverse transcriptase primer sensitivity evaluation of the present invention of embodiment
1) design of primers
Experimental design sense primer, downstream primer, with the reverse transcriptase primer for annexing base VN, band different number T and spy
The HBV pgRNA specific reverse transcriptase primers of anisotropic label G W,
Relevant parameter is：55.0 DEG C -60.0 DEG C of Tm values, GC values 40.0%-60.0%.
Upstream primer sequence：GGAGGCTGTAGGCATAAATTGGTC(SEQ ID NO 1)
Downstream primer sequence：ATCGTCGTCGTAGGCTGCTC(SEQ ID NO 2)
Reverse transcriptase primer sequence:
ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTTTTTTGW(SEQ ID NO 3)
Band 8T reverse transcriptase primer sequences:
ATCGTCGTCGTAGGCTGCTCTTTTTTTTGW(SEQ ID NO 4)
Band 10T reverse transcriptase primer sequences:
ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTGW(SEQ ID NO 5)
Band 12T reverse transcriptase primer sequences:
ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTTTGW(SEQ ID NO 6)
Band 14T reverse transcriptase primer sequences:
ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTTTTTGW(SEQ ID NO 7)
Band 15T reverse transcriptase primer sequences:
ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTTTTTTGW(SEQ ID NO 3)
Band 19T reverse transcriptase primer sequences:
ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTTTTTTTTTTGW(SEQ ID NO 8
Band 22T reverse transcriptase primer sequences:
ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTTTTTTTTTTTTTGW(SEQ ID NO 9)
With the reverse transcriptase primer sequence for annexing base VN:
ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTTTTTTVN(SEQ ID NO 10)
2) probe designs
Probe is designed in each type high conservative regions HBV domain, relevant parameter is：68.0 DEG C -70.0 DEG C of Tm values, GC values
40.0%-70.0% carries out 5 ' end FAM labels to probe, and sequence is as follows：Probe：5'-FAM-
CCTACTGTTCAAGCCTCCAAGCTGTG-BHQ1-3'(SEQ ID NO 11)
3) fluorescent quantitative PCR is reacted
4) Fluorescence PCR program：50 DEG C 20 minutes, 95 DEG C 10 minutes；40 cycles：95 DEG C 15 seconds, 60 DEG C 45 seconds (receive
Collect fluorescence).
5) instrument：ABI 7500, the macro stone SLAN 96P in Shanghai etc..
6) specific reverse transcriptase primer different number T sensitivity evaluations：It is inverse in HBV pgRNA detection kits of the present invention
Transcription primers consist of two parts, and first part is sequence label part, and second part is to be combined with HBV pgRNA complementary pairings
Sequence, the specific reverse transcriptase primer sensitivity of comparative evaluation's different number T in the reaction system, as shown in Figure 1：A:
For band 8T reverse transcriptase primer sequences, B:For band 10T reverse transcriptase primer sequences, C is band 12T reverse transcriptase primer sequences, and D is band 14T
Reverse transcriptase primer sequence, E are band 15T reverse transcriptase primer sequences, and F is band 19T reverse transcriptase primer sequences, and G is that band 22T reverse transcriptions draw
Object sequence.The result shows that as T by 8 increases to 15, all increase with the increase sensitivity of T quantity, 15-22 T is sensitive
It spends almost the same.Illustrate Reverse Transcription Efficiency higher when special reverse transcription portion includes 15-22 T.
7) Poly A and the design of HBV sequences junction and target specific bond base sensitivity evaluation：In the reaction system
The sensitivity for evaluating Poly A and the design of HBV sequences junction and target specific bond bases G W and merger base VN, such as Fig. 2 institutes
Show：A is Poly A and the design of HBV sequences junction and target specific bond bases G W, B are Poly A and HBV sequences junction
Design and target specific bond base VN.As a result the specific reverse transcriptase primer junction base that kit of the present invention uses is shown
Reverse transcription effect higher.
2 HBV pgRNA detection kits sensitivity and specificity detection result of the present invention of embodiment
1) design of primers
Experimental design sense primer, downstream primer, HBV pgRNA specific reverse transcriptase Tag primers, relevant parameter are：
55.0 DEG C -60.0 DEG C of Tm values, GC values 40.0%-60.0%.
Upstream primer sequence：GGAGGCTGTAGGCATAAATTGGTC(SEQ ID NO 1)
Downstream primer sequence：ATCGTCGTCGTAGGCTGCTC(SEQ ID NO 2)
Reverse transcriptase primer sequence:
ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTTTTTTGW(SEQ ID NO 3)
2) probe designs
Probe is designed in each type high conservative regions HBV domain, relevant parameter is：68.0 DEG C -70.0 DEG C of Tm values, GC values
40.0%-70.0% carries out 5 ' end FAM labels to probe, and sequence is as follows：Probe：5'-FAM-
CCTACTGTTCAAGCCTCCAAGCTGTG-BHQ1-3'(SEQ ID NO 11)
3) fluorescent quantitative PCR is reacted
4) Fluorescence PCR program：50 DEG C 20 minutes, 95 DEG C 10 minutes；40 cycles：95 DEG C 15 seconds, 60 DEG C 45 seconds (receive
Collect fluorescence).
5) instrument：ABI 7500, the macro stone SLAN 96P in Shanghai etc..
6) sensitivity evaluation：The sensitivity of HBV pgRNA detection kits currently on the market all 250copies/ml with
On, kit minimum detectability of the present invention can reach 100copies/ml.Specifically evaluation method is：It is molten to build pgRNA pseudovirus
Liquid simultaneously extracts RNA, and with the concentration and purity of the NanoDrop spectrophotometric determinations RNA of Thermo Fisher, stoste is carried out
Gradient dilution is 1x105Copies/ml, 1x104Copies/ml, 1x103Copies/ml, 100copies/ml, and examined
It surveys, as shown in figure 3, A is 1x105Pseudovirus RNA, the B 1x10 of copies/ml4The pseudovirus RNA, C of copies/ml be
1x103The pseudovirus RNA, D of copies/ml is the pseudovirus RNA of 100copies/ml.The experimental results showed that kit of the present invention
100copies/ml can be detected very well, and illustrating the sensitivity of kit of the present invention, detection kit is high more in the market.
7) Evaluation on specificity：Although traditional DNase I can digest the DNA in the sample of part, digestion power is limited, and
And complete digestion less can guarantee for unknown concentration sample, it may appear that false positive.Kit of the present invention uses special sex reversal
Primer is recorded to exclude the interference of HBV DNA, sensitivity and the specificity of HBV pgRNA is improved, avoids causing false positive.Specific side
Method is：According to Tiangeng viral RNA extracts kit (TIANGEN Biotech (Beijing) Co., Ltd., catalog number (Cat.No.)：DP315-R it) prepares
Sample rna, after cleavage mixture crosses column centrifugation completely (RNA includes that residual DNA is adsorbed onto on centrifugal column pellosil), addition is gone
Following operation is added before protein liquid RW1 steps：Take 45ul DNase I buffer and 5ul RNase free DNase I from
Gently piping and druming is mixed into working solution in heart pipe；350ul protein liquid removals RW1,12000rpm centrifugations 30 are added to the centers adsorption column RA
Second, waste liquid is abandoned, adsorption column is put back in collecting pipe；The DNase I working solutions of 50ul are added to the centers adsorption column RA, are placed at room temperature for
15 minutes；Protein liquid removal RW1, the 12000rpm centrifugation of 350ul 30 seconds is added into adsorption column RA, abandons waste liquid, adsorption column is put
It recycles in collector；It connects the subsequent operations such as rinsing liquid RW steps and completes extraction.With the reaction in kit of the present invention after the completion of extraction
System and the patent document (patent No.：106555013 A of CN) report that reaction system comparison system adds reverse transcriptase and is not added with reverse
Record enzyme detection result.RNA (DNase I digestion) design sketch is examined as shown in figure 4, A is kit reaction system of the present invention；B is text
Offer patent reaction system inspection RNA (DNase I digestion) design sketch；C is that document patent is not added with reverse transcriptase reaction system inspection RNA
(DNase I digestion) design sketch；D is that kit of the present invention is not added with reverse transcriptase reaction system inspection RNA (DNase I digestion) effect
Figure；As a result show that kit reaction system RNA of the present invention can be detected and not digested clean DNA inspections completely in system not very well
Go out, patent literature system detection RNA can be detected while not digested clean DNA and can also detect, and can cause false positive, this hair
Bright kit has good specificity, effectively avoids the interference of DNA in sample, avoids false sun.
It should be understood that the present invention disclosed is not limited only to specific method, scheme and the substance of description, because these
It is alterable.It will also be understood that purpose of the terminology used here just for the sake of the specific embodiment scheme of description, rather than
It is intended to limit the scope of the invention, the scope of the present invention is limited solely by the attached claims.
Those skilled in the art, which will also be appreciated that or be able to confirm that, uses no more than routine experiment, institute herein
Many equivalents of the specific embodiment of the present invention stated.These equivalents are also contained in the attached claims.
Sequence table
<110>Jiangsu Hong Weitesi Pharmaceutical Technology Co., Ltd
<120>A kind of HBV pgRNA fluorescent quantificationally PCR detecting kits
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ggaggctgta ggcataaatt ggtc 24
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
atcgtcgtcg taggctgctc 20
<210> 3
<211> 37
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
atcgtcgtcg taggctgctc tttttttttt tttttgw 37
<210> 4
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
atcgtcgtcg taggctgctc ttttttttgw 30
<210> 5
<211> 32
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
atcgtcgtcg taggctgctc tttttttttt gw 32
<210> 6
<211> 34
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
atcgtcgtcg taggctgctc tttttttttt ttgw 34
<210> 7
<211> 36
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
atcgtcgtcg taggctgctc tttttttttt ttttgw 36
<210> 8
<211> 41
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
atcgtcgtcg taggctgctc tttttttttt tttttttttg w 41
<210> 9
<211> 44
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
atcgtcgtcg taggctgctc tttttttttt tttttttttt ttgw 44
<210> 10
<211> 37
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
atcgtcgtcg taggctgctc tttttttttt tttttvn 37
<210> 11
<211> 26
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
cctactgttc aagcctccaa gctgtg 26
Claims (9)
1. a kind of HBV pgRNA fluorescent quantificationally PCR detecting kits, which is characterized in that the kit includes quantitative fluorescent PCR
Sense primer, downstream primer and the reverse transcriptase primer of amplification are carried out with HBV pgRNA Poly A tails in the reverse transcriptase primer
Special reverse transcription portion includes 15-22 T.
2. detection kit according to claim 1, which is characterized in that the Poly A and HBV of the reverse transcriptase primer
PgRNA sequences junction is designed with the merger bases G W with target specific bond.
3. detection kit according to claim 2, which is characterized in that the sequence of the reverse transcriptase primer includes successively
Downstream primer sequence, 15-22 T and the merger bases G W of HBV pgRNA quantitative fluorescent PCRs.
4. detection kit according to claim 1, which is characterized in that the sense primer is to be directed to different genotype
Sequence highly conserved HBV, it is ensured that missing inspection or detection sensitivity will not be caused low because of HBV sequence type differences；The downstream
Primer is the sequence that different genotype HBV height is not guarded, to avoid the interference of HBV DNA sequence dnas.
5. detection kit according to claim 4, which is characterized in that the upstream primer sequence is SEQ ID NO 1：
GGAGGCTGTAGGCATAAATTGGTC；Downstream primer sequence is SEQ ID NO 2：ATCGTCGTCGTAGGCTGCTC；And institute
It is SEQ ID NO 3 to state reverse transcriptase primer sequence：ATCGTCGTCGTAGGCTGCTCTTTTTTTTTTTTTTTGW.
6. detection kit according to claim 1, which is characterized in that the kit further includes TaqMan probe, institute
State 68.0 DEG C -70.0 DEG C of probe Tm values, GC values 40.0%-70.0%.
7. detection kit according to claim 6, which is characterized in that the end of probe 5 ' label is a kind of fluorescence hair
Light group is one kind in FAM, VIC, TET, JOE, ROX, CY3, CY5, HEX；And the end of probe 3 ' label is one
Kind fluorescent quenching group, is one kind in BHQ1, BHQ2, BHQ3, TAMRA, DABCYL, NFQ.
8. detection kit according to claim 6, which is characterized in that the TaqMan probe sequence is SEQ ID NO
11：CCTACTGTTCAAGCCTCCAAGCTGTG.
9. according to any kits of claim 1-8, which is characterized in that the kit further comprises：ROX is corrected
The gentle fliud flushing of liquid, polymerase, reverse transcriptase, PCR reinforcing agents, dUTP/UDG decontamination systems, ribonucleotide acid inhibitor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810682313.8A CN108676919B (en) | 2018-06-27 | 2018-06-27 | HBV pgRNA fluorescent quantitative PCR detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810682313.8A CN108676919B (en) | 2018-06-27 | 2018-06-27 | HBV pgRNA fluorescent quantitative PCR detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108676919A true CN108676919A (en) | 2018-10-19 |
| CN108676919B CN108676919B (en) | 2020-08-04 |
Family
ID=63812410
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810682313.8A Active CN108676919B (en) | 2018-06-27 | 2018-06-27 | HBV pgRNA fluorescent quantitative PCR detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108676919B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110964849A (en) * | 2019-11-22 | 2020-04-07 | 华南农业大学 | Method for eliminating African swine fever virus detection false positive and kit for detecting African swine fever virus |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106555013A (en) * | 2016-11-28 | 2017-04-05 | 北京旌准医疗科技有限公司 | The detection method of HBV viruses, test kit and its application |
| CN107058623A (en) * | 2016-04-01 | 2017-08-18 | 北京大学 | A kind of High sensitivity and special blood HBV pgRNA fluorescence quantitative PCR detections systems and detection method |
| CN107674910A (en) * | 2017-09-22 | 2018-02-09 | 北京旌准医疗科技有限公司 | A kind of method and kit for detecting and evaluating Anti-HBV drugs activity |
-
2018
- 2018-06-27 CN CN201810682313.8A patent/CN108676919B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058623A (en) * | 2016-04-01 | 2017-08-18 | 北京大学 | A kind of High sensitivity and special blood HBV pgRNA fluorescence quantitative PCR detections systems and detection method |
| CN106555013A (en) * | 2016-11-28 | 2017-04-05 | 北京旌准医疗科技有限公司 | The detection method of HBV viruses, test kit and its application |
| CN107674910A (en) * | 2017-09-22 | 2018-02-09 | 北京旌准医疗科技有限公司 | A kind of method and kit for detecting and evaluating Anti-HBV drugs activity |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110964849A (en) * | 2019-11-22 | 2020-04-07 | 华南农业大学 | Method for eliminating African swine fever virus detection false positive and kit for detecting African swine fever virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108676919B (en) | 2020-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100378230C (en) | H5, H7, H9 subtype auian flu virus real-time fluo rescent quantixative PCR detecting method | |
| RU2301263C2 (en) | Method for detecting human parvovirus b19 in biological sample (variants) and set for its realization | |
| CN104988149A (en) | Human CYP2C19 gene polymorphism detection specific primer and kit | |
| CN103484565B (en) | The test kit of a kind of real-time fluorescence RT-PCR detection coronavirus and application thereof | |
| CN108342463B (en) | Gene detection kit free from nucleic acid purification | |
| CN105296673A (en) | Influenza A virus molecular detection kit and preparation method thereof | |
| CN103834638A (en) | Single nucleotide polymorphic site rs7574865 related to liver cancer susceptibility and application thereof | |
| CN102329888A (en) | Fluorescent quantitative PCR (Polymerase Chain Reaction) testing method for cccDNA (covalently closed circular deoxyribonucleic acid) of hepatitis B virus and kit thereof | |
| CN102559930A (en) | Kit of detecting hepahtis C virus by fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) | |
| CN103773897A (en) | Multiplex fluorescence PCR detection kit for hepatitis C virus nucleic acid detection and genotyping and application thereof | |
| CN108676919A (en) | A kind of HBV pgRNA fluorescent quantificationally PCR detecting kits | |
| CN102094002A (en) | Extraction reagent and extraction method of hepatitis B virus DNA | |
| CN100422344C (en) | Fluorescent PCR detecting method for hepatitis B virus gene parting and reagent kit | |
| CN111057791A (en) | Kit for detecting HBV pgRNA in blood | |
| Nüesch et al. | Detection of defective genomes in hepatitis A virus particles present in clinical specimens | |
| CN102605103B (en) | Primer, probe and method for detecting Norwalk virus nucleotide | |
| CN103667439B (en) | Real-time quantitative polymerase chain reaction (PCR) method using double probe and capable of distinguishing B-type and non-B-type hepatitis B virus (HBV) | |
| CN105296675A (en) | Nucleic acid detecting kit for influenza B viruses and preparation method of nucleic acid detecting kit | |
| CN102071262A (en) | Method and kit for detecting genotypes of herpes simplex virus | |
| CN105506122B (en) | For detecting the probe, genetic chip and kit of IL28B gene pleiomorphism | |
| CN101565756B (en) | Detection kit for nucleoside analogue drug-resistant correlated mutation of hepatitis B viruses | |
| CN103114154A (en) | Rhinovirus real-time fluorescent RT-PCR (reverse transcription-polymerase chain reaction) detection kit and application thereof | |
| CN103710466B (en) | YMDD (Tyrosine-Methionine-aspartate-aspartate) fluorescence PCR (Polymerase Chain Reaction) detection kit for HBV (Hepatitis B Virus) | |
| CN101195843A (en) | HBV DNA gene parting fluorescence PCR multicenter detecting method and kit thereof | |
| CN105543396A (en) | Nasopharyngeal cancer free EBV-DNA fluorescent PCR detection reagent kit and use method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |